ExifMM*   (1$2ڇi(-'-'Adobe Photoshop CC 2019 (Macintosh)2019:04:04 08:29:550221  v~(oHH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Uut7%1 ȆcVp@uapckë$7fg򛿱ƏP?GR>64: |\\IcBo?:~P~hw\\o(2z;6뫭$?M~?Nꔞ ?hH$"X0˷w*u82 s~08j7~{OB 6'kVccP$9-sZg1w(,x1ДVr3923;1]x*gh2պ"FWQ Y[b7~w/saY'yj'<R$k3m2cyHB1/PuL\"D_BukZ .dS R$I)I$JRI$B`JΘw\nkV:[gqz澿>u629W>?ls&XرynIDe=?>ҨpЮ `>Ӻw2I8c<$}%ty\Ybu}'~U, sJƦDwߘ+:sOad}P{˱u ans؀ #bxxvqD֐`C[;Z~/M<*?UlbRr<gD|IY2ܤ};t >>Hwp{U@e]clߚ3ŭZ&TЧZ\xL*.ac-;?fݫ,vs&o=C(ԁI6}mI9kUq=<}ﳝ-hy7n'-r3-*߲1׼Sqe$ !:~u/yVf}dħG[kUUnҫ{=OJLB$B]_Jk[6XG9zb1LDPk([+-?yp ^N:ksl`ͤkW5fhn_҇~rWd87$̽J rp3+ˢ4kmc^ׇ{?bxGi|Sg7N׶[{Aq? @Ob\)oI$9&nCqwh8,20G=i[qNJNv= sC,꧟ϭD_QMEy:$x4Y[ c+slXs+I$B`J5&ۚ^ݦHfݵEd}h Ѵ3ljf@ d] yCҴc2Lsz&5d΍i%v(rub7+#Y*ڂjF&5yj&.b A5̽+-?S/ \˜_ջUѹi ۚǹdkU XYc^XnvTP~NUH8َAԬ*_fu!d [>ӻJomke>k-,l׎@._RcPncyZFQ%[%cq5Kfw>Q}^I Op}W&eLư|p.=Yi75/ 7ܕ|[:3[d;轤w+IB$AY{0Ӱms';!g^z$y{)˕˫}ܧiaܥMvfҳ~s|W%8&G%J漼tJ^>nԜחfCѰW2ݻSW揤ȝ;;yڎPVk4PUÞ֠R ptY?YoUF S*lt{5[p9[gv0 UnC.shŮ2\I hghwf vkkVg5r2wO$8EX=-3A4bA|dh^ץNENѳp%ƵHk_+g0 a1mo-F>3{z&ņ2>t4dA4 #2S X4L}sH.RǦI۩:ڋL9KɶH{UYcחYɺHs79n_9xWAqӠڪ?ڽ:;(/CT.h#n øw\&/Y;26mk ѭ63iuSIH8lp]sKyūOƣw%SK^m~RY@kɇ=w؂Ks\\)e+-?S/;oXtF':{8r"[2ckEE?Ҭu_B߃B+1nOKIKqPGhu!$cVY>u?RҒz>[*YpM:Jg;zکj%gQsYwpOO澽M*ˇ cZvWbye}`u<ccXڽ'8{ks6܄H쳳Ze Eta{J><ې4}Dï'ǯOsKxLqC05OQ{G&V$$n'{,/ikGk{l # ܭ;f:7 Z[kYtpt'X6}hzƝAmi=WErm7YyhqYy,9E8:+w% ;p_T9f }]ddQG+Xxa~7n3jĻ5d1XH;^6>>ZNJ1ҟ 1)/P^c{R#Uk,>̼4 ~P?o\7WmWQ]R2,!wm]"l Rp1Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMY update_maart2018-3 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM qo Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Uut7%1 ȆcVp@uapckë$7fg򛿱ƏP?GR>64: |\\IcBo?:~P~hw\\o(2z;6뫭$?M~?Nꔞ ?hH$"X0˷w*u82 s~08j7~{OB 6'kVccP$9-sZg1w(,x1ДVr3923;1]x*gh2պ"FWQ Y[b7~w/saY'yj'<R$k3m2cyHB1/PuL\"D_BukZ .dS R$I)I$JRI$B`JΘw\nkV:[gqz澿>u629W>?ls&XرynIDe=?>ҨpЮ `>Ӻw2I8c<$}%ty\Ybu}'~U, sJƦDwߘ+:sOad}P{˱u ans؀ #bxxvqD֐`C[;Z~/M<*?UlbRr<gD|IY2ܤ};t >>Hwp{U@e]clߚ3ŭZ&TЧZ\xL*.ac-;?fݫ,vs&o=C(ԁI6}mI9kUq=<}ﳝ-hy7n'-r3-*߲1׼Sqe$ !:~u/yVf}dħG[kUUnҫ{=OJLB$B]_Jk[6XG9zb1LDPk([+-?yp ^N:ksl`ͤkW5fhn_҇~rWd87$̽J rp3+ˢ4kmc^ׇ{?bxGi|Sg7N׶[{Aq? @Ob\)oI$9&nCqwh8,20G=i[qNJNv= sC,꧟ϭD_QMEy:$x4Y[ c+slXs+I$B`J5&ۚ^ݦHfݵEd}h Ѵ3ljf@ d] yCҴc2Lsz&5d΍i%v(rub7+#Y*ڂjF&5yj&.b A5̽+-?S/ \˜_ջUѹi ۚǹdkU XYc^XnvTP~NUH8َAԬ*_fu!d [>ӻJomke>k-,l׎@._RcPncyZFQ%[%cq5Kfw>Q}^I Op}W&eLư|p.=Yi75/ 7ܕ|[:3[d;轤w+IB$AY{0Ӱms';!g^z$y{)˕˫}ܧiaܥMvfҳ~s|W%8&G%J漼tJ^>nԜחfCѰW2ݻSW揤ȝ;;yڎPVk4PUÞ֠R ptY?YoUF S*lt{5[p9[gv0 UnC.shŮ2\I hghwf vkkVg5r2wO$8EX=-3A4bA|dh^ץNENѳp%ƵHk_+g0 a1mo-F>3{z&ņ2>t4dA4 #2S X4L}sH.RǦI۩:ڋL9KɶH{UYcחYɺHs79n_9xWAqӠڪ?ڽ:;(/CT.h#n øw\&/Y;26mk ѭ63iuSIH8lp]sKyūOƣw%SK^m~RY@kɇ=w؂Ks\\)e+-?S/;oXtF':{8r"[2ckEE?Ҭu_B߃B+1nOKIKqPGhu!$cVY>u?RҒz>[*YpM:Jg;zکj%gQsYwpOO澽M*ˇ cZvWbye}`u<ccXڽ'8{ks6܄H쳳Ze Eta{J><ې4}Dï'ǯOsKxLqC05OQ{G&V$$n'{,/ikGk{l # ܭ;f:7 Z[kYtpt'X6}hzƝAmi=WErm7YyhqYy,9E8:+w% ;p_T9f }]ddQG+Xxa~7n3jĻ5d1XH;^6>>ZNJ1ҟ 1)/P^c{R#Uk,>̼4 ~P?o\7WmWQ]R2,!wm]"l Rp1Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$poN]}b?_cǖu"*-.q?SywP^ˈw.=~yoQ=-8^}a{"CO'}YNLxޱ;U*C>G[Y>FE,{t!ET[?ݏ=:~V?jN>c՟~*]~r>Z5ckkQG喺M>?~gǯ>0BT+SFC·͇9`%4W2ן0xc18.0'Y?[b^;zCxc1.[?'b7TQxc:c*W8!?$u*ӕc'1,ɠf>"x kϚobr?q>j3~Fj,O$޴yϸXC竧?A,]K>'ܿV*?>ɋĻ_*#jŇ y}!(TIgl- C:bb{Rsy9*>c_j]x*ùH3c?C8O$a:CkGEM1Dzn.1Wͷ+ۊǛ~O1>#\w-v'K^ǻ1$o Z}󼇤hc48Y+es_򴻖7:,?ë?PZxI8A@~N=?m'?+Oi#qT'l1=?%w~"*ӌ?\Q?%4&?C@E25/Ww@A~d_pDG'E1ːj xǏ ?򄻘(iy8 ]*A| ?r(Z|z721M.VSO#+cy WL*$mRINEˑY߯eNys6Z,ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*]\]\@uqU#%Qn(ml<AC]A!br$S#\c]Ky?NxWۥ''<Ww-Pi?N ;WE1A\-w"&ca׮!_m[>!xncXb\=-_Gq84n(?,5[_ gQdQ=X}lwؿu+UO6֝V~U;cqtWZ8~Tk~?~{{J6*?(΋ҖώOy@}8.?E.{1,LM0[v~x{9/7 oVhӏ=oؒ*lU? CJ!]=i,V'/z̃wVqq-j{Fb_hwxGDc=o;ܧr?ү{A\Q[?X؇sGQ/W󘿤-o6D?`Odž uؿ[+S=x=(?ɧwhr])Ǩ[?FU,y9|T d{(G򼻖O'/֝_`Qr?ܱb8tF=VtZo8w':&܏i-o8JZS)w?N7я6k1A xqQGp9Z`OmӢj5˵2&d 'L0_- }?@ɞ؟@Crzv8[=팡{K'ߖEvGBnw̜Q?/tBKVƹ,qXꌈ|:̝.5ˀ6rNY>:@vHD~s'z.H_/aOeG:!c\R?,YJe;f}$d Y%Q޿нrv.ޓ{]wT?őX/C(tTS2^MӔ4~+dN}C~ t_d(R#ޱXMe" Ht+]}~c^C|B^P:q!P>OAqsRo:EDP # Q>Fyex-1V@dM)j<25JY@kB-r89TԖTR9-+tNL[}\ DV? aTjPLpFqZȍDb2W49EM\ v&QnvזZیK0nVQq1)[.iO|"%2-s~Lx-`YEq7TNPX(q!N8DbH$eQӮ"TE-;e-LTS0slxms4dTkN TEvmZƐuLYq/@Ja/As; v0&X%w^OD;MAzt`#׳b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊'Krb2&XF0v[w[_SF ^y.fP8ݑ/j[ʚtnM6LTeŪǗevf3ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*bvsH" s %pi: '!cRFQQҺJFqZQE[GG(aҏA!JK \[NhiXK{O)ꃓTuEpG8W.3T4̔5#o 8ʖ|`Y8I@kE=e=xzk*u@~_{ĹuSБ8X|NM: ;!MJ?F;pl-AEk8!ěZ5_%:\xԥwb2Wz`[].(~gȶ:)5#MoPһfҽ4,]H(*N 2%A6[mu G3Lp2נ۟8[[ZzߥgVpq(tWfO4@6w-]qVbJ IPOWr0hB 0J,Je@ eĝlmjԚ kD)qSR60JehC}sjcb z0Z3Տ x<26SkIw~`cjMtwe2oS?dW)*CpWnۍ #,+<}qUOԊhw9D/LvNǠi#Tr4*FQKE$N $W~Xۑ,\qoMzƹ$ĭSևkƪ~/lZǙNs46R$N)VvNT\rQđA[\VB3& ]6!JƸ8LC+7o|)YEWQ\i CmNS|+me9 ZԦ؂YlǑڝ$;丐\M41E4lj *&^YF?|6@>c*M;`UZ-vjGs*Ub69WK Үhюq"z\+F'*xRcZkVؐPz *J`bVMN:NW ı!iҙ늬Z0Zi*E 2AZrⅿcT$2T,@0-k;92aZA 폡 %ii9Lڸʸ.X/QAڗ>-VMت`}=)z\-1;clT n[wm 5r Pq^Ո昝-svO=6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvH!(ܟ\ayG~Y./H(>+]?_?.7dNaCړ? f _fLyˇ.EBF͈ll;f$S&.˿4ivOs ۘ'~,Þyz,>+KDJ~>DsعZCKf[9v:F\??]$cݘ_(=&>y_[-2iOnϤb=YOũ`k2CS??'e-S6/U0.e)?~O?ǧ.>ռ'!ۙ?LJST3h!eOXKl|2z_\y{?.^a֍/_%|ʇl\]xnW93!gQ;ٹ7s s8]|T362p1؎cַaVM/Q֭f?N/txQ])Yz]mK~jx7ƿ7bceqpHb9?K'Wj5hnw[4'.>CK8rs>❑kim:4n:S(#FBB>A.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* ɧAu~i;Z騱[Tv,y˨Sr(i-|}KSsvQĤ|R˛8A,b(1fC銡r6nqJV+HXZ7\m4r"bk3JP:cLD]+i큕4nN<=|1|zbŤEݩ\TҢUzRE5ҋ;8CNPMHwC0)j'lJכ]x@b\zh J\/킙' ej ,zf %@̊@q2rli@qHVT;/nfbjSn~B~ .4`7\XY%m@c@~*}, L*8U RR~*} Z6)Dl{׮6rV 4kx1g1P+pX~Z )CN)^j7@n55 6•JѸٍG*ءP}{Y*2l Z_zUn ) ^2\*aBƹk.#恘r+`U4ld!_My%Im md4nzPs+rITdZěW,jǕ7 ~; QE8o]ؙHJڰvaQTc O/RvF1M;v_م*wlS>SQG);XvNz_]R.yN0O2/\js}BR_lλK&J?;/7(5cij*F1gdc9vLٯs+^gC>KG[?hf~?ֹ; -*HrIӆeGbR;'—mXlşbb<÷bM{ɉ{kogBS0RS$V\_y.5=H />-?\aGVG12觌2 ҵe k58>?+dt:]G!$<ӿ9gZ-FJij?nH}qz]nog~WdLoSҎ?ڸru:3v>|]v@5%jz5ZbgsLP:>?nŨOWd5ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊, ?k qDWъ?W30v 8Z-?❓ZVEQ'Kl0v,/:̓r8z@Eshꝑ}Lժ螄?mGe˸y|6'ćg;9/u-=?OnL?v-F{/vE3RݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$CoOF1efkdn*IP en PPg)FrrCiN4RɔTobSsAL $@ ?ݾC%| Pb$AsZPnAkW@Эyf?d^BeSB`کW mO.vH]$J[juS^k|}{f:I ߅@=rj0Lm,"5񼸊R-4%6{eHp1@ưڙ&Ml|Uw#(,iZ րch;bTEy\+*#k SmX`;[5#5"`8Ud@UdfNvTcj cmIolk iQ vُCE:bw׾aU{1[!dJcjm*Y'|ծے*|RvN2xsp JDQJNr p9G?yM~$Z+|?g*q $j5i\hvRNmD)to>ֈmA_I7>ݳBWrA1%X#/1BAk6R EH"IK#q^@zt lګ1/[O7G(_ <jTqFᘿǽN3Nܟ{9OtZnǗi~_?st]揵`enQ/'- u?Oɳ`>|~G/CٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$^K3y~\~YƃƋLzk>g , SuRq8Iu:3kvRZXPnc®(&N,iyzm ҧƒQm(~;%Eۉ8e]ISA1&`HmbH<1J)!׾` +\'Ď*jiēPhp YӇ$8m+IbePS ڮ5h6Ă1Z9̻s \c.*՛rzf|ifhɗN7&EpB^,LR:oX,mBÎWiJ~cAF*eJn=D&+cv8gl@E0ZU`֋ToUCn=W\L]b+U bhW*WX|,JYA7j۟ b,F1U'jv[ K횕3 ZO\E7-8<#햴VSM&A-w91&Qk޹(d̒M 2?''8y_qRIQ^4q`YhJPSa poPP\M<5oLb5HZW 1+ENZ @x\quڑ2? W<޻ec GNWoTvM*Gz8"G(|w CI_WlQFqvljF)+OcBklLJ4Ɣڴw C1EC#2D*֢S Z"t H\#Dbxm 2\΄qǁ\biqiB*rkjB#iDCɅI; GЊx18mx5݇Ze#4jq0-cSlUH V08|TUl)̿]!dN'avQgOP*gs}9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]]*~W__9h&Y}Y=g/vqzq'gV].ogo쳯Â8G  gO4x CԼ+ʵ`3o7ity5&?V?մDƀ&7!9MOjxaG^K,nSy|D}^3?|_<gwk1q_'z'D򽆊l t}<?/%Y7?һ 3=vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUMc0F{0ݔd8f#p<Zhq=})$(;?Kz'oQ%!?]?:הfXH#jUSFxOoq`GWgJ H.OSĿΫIX}dGYY4yrJ9T:0VfQ]L&`ll~kI\Gac߳1`}XĽ^ }9_3ZKi#AphUZp05!'O]N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b|uەbK'fOxKk4ًk8#ۗ6悟FTRhUHƘPR_PO,R߫/^E8SX܅Bc, q4AۦEB_lQNƸU.B\T>y#& !LF`*.=7M4TvV0߶nU>nCD* _82BA-'~c, -ʰ(Ѷn8 A_T9JA"s#8r6뀕\i!9Ak$%SxX\L QoטvF$_|-)ׯ|rCf |[dBjXn-|+k IJ1l+8?jOޑ;/A2doK8`A$xU޹W@îQW|Wb|qޝFC*6P4ڢYAKm]P)M%=r/JdNɶ QUkWdOlQ8J$ճtjTLڸbr*W+S\BmLPx0uZ*{S V|pֹ+B2%V0<6|9n6ĥ>Q>(u8 ί -xc$4ᚦܞ?oSZڨXLUђv;f YVoN$Uv8P@'(JUː5|)U@OژQC3;ƒs\ W~ O 1 OjeqqU>ҁBI^W+]ʀ2=VڎW$+?϶%{_E(Ɯ^NxS;ћvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vi:=֭8C$à-28%\0E6xa ]?V([Oy֤|(.v̎Ty? y=1/SK[4†YX"(f4fR] fh;96EOC36/+?#,._?靄?2hsS,,/s[/L?NUxG>[^_򖟡'$ _]c=#xV&ϧ9u͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ZU53؎gcCÞxO3VH&hcOV/_?<>ی9}?vMS < hCx[Vggc8'Ji:ծHsap dSm #QV~ٹZO.McH cjK*@[\#f4+}e ֘mUKRiz+ ie+(_gs}MWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU$n/e?l?_|h3ԝ0)whCJ7d6.աy~E[٧c1g9Ơ>j稗LC̞j^VB>7VCU\͏6h3ԚS96t)(MV 3nee˄?KC_W1vNckqiqr7 7>Ɏ/Ty?9?Y?d:'vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUCo%kZe~/_^A @?G&볕_:VYSta?GG&Myqg?%QvtO'bZ|miN5_1,t=zr^W_3_d+ g||rTCItN,jEES* `k*l@^qECJָQj@cj6f}2vڂ@97P 2`MOPbJnkL6ICH3qI@hM&~yap*.%>%uǕ^MiOڥ|;x6Sk$m)s (S.z \9D׮)T3w;v"|2Mg1Qkw7L ]&?c\vCִ 5풥a(riCF("l;|XT M}WQLxߦر*+Nzx*ۥH s?>T8xw;o6P~Y+Q I تv˯LTܯ^N2QJԷlgǶ>pʤJ (}9PЯ`rPW ) m)bkT6\8U(ILc7#JM"!P'tFh~O;T5 klܨqKf6u,,4 $Px44زn=-/PĎR~bRmO"ii~(44v3?˜xRFE ߭vF=MGEiEe`2x LV1gb#й|6*?ŵ: h4*"ISr,**~(56…D$!+ȍ%q^(I%OozxS4CF%zf/FNP߮n-]R-q2&xe~96@Q3bVd4" aUڦo- D <;t8A7*:mP"Hۊ~v0w#P)Zƣ,(φLhxl!i["f04Ȧ"+B}9NHl ԩE(qqQAE zKe7)*ruz T%}*j5醑ky-Ͼ5L Y:e!낔I~-)WztBU:W?,P[[*1Mzoޣ$)kԜmD3 ?~P y,*<2wYv,"Limpy# [/Q 6goV*޴,%7sP8BISLd*~z;U \O|4bzR\vRBH7UU/.Ґ=VHKvQ2"M:W]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU7Gw4ϛӛ?N/:QC՗?K.kiKAEU;\p11x<C#);">uŇFicIo:3]i?w2럣,=ʺDO3_S >&\r>/.]CW{C8c1-<0 OQ.)Ucb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*N+ F⌬*Sb8n9(;9O,ey$sV_?G['?8Wӳdde?7˱%g4-h0X?]IdPC+ A:A2@vs=~[--CI^2xGF*?1?{c';9CBU؃`۱ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثy8u z.4z" F]"LYIPԜ?Y=c bڕrUj)E/q2`C^|hZݘ?<7ȥFڴ勨51jC;PS}~<.ԞAc; _Ձ+M1Z|aa$j^!ڴAڙm01զN,TjͲ1[wG+ڕ)]IUMkC/P-tQQ`PAIVStZ r}۶4.W0"֭BBo10A%58Zo:T7y3ʀ  4`Z✸\CJ˿7ck8zd*Rw8$LAUSS0)*7vc1̾=0Y4 {*"4b:{׮b M[bVUbIKKMH:f]pE7ZRNQxa*!h/(PmfWUIڸW,TđZfW`NݿಙjimuiA+DJ 37mtq64a~/\kS7+qjW,oN Y*?d-VE/H ~_~+ͲUZ\@S(tNJ8 q4tB;Wje#v)XEGS3)8UnDӥ?9D}8P]*S5^hbJM(uڛeR38Z|&TmM"F,PWs Ȥ(b/5Jtp2VizTo- p%v)ƤoQE4U %iWn6 qzt?gj)mtq>P@) Wsi-[u]q?c$5^R6_E~&5erqJn{6,Qi; T{܎D}k ZSݍ`EqZ0Jer| (z:tJF ssM.xF+MZZbf% ޽VҠR0!ؒhO:!BJ1S]?$^(EHmጩ rE@EhJ0jǚmV%P:ߦ&߮7jm\*7$ wʃ /Va_ar*5$.>n=NxI5^Cۮng}q8:uBMI(H:>,Nbjp-]Y?mWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vt? ~^G)Q:(<7<_^O?O3ڝ~/?g[UTP6 쀧$e<Ķ?1O[;V7fU??;#: ۟c;3ʟ <\J־hRn 66Xc{XuGJb1'~ F#8ZnwᔶXۢ7_Lm>YfQO$uhjG-; 8pھ8cҸ"Z7mnP r&6L*vr tˍv.S RIGlǯZ Sn@ ӑ(o-M#aR#o2Vh]Wۿs$Wm낕BV`>cIV.N)sTixu޻`xm(T3o\iU8mڙ|I޻R*@6HͰ@BCmǨz`bVbۛ ڃP-wޔ9+BR<6r*>*HSZSH-UST`Ԛ`RfPr$) )XΡPAۥ.r+EZc@AA ۾-._;WnLȔ2$'Lz1bTx)SJVʀj XK!TT rىUO) FUcZ!ZzvvBfqVH_4kHP)qA>9*(ʴU5۾UUO"k&*J ӯӎW;a(Ri=qM~ERrv$a(\'5PƇ#iUfg,) OՅ m:;rSr1v[|Clz{bBo'-9t5".r 6{,㸊W` PgoT0 ZuA+Zu?rʂ(ErDҨ#$CC8|'#8s?"c?yZ34a؁?UĝȨZzn:\&H~ wqZQnz™Pu@rJPus!'Ol6jOT M ghb͊6*ثb͊6*ثb͊6*ثb͊6*ثb·{%uEAo'fo̟ ?g{S??_.ι@ϓsvro>am7KjA^AO'KO?>2?K?1帇%d'R#k9|>\^~+Lj';:Fuo ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث1/$[?Q)ڏO$'! }v:cӓe?4}X;9+&57Wlڬ)zڭ&=~1(Wdy?ǥٴJ NpVwsG,D}/,21]O? u7@-A {8gpۻ8g68*hA؂3"/|"ñ ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ ͮ^%7_BSZŕ6CEQSg/+ t*H1393知Oٸk)$ĐQ9| F;|M(/`EYp,dg @tpQY|q&G O+"CHU b}8E~,dBƜXԟY~Q$0XMV7>ŗDžZ] \Y#412COsSo阩4 (\@Z@# kky 6fL(-YyW&X 0`ՠ?~) di_~U7UZ8`: I-5nHBOJFQ aՅ8A`y`*N^,HST>ЭE|r*J(PҿFoeRFT7aM0SR?ZaMI5y ;~,J٧ Ar{^t>B_X@=z r ^U)3{s*J%w=tĨ 6jcW; Bl[C q p"GdT1݂hi]* ! @6aԍy(fSQ™j@S+a&<W|2>:b#bEIG?Q!|QMNƿ.XAEkes iֽA]Gor7'esX  B|iQ"2EztvR˵:PӾ4PmP|e Bz[c%BJmڸb"̢$*28ò+ 7~UPy0Q>*mS!༎.U&iL`n]?>(U-8LNRzvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vN/u"3G9?<j?+73P ;) vr/>m/LozG_?ȟ_Sq^'/G߲/O#)O.-nc?>?\_>s]:gvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]7>PP.P~O[tQ]hKK/cZ/ZK??VOMɢc//gc bQ>y?I4BF`*Q"QdlR#E Q==ҔVDAhSAC(??##%r=ób͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثU|***M1Weav_oӲ&8;7f_;7&]TUUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbb8b[Phnѝj`o5غ)#M̅}ci2/i5ރf$қWq+j*m~#qO&ŷ6yGHy+IpyI9tbiD_VA#hO\i$RiD5_qL29do,l 2SC̄E+EHEII[! k֙Ѷ G ǹ_׶`!PBn?q(_(ƵYkO^W*t-/) 30d!Gq$d_R9Pu0EDL@A]r_Ց)QMpZއ'-tm #5Ewƒ ap¤}S0eb?MaRI+F)\m2^0sBGSͺE&Tn` om$k֛ ;}تdd;ccIv# N %(mN.A5 W߾EUvb4O;w A #;urn{HeK ׉5!=n M:1П~"K  e,11.hփ$uʊ||pҸGD;qaa㈊myƍPl=]C%4HHOR9 ZbH4 Lm\ K5,49J܍* @: S )]%3'HO,liT5-:}|+^i ILj;jeY),0 7%­1K Mw^pk+֘ 3DÁ*t }3+-j7̰5"TF ^a;`/iU EMF-l,T[_h06"'9EA@+#9lt(FG3u8[vYL8ۭ1!P*"YA<#=VF|is'2mC$wTo5:q5 GW$|!4*iq@O}1 g@-Sjw8v`Vo`۱}ioݒ@jI7 `b$c]Wm ;dZ}94WPɨc E :wƒ`j=4WjPڴ\rE޸j Vr:vƘZP M:,V,jۭ(+ɧS[ iTo_|Bh$䞟,5XشEzv=/6*ثb͊6*ثb͊6*ثb͊6*ثb7't2/m='_NuK )/?→gu%BF*@/!2Rvs_̿=}OmLM/lW9[6O%yؿϐ; _/k&O#5jq^,gRgGΩ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vG<|o1jud~;~ ie/?'g6n|weSO9}Z98}O_]N_9;z$6FBpXt u g/GX_ݓYPv'ؿS?~ryy=[b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbbs*O\Yj*v*,Pv֝iine;,7z "JczȖ*O#jqjur'YC!MTW Wi7 E h Y&jr20+nsһq eN\ A!a{}9fBz zhUGQ)=W#ř\RE+cEM.&+yUhڟ0n=iu۟R*Hv̔551'gL5x:R^Z)e N4TX}Fݫ+Z+Pߏ̻ dشǃ AOYQ}@hGY MX\^E]1N(vܚTPST6KNsTFmTKn2n=0*|ןڭ;k RCJ $ic<ҵe-%UJ1ۯMbv_ e$ߓ׮0ē}!^#%OS$<Vޝ rvETd$C^,B.!ezWZUkFfޞ=s2V`+ӹ(T}T_MN2i:Z"}rkZnpxҧ1ա?N[Tж*6Qc^S@*1 (I Z ݱ6$Gʨphzf `7mj7Jl1e-Ӆ恒Pd%>@)ms@SyӿJ6Q!V݉&BqS\NyB[$9&saō7#ўG]vlUٱWf]vlUٱWf]vlUٱWf]v8)mAW<*XZ4`J#u*,vˆHN;|V#犪 QP-܍9}^Ťyztt]Ǩ=N*H~ SzT;SjXwG5@+GL؏lQӑ0bc%Ue#m T5c@+Rw35JcJ~8UeR9PSqiM?CP:vlX7µۿA*ֽUirH QA [nF,אS. K=qkQ'@bǐ [WguNoK @#C`-z dnQi|7'H5j87w+=BYoO *UЎ4sjuEW VV5 tޝqIG@v {b@~XIZ˷Lo*SoEsZ-kJM I#{u8O $8A3nG_4`UIMNծTcP(}Fm)g#jPtG(Qzկ߳E6F؃W=?Ͼ6T$%ӯMq=`HX) eTE<0*O/^orD$'ƴbUKmFHj{~(F/ 鄔!* \7xb ȫ:FS=EK!KT뙸Ҥ V4p-AsTYTŹ M s LmkTzOTHFfsJxrDpw$,V$pd CɫZR>'q\vSjLN>XRc#;S}cZ႒JEFi1QP* 4ХQڀ7o,j:cLiԚ S :c(sC(A1hՆ@趾 P|Y w0%NH(8,ƢŒ%V4}CŬq=~Y(sR W~?kSG]vlUٱWf]vlUٱWf]vlUٱWf]A8_yDhVG5w!rWK}?C]~l,^_kJ I4fVT4?WhΦ|#96.W/\yP{L*sDcM-^C)?VI}/gCF_ӎ?ꓳD`*gu"(>y).evlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`W[K}([aZ f.}D0ri1sؚ_PɚvN\!wO 粮O?'#d9ѿ2ME `%^K;WSW/Z̈́]xkvJt蝅detm™"N@0$m\8ǜ\$a/g ϗ]Lefn͚~ c>kNǦ%/s}+ʻ |}%Gi *\O/D>{,f&O?"?uo1NMĒK_Yٵ>~'{<:_DGc`2jEbQy.m(};_d]_ yz} O6T4憣Go;7M,eq[:QxD]Lۺgf]vlUٱWf]vlUٱWg2UCk6KGϜk?JO^#?%/wߖ>rCJo?']\~G:ggŇ/dZdGe\0 0:6X&'egm"E3ױy|%/<_avc6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*4қ,ðl{Y;QMv>vjˮ*rRqv9*e1WbqC3b`Wf.T7$$b,4ɫ‹b~# vM]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثث^Ϩζ^F4B" @Yh79o-~#m܀[se;<&QئpndE=xݳ\dwPr0&:d8Dn7=*7(2$̼454(ۮ@vX+ZS (+ʵ7AO W6RA(XLisb@P>zYˋ?Y|׭qKkoR p\myPU SJҕ?<-HX+])ƇP#~l:W+`yBN)V S(ҿܜ*)Zn: Ntǵiӯ~e1BT+JJo%kHo҄e5O|5 Ĩ>"2T RzH}'mp.*Qu%iM4#[mƆZM*ğ$(AUUoihoæd)ZZ*Am zDŽU#Z?ja,mIF%wv2r,nw,-w`qn?緀+S/e; U֤}m(ƇDTou…;kQt£~i =rTSPmidYRVI >!O !IR .Cv^϶4 T1Ś)e~w8]%M.SWv< rL]P8`) Kn~yW`Jt1#^۶8o$IUdOsku큐_ H;bw`NpפG:Mv(A"Amp H5 qN4x⪩-e* dT-DIY#N'Ku|Nmuq! t9plg$ǭ&(~ JAr4)Q]НĜvd6DT*V%MAċ"z ìj踱ƻS6)4٦4(=6r6z p 9I 5ڝ%; J2܊ת ГC_ d%V*cIބa1ejf'b4ckDXzҟf++QxDŹ8J571݋I8$T91VRz-Rb TmKLTDxJ*5۷\x ;#F mzޟ<"+k+AzeVoqdӋ%;=q)%lH,CڛeCr9?6[u8vi훑~MS-۷o,I$LmFUx1+ZTQP 8} f|Qjm^AcڪecR77o㍨R!sZTb1}>q1X|F68J ~|m )_UD؞O]Wjpks^ч%A 4nZ6!tc/#(wAZ x9gcV րJ-}V*I1ǧj4引]V%B-dZ֤+-4[q!E*:3w>ҚEB`jq=Qs,6,m̄ՒsS * nҳb͊6*ثb͊6*ثb͊6*ثC&/#9o24iq9.Bi|:uvvqP?/Hňb~],_T_|5|+FccsGJĽoahx_}m?\Z]\w)?ۛ0cxx.ɖouٱWf]vlUٱWf]vS0@I4rOl4 vC=3O&+nWR F*v,{G%.]KIv6(ff3W.ݟHx?es]~6_Xyns~ uK%bvtWaň|M/!F+l {  9 cQvNsydSB>zê٥ho{ز@~LKIdF5=/T]Ǵ13xf]vp;TDB_ѳϵQc=\W/^{cyKʐy~c@ ܟQg::hOKU;?GCN:`mKLk[ R,xd=.F!(;8W4{+jF$r2)ďlN i2P?OI#d}^vv+닭XE|(>NwZ=GO7=鎟!_ ^.z#7Hfl t]aʳ'a䴴7>kcQ޻:~u~i\G*=9HѪ|#fpr^RvG?&-_Qwlv __h&*1./ZgS1yK_:x_%e9k<OjNjO/w;;z+NM}^KA&~ ?g#eG:]1HN?Qvƙ' A@~/^pqy[رL|9'OR9KgG/6vHjvlUٱWf]vlUٱWf]vlU_VYOՇ|a'7Kbqgޭ?5v/Nem/KZf ܾNHM;0]-N*Mև, vj\k!XE0vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbM'C@XG^di/lda|k&? >$B'Y[$p;0t͵UO>`~;_ȁ,?䤥M8݊(ѵM-:sҤ ??*×T6$ݨTvj5Ɨ iUX2.\j_6Nf.?G]َثb͊6*챊;䧘V{6 ~k>/ hTTt,T_b-=PB#~ _(b8(Lt#| U„5lw v\ K V'zt1DU;䀥wK$aTTTPɀB-T}Fea,0Xz~|CMr@1Q~(}Gmd8jǏR)`ESR)@At*M@l=833|@ v l)!fVcn#jRj\KOP]s)HpMEOӕƀ$J搻mxq[FkRhpZpVy]JKfaʢƹJudl`a2vȐY.>Ojfl)I+U1jv+AdTVV4 @ՌX>y%%P ; v?^g$mjcxJ0*Ơ*AA\dBA4#l!-P]Z$p@1)lqQŨ{bi2#M Ƒեr;z7O9@ tmVf>XO~jjL}-Jb+\x;ׯ"|0P[c9vQ^5,S.AGAۦ,J)@OR:G; +[bF튅)6cb< vKp-^W Bd(BNS%Mi}YZ% jvj]O1 Ӡv.Q$| ,~YTT=rF*#s[ {:tDb~.0'f8j1=2.9- ;`cn-MI SeK$k@GjOSƘ)2)R 1r@`h; "9Bn]h+߾4N9S6PݯtSrąAޟNFCMV&Pmba~GP1o H^bm?v*B)).?P A֝; GAWZv8RCoE  C^H텏WUrӐ2Bڷ)KPPwUҪOBwC^+M@I}㹑R{v[ n(`Pa }fva&ƔH\_N4]"[v5vb娥)JԬ )N/]lJҴcoj^-V4ڙdSdwe5ڣ[~ ZBA"~3Cm|{hאl)eW$ +ʘTQVƝ{eZ9,ڝ1L@dw]q.QܷLP?2h~!I0us9oU4G8#ަF?L oO%B~f^[Ȑ]!(Mhs?wl$5G]sW~ClVf wYLIotHi+~3}'Y>_y;oYOF/;$~m hVvhd? j{6zHίA:Oa{ sr߶ ݜfiN'z9kjƛ=3?];]vlUٱWf]vlUٱWf& ~{O$Z+qz|Duc:ޚ)'ӓ܏u;?\=3x~_-~_Qz%,xeV̕gzno2g5ؒC^xAs'gb]vy7 $O^N Rl?,bg[n{a8ǘ_ܞ`7u_6vlUٱWg>DPE'a5&s='pzS0|x·$3|LWVGȿW&UY6=n&ćЮUY[6ݨ/7dD~?'g1Un&]D MA)9NO"e_{U#~$]~s[*ۛq>ݏ_z=J?]f,īTAD9_ LcW1v2@/Z_L"hv⻒z?i;=6^Ufr0 ,O_ݪ~9}r}C?4X;={]vF5ˍ'Rc'`hxr\OGvA~ثb͊6*ثb͊6*ثboۍZ{wOs|HPzK—?tߕhIo+=Cq×v拂^,~vK<ˡGe&ŅQoQN ;P'g.dq؎ 0L vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*=Td[C l/+-b[v .>bbk:ǝ*k@\UHIvAО'JFSVA͊6*v9!+,]B$PC$]Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثB?ILD9!?f(͙Z|)Oqu9(ꜽ89خt-61;'͓j81bti^$'5ٱWf]v$udsco65' cl81'c+]&M.! (tu?bE%Q .lᛑ3GO'anc76*ثbS,bsUd.s՚}p@?~rHc[`4ɊʉT߰*|$PlzPN Ď5(hz!y R0 ]Ĭx??ޣ\jZRw; \Ie,`+qސ] -awn1ʱno].Oლ'QMqi,zA^[S+7 mP+\E^$S|R&G椵Wbv 0#W*CrnCjW8mvЁM[l,QwniS.ܩzon8V- 7ĨpLK i`E(`1*Q  l( $R@4j7 7&;يZ߮*r1cJl3s M; +~@;S;nAS|hYC(r;_6?~3'*~_ Hu#~;xaS}$v4؞F$h+C]dZqڵO0R(5f`X4q}‚+]Ŏc ,jO!"r{i#,:(/U+O$Vx>ӕ|@B> }k5XVܾO)Tcr8| 4Mw;}R vO?~oO`i4\.G&P~ FǩVvVj8 ׾Ey/ { Oߦ9 B껓QS⤵,j N˝Sd9eM&SzVlUٱWf]vlUٱWf]vlUٱWf]MkvH|Rg>AOǥ،g" ;l1&.-TYU≽('o7ij/~z#)za?a.Ϋ =;8**~?]Ӎ<ԝFC3oa.LpvlUٱWf]vlUٱWdgVm3HW?jg?Go6aL?yg~Rhy}%l;W fts3?IwRqAx'f]v6iD1c R;ݞ~?u 7δF~R}?W/1vz=%f]vD44y۲>Ufq'}ع//wQ9gpf]vR5?vk@^UviT#IqkcʳZ2{.܍?є];ݛvlU hrׯ8N{dWckS_Tϴ?D^kou$#tzbcC.?ӏgҭuMMmoԉaPq]rqFxqq@ˈwvucO%W ,pUpTwg9Ǘ/,g4/:ˑ(}c'0gdO+b~':՜}pevƈi\_d71g\1,G.y3Oi czC͊6*ثy;mf8EIZĀ[<_ϨvtD;ͣ3AI)?:g$[@5[-ivlUٱWf]vlUٱWf]vlUNQ*„f n7\ؒڼh8F9h\7lud߻;VEynk?g;9FXGٱR0g1:jЏ_Jv`>f{kM!{D??/g7e]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*?!lhv25*(!& 9Yd[{AKbJK*xev<]<1C3qCb͊0]S Wc®ErAg4n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثI2 96 ϱyb|,Q~':__γ!q~>oGk]b΁'iiukw2jke|tzGF8ygheCx|/3Oat4^{KE p&DsUf1GiF>LJ]fl1_vGs\]vIc?tO!0<6cH<gXGj=2rfٻ6*ثb͊*יXӽ`zg+O2xpˈ%Zղv9>F&sK-X]L\xW%H 5$~W%JtMD zqȄ[u2%J6 Am hWy Wc OђmVqQJt?~8nW·u Z悄u'&Rϱڦu]ᒌv{e ;`Ijf,Ǖ)l1Bs̰m(T~ fcUNeס @|pO+Rє4 03p W*'>;f-@%C93 M>ҪC҂oHo P)6RrU(l{e;]@(cW&F^-Ri䠶 34A#lE-.RU.'5XG@AJJ s_LJ+B~T/Hnzb ׉ӍH E ? Z\bbXsNcUj6C|Dtɪ H?v&6R7)")m2P)L#d0j>C`;S.1`8$nE 9Hحxr62Sp GɄZT({f@m iK1-k*lޭ7(ClOSPo»aKL 'uv< hWpzcHZ7LPJܣnQa[\Z;׿ݗm T!9b]Ddm?ծ3Vu!@Y~;Wb=}ŋ,:(Rl@H [RF_[_a#CLH[ci)EVִ'W\_bU@jFb?v)](t?_nȌ>2xw4۶;ZX€Kz«2O_,M4U޻M»f!##=ŏ$bvC*ZAnqXS H@YǗC2=rD<ţ65 ><HƝzbp {Wa (v~Y80z+7]vlUٱWf]vlUٱWf]vlU+^%a0]4q~_n9Z~8ݕP\vC?)<܏/O4}]nb1Oίû6*ثb͊6*ثb͊91?RSg~Y꽟_~MS.ǰ_=?|9q?;;zC͊6*%+oնkwvr/bᜟb}l˷?:.4bX3с~w2|26EîZcqL<9gHq`bom -ʌÎSq1?m3 vyLI(!`x?yg58Hax$3$Ѹ t FBBӉ.en͊9jaU9^Qw``&Rv+9m'aOY:?.Yx`gOFq/dPֶ*W23^a匼_ԗNSaGWH;c??,;'7OGK #Es|1aۥ*z+gk<bgeKO;;޽RּZ1)qD'γGDwICwwݡ ~ povvvlUٱWf]vlUٱWf]vlUٱWdO'˿4Bu+OcN}x_N~Z?F_LvG?(|C&1Y"o}aL%+LzRVo-O/pLLN;i38aA5 KꐘLN['f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUϥ}D`ȖNǨ%ؠ<Tm;NƙʢC(Ӷv&ONMO`2\*kjU<1[vZppһK|r4c"c;6*ثb*sC$ؖM]IIAS\m k.ءٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ZL*@Qi<"݇sI܅1zK|,x?_냠a+?yC{b#j2v/'W`?7]hxM&f;6*y36C4GFeU͎yBp`]whmNxvG\]vlUٱWf]]]}b8D?Nkظu^$ BD*£=/Ĕ=s$.C] QO9$)׷L$z=ԟ+KeJV*UUEk&Ps#UӘV@P++lT1' A)ˀO\Ac"l2Us|$wP:+]`U+Oz@Yo]ٙPeY<@r53z/L 6oo?F6JLLo3A ҧݫ-e)-<5rڛ !*3)Mn*k!y ℃a 8Ud JOluhvĄ)AGLhrL$I,SæUOF߯ (\i@m-Qv>)J,R'9(CI;Oׂ6PTh2BǮ^jioj+vz@MbiOݛZLN^ 6cPfUMN1B>Gԯ ,^^Prݍ+_$ǡ1'|ŒQT.dPT<♁$\Bzjxc'`~bG`N3~T,HrL5x*(jMOӗlG QN]\l0t8mVN|,;sZ`U AdT460zSB*RƝA?|MiR!I52QO݃\UȿC_%SʟhuISRy Ɔ޸Iv*dٻOl$.@)܎iV=h*J9lkO2dJ})b]PƄP;B? E>>S(^e WٓmK ۥ2H)!X*8+R|4&54N[r{ Q!GN٪H>­q@G-BM? dT ( ⤐9#"IQSI 襏*:A[&CĄjiLq@Sw6BLcvcq۸8ۀrCtr^_,I$N+?I=ٸ l+ ICR@vE;S|z.8-锕h:wLڕR(&?<dʭ΀Wje4D6 ZۣRpiLʜz267PSJ e?ӹ˥EڋV1Գ:xڤn Sȭ1ΆXimN)hItQCRwlU\ baCu5ޙ(I#*֜@rTҴ$ZcQB@$W9P#*rw ͈HnILHrPHإai#q@Zeb=@Xӯ(\$"%nRZ2gK9܊wL70KurGl$MK^LcQ_;P}b .28JZ'2S`¹y2$S9@k$Ӷ&PqeJ45RV3@;1;#vHqj(G|vϩ36*ثb͊6*ثb͊6*ث+k:6cU34z g[3?gQ" (v=$ >ZOſ05Y5dYic?s,Q?} 69gOc4-&="+(F'lxmVsfgv̷ٱWf]vlUٱWf]vlU ۲3i+:Ig=X_$7v~NjJ\XEY%R?닲 3K`.͊6*ثz픚$I%89GgMFpWPp |YCYBģF3J)15 Fj+T-Gj6>$;KsDžO#vs ++:jevr OreS{1~*o?mZ}vvġG9b1DF?L_:͔呜;fCuSyў# iڌ;=bE~^j>(A$oW'7/vfQqWvG)pN<2bxQ^ֵS8^(I;7qpOdG i2E#5\0@+f'9J?L).`~}UC@.QcϼN2i6N̟Vƫ<}%?.{Aa>H`'# 7qd"$?lGK~m_UMJ1\ ?5'G9Ld>:?ԗL9ǦvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]NŶ"[Zr%v,A.ĮP{E;5NK9.K.%~xcLj۶$gS9 \[u',vIсB=E0Z]\Uن*UqWbABL`k(}e0:Aסqv:9&͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*k/*Ir Lj4>v3;} yٕ_ה8.,0c#9ٱWaiFl{?Y_gw-oo?vERvHӊ,A@|3; @z)۾HmnyRIR$r]$`lzS5Hj錥(< To)@>f4m6閈)?N\91*2NޡװWMO2lȤ~s)ڇr%W8T zJ`t@2+䂯~4gܞ0)ҝH*QFUB({td⥏_ er• >⵪iC4Z<S0'k^[ңjc|\Sqo%EIƖ,VTзlrQJtĊB0qB)]NN.gƊ5GOl%SGM_퍧#A_Xr;b>;7O X.CKB>T4;WUU-X9> Ri6,s!j9xbƝ Ys\TnJ _ YHIW$xkzE^Xy,JִƾL*3$}gX o/0&j?N8MT׿L< jo UOWST$R6X< (gbFԡOTPa '*U;P\DЍZ^.mhW5"$5 mHr\(\ C6\r9 m\խiʣ1ڇQ1m҄\cZ߾%s s=5p,JRmZAVu @: %h;׊@:pRP$7.KJc"P ="tj}T4N(CB`jض4q^oۮ0W¸ AY*@S(U#8N*eWOLr`TTܺ TSeP2zv:i׮Ur4 ol HqM񞒹_ ^"EԶF8zMkkL]94)Ґ 78@:d 5CA_vp~Xi6QJt<7OL͊6*ثb͊6*ثb͊6*?'iOο4?'Mbd:]6ki%8}7:GZNߘ#?T ~Sh\}FQT {+93w'Oc?]{;gvlUٱWf]vlUٱWf]vlUSQoR2"bSBc2^yWSYޣxD},kqC K^i09Oħi+;.~ҩ}??ᓰ6ٱWc"R'W(x 3[eb̟'>,ַP2Z拵4'0g?_̟L$yO/ՀJ?eՏfP⏧,έa&]EO`~-=n)OAr HPftHbO~dNnňs=M~͘<vOC_uԇˆ>/nɓ]oc0bǏn/?gfe;ݛ?K W:ge y5tɳ,O<}o<_QzF޻ ?Ǟf垇=6f(g͇uLÝ?}k>Oz&#h~xD%vyi`ᗫ/OcvlU#~q|=4^7g,?)򟹇?:_f;6*ثb͊6*r U=_yjm[Tb#Srڟ'hJ3Lpꂽ2K#nՄ5Q\=(kM~R@UŘNe,JqHk!Z4`):8P;IEJTRNWSM: p$~*aSOlP]$`F;v O֘&w .rO=MZ'do5ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Waj)v)Dv.21ٱWf؋v#9ڞ8UO2ApvlUؤMC f> [j8mVYȫ*UٱWf]*!vk{.ŤNbH%EO|!™UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثQ,/;F̿~&gi'O puXe*?GK5m*s H뺲ߴ,2?gExΏB_̓1ݛvlUٱWa>),Qmx4)l#aSG/N<Œ_~_N=x;Œs ?N8G֟&:\&^=y%/RL]ن;6*ثb͊,bß)iGU$I ˮC$$柇%+DQ=q%Ie@Q 2yg"KOYĂX|jQZ5Z6W~%@Tjv!rP]AP 0!8IFh[j׵r؁N>0( PS4kP +&YRxeNT RHyR;dzRT=XPlQҫ;cj΅D]H'}85TƇZkZS(Jr%- Jchi$vr LM[zxH^$5rV<;J׉XRT=*|V(y¦ Pfg>|)H׃>ѯmڻaE! R 'XiU~$oCA&>+! 28J.k(USƤSڻʠ1r$&׼cP='n21;q~xNmL%+ C17-B`5=p|VZ; ĚE-_UW+֣d4%"MAٔĜUlY4j6nԟ asZ6sexRN5ʖJoWݬ]L W,l((w3@C.=vi$*%2tWzbo~ Jd '\{;J zfP48;R84'Pju5+غ:ZRLMAŀ3s5 TH$k͔ | q8=aR@ !T^j=E7 RN"Z^,{czl T]$q5$V,R%(55yl *8=r-W|*waq4ֽXn)r ^`E)`k]0 v%1 N:hMWlJBI,9PĮb>*.c)!mxF kōhZm[CCR9TiPu GQۮ*]PlYewSO _R8R\yPW8Jlp*]ː ؎ӧ|4Vb^Tn:eP'PjZ)@&շ(Ti Jv ׬R uǨ߯^C5wi|MUVe5F>4]=24z3qWo^ ),!'}%. A6'|P2']"aGվvFHLw/=6*ثb͊6*ثb͊6*~Yi_RO}s7'OvvcC#*I;hY| Aôh[^aJ*ep{"\?xǜuz?.9R?ѵ-5/垂b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?:?qiW/C8Rz%kqvN< ȋ>e}l@/^wx9?dcJ-PoO5=2KqR]9vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]t4;#"Ȗb|]Pd ,H9p!Sx|a'`l,]v9z+vF1fW&A,d;,b]vP8]]y^xJ[JV9~x&#gb-;]qP$]qCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7_XlP+GچOS6g1 .m-ˏ .ś^z=\WG(`(2oC'%ơ8c{4}Q>..jVƓ[L6yirGg0)C4]ƥtuk3{ I|?9C3xǬ*I)%u&cKoU׏ \?W/LvuֻY CUMjWv>SQ8b<<_}9ixR_q $'5ٱWf]vlUٱWeU?#Yj9(mMzMEHvؐV59/,o^+J"'r h+CB8]Qt;%.ɁR\j:wN-4r5ҘjG|"]ZC}+(H>ġdWZoA -*l u7au`C0 u }4J@p44|ř4[XPUrNHMʂN9P>ʜmb+;oRr5$}PD ,ۑ-dhM]Kҟ,!Tr55ڻ퉂Im߶BMJO (j1BP P_:MV#V?F<|0*JiC5(E0"hrSʛc|!PiDh(wkb7$ I& ʫSA长cq*GӨ9j+B*Vz r l=1SƕAV*jwZf*voU=;tı%cH*7B6,{a1EN\kB+'a2>hw\RN)߈U?| ǞqdS)x]ߙ:P="__oI?8=?yg~M4"C'_a8mK?߻:nuثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث/<^TSX [)B_'b"BOB FLw $ػ/&ٱWa/m[Ą˚^:` _vZ- DLJ߉;2v\ Jn䴚G^k4r˂GĻ+:VptopjO*r责S>/vK"-~K"|S/OGڃ<c샦>'<.;~f/ !7qNc*q?inͼ2z}r9dZgM2ҕgBWesbq?yo,g/Wegs_RvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]K!s lv| BW"e2Sup,S2h2J$,݆; 596c1Wf]qWa?X 0j~9Iv ['f]]vP],U؄c<Z ӱ_iTbG|vȼNc1Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*o[ıv8t%?0e\ח[\O,Hi2`>?Ոv[vlUٱWf]vlUٱWcT=9c -.uR|y @j2} wrME*((w8"=o ˿QFPyוvnq;U<42E7ª^\uȪz'jt>VXbr6-?!-jj )sY8ސژ`x bƲT+a*qMFԂ%Mh 9|zBpQ؟3|r4W|`4;:ֻ\J^P+w8Wf ^ pܕr07?xZ\TRUWC}{aVoMYM}6_ 1);P6m^JU$ї»cLޯ * v7s[BcGC׾c4xELc =F*d23eS=偒[]0f܀h6#0 .rȯ)G |(P f UюmPmPzWOׁ$NUX<oLMq+Z=UОqR%>6bJˉ%ryDTRkM~G 1S{vUէgJw'Evr? *+q@SNpwE8.Đs'o` *Ov# mþ+N]@<+݇wQRk$roJ'\ΕobovI])G O6䨡q64s:ӕE<2cĚ\oSlIs* cvJsݔ$bv?vY!6aj2Aacr&aE(K'?OqZԚӣٺlv'VyV ۙ'e[îj;*3D=iZDIjee*S`14n]¯Bb:M.ԑ m+ ޻W @Yw+NS'b )ָҥC? 78Wv#rM?N`04%H@B S6p}qM X\UB]A tQQ+BI/)%SᏏN` p!s^ҪŠw(=rVR+@O` 9|iQ I<j`UԔOO o L!| -WVBAǯq)uA Sv1 6464 n:W*!7,ZYnPyo6B;~"y-@ mZ>#6*ثb͊6*ثb͊6*otѺm(R5z^1l.YOc?]Sqo`27͏o2ܣ/SvN<~-"7?7ݟ󝥛#=͛vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU؜PS\1IL?=4} x_v {TuK1IG8hoa?❅77q-j~0i8}985?OQ;/0Yl5-l vwjx_9}?y#˻ _P!g*Nse#GfZ\l$?}q?}vtIhV:9DHQyLvp6~o+jA%c-BZ<5iirz~}AK23vu'=~nʾ Cqe}R?5C>>본>nכtڥͨUƟie^ጿ>; s vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeLUiau'f ؠ|dcJ*anث|+ I]vZ]Ƹ 0oBL`;6*ثbbʮ*U٘Tdɡ؜S v]0v7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#C0g|Aƿ9 x]ajf^_tQCEe'}FV=:a$ZNj9/@-]FWn$IZZڠ@WN8%7pZS{cHyR?f͏9,VKO+N>呶+K` ;b3ȼJڙ $5h$jƟgUQoF~a]H HFsz`eE5hzJn96+ZRkO]ݘ(elT4w't M)Ui7V5˥0gIlmw´2UvLi*Q^9n.I~De^J ~+S+'| a N"4g(?:9 P򒠊. M)dwkj5$ )`@ۯeާ%vDpMM6SZ+]2 2mTr9S3uǚ;Z0 צWL)> 뚙ސ}nL+^51ZDCp+XS !JibZW"mZ8҃g'o[ 8v^;6*ثb͊6*ثb͊6*ثb͊6*ثbƤ%B0juB29Dnd;6*%t9yq4uljz ꯃ;:娼WV;-jcs$N'{Ag4 yIMGn3K-<):GS0a?음ҋ+#Fl{\^o,P?GY#;hcĻ:uث t%[io#OQ{!v'3-lbٔ5>k6d; ^2>;: tywQ1Hy W7P~~?Ggjƫ/^7tޏOj_vzG1𽣥SP.X"76^Z.gbJF_N䴴{ȼDl>y;Ohc޻:u*?׬J:7N`Qo]U-4t˺ϔuR UAOc8.ihԿ/w]|R'`:j]d[ٟR0V(Г r~cW85vv?LhTzMVP?Oa9f72Wf]vlUٱWf]vlUٱWf]vlUƿ6l .Saq]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcʚ;[Ѷ9`, 8ٌ W`Z녉.©d.k؞*ثb^ͅ(GQv/lՙπ!&A8d;/0]vlUUU]*W,- 51!M"8Z݌]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^zM29Pg'$<6_H9;πaӂ1S^' Y=ij9jUP+aAj-axWs!)kK`dJ9OXY F/,_6*0.-jqP9WUߑڐJp'y4ȴ) Ov }9a6덄SO|U_J ocקW\꾑>zR,Gd-UrA~@8_^Aۡ )skPLmއHJۭIؐ)T2O MKvUv$PVo)ajwVTbI\~`\i\oJJda6ıkvE: QLbkTUOvh; M]_=C)4D턔0ja,ʩ.7Wi9A@8v;/Ku+jsw/0P@);WpU73$c덠U(XQih=e%i{{_'Z¿~ E)I|93o,܁~xN;@1!(SwJI @*7SiiXC 9 h~+ҕi )xPK!OݍXqdJP][D+1"7X(")54ݖbn J=dAv>i>$^ȤHw0WY&2e(J*׮_G^ߎ_ x] .NmNw*xS+:d|P)*9T ) tg.Y89|iJ4d y~5ļ*6 &550MMq鲻W\M(_Iu$&ONAR;ԘE7Žrrm8ڀI^N_"Kw2 { %"-EIb)qI4")?Fj @RKVbv3 M/3 "N(;޿<7kHb<+ӎ!*z֗0=p''*Ġ>ox #a0$:"~o@).(QS2Ҝw.-dS 6&a/ٺar.u]2Y1;T ҜWFz1DmJ]Xrf,mF3$=0^EHiB7.UwRZ;Ȧ!wZS|8ّ s^(,Q#( (uk[+&Yy^6eӝ Af;w˦% -C*]X1c#T-zE3* x 1I QKU+W!zo^Daր0DSZ1PΓ8ȅstrsF'~ĕVX3VI׎8 +x;џ_]vlUٱWf]vlUٱWd3}&Y}ذ̏uw'Ż;t,o3#v'/'B##+M.srzgc?'t⩙+G`?I:΅杛vlU4|څ?4 w?>p9g>/b,~!?MvM临Kek}"Չk#xaN:pK[Bثb>kH5},2SpK~OMT3p2g;ؒC^x;;vث=$CE9Vd y5wg vdͷ-o]ȝD.̎9ˇdsA<vr_QqXTFM8L8If|8b߾pثbMi_\J>,b_̗ 9LPI_1xG֭OA[4nŸ/C,ЮCk^Ηè 7/Fx4̿Vs݇/zOh#l͊9$6.n4/_g9܌)=Ȑ%O_!j^y-?lvx%/q<̈́WvwA33v^;6*ثb͊6*ثb͊6*ثb{cZ[݁r?'y;ep9CII *~d|x@apor`//WNuZ} ?cv;%r'SN9[ܻ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bRᓦئ݊A|cݻwm؉bpUٱWf]v9z[5;xUJ꼩R6iSQB+@a0SȒ Qݲʓ5ү!PZ}ي+cJp3#~JeFºyh٘}:v'H23ljxTv˛0"AG ornN&^†iJŠMD*& a¦=)t¢-~Y11퍭/դ H5УICj/! |U4(G {!yTW N$܎KHw=VLʟFE-%fqQ 'oSH\ŹxFl@A҂G$>Gli_%ixAm:SZ?]MN_ P]e> 59%x[S Z'=: I$G޽Nل^&\+Ƶ#6$Wsɘ:6`2;PbdDžA|^G-@ى8ǒ%(Madp/ -uB8mxP^tZU[gA2`ZDŪlTҹtZ)oy~UٸbަkxVĂ:ƘxxT|Rv>9Eqpn> qE-b^m@wL*04c3q8,-0csS=j]qsR2iZIW`Go``z-+^L!}kMepS2]pxn#&- ׾va<+Zjt ҏ֣Ux dYҥ'@+Vvt%5J1&<U1.xztFf955ϣjw\rJt`0xX) q2Lu%|zZ qiHR7]I DžUbcnL>-M,dw4,>.ٸ^k3Z9d('QFfW$XG{qqrAڧ?VΚ[PeS'LT.5 ze!V m_JzeqJ!]b1nmQX||"K8^EDᘮJ+ Sg;PZaJ_, AWm]0lԭ: bJphet|xid"rTͽ}SՕPSf=_ `,5+UzΊvއsED_!O@2`'g s/F¬%x Un JQSBs!?߫&w(İڔL_B}vlUٱWf]vlUٱWf][bʑ]]dA\{ 4%/㽡J~b^}WDnD/Gm{N|%L'xG?F7i‡/{Cdid{z3yU m#2(G_uʻCOl)f~k KUؼ&cYs^ W82s. pݑ(}m |O +ƹ!ł_v.D}̢NMR>?Hd9~o?{'g^ݛvA8bE't~⯜m?z^f#ܭWF ?L}Q?їIyf]щ;Rp.Kd#@vp/*AKZY&>gi#߾U0g3_.vlUٱWf]d.h$g:}1ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWb[vR4ȶbQ%W5!3+dثKbf]vlUUن*le$;^C{.IOvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~Lyeqg5L%?GMFn#eQ#A母Ќe]8s]ާŵ@iDXJF}ƒlRMALzI;a$eoO*CC~B|UK`»--7!~%e wlh`ق5A*Mz{dIdS" ٹVޢ ;`K s,)0&5/`3 5P$آߗ)pUM7޹bJw3ڴ1~4fV1X!VBhr YI  ujY_ R"s lJSVa_ӷL׎9"*wsB7loS@XQq"+Rsqi*I:̅~=2YR1KxO^j JH㊊di/7 I<655˒K @jyɣĠrB+i%grjwb¦6^\6%4Z0q3pB8ZS!iW3Ƞ0Jm+wdmViQZ> l7+Hg( EZj')| Liv"QV4x Jbە2{a*")o|LZyn Rz7} ?oՌw*#2ExI`;Tob͊6*ثb͊6*ثSz:*Æ)Kϻr|Yv`^`~V)0??- eW-z]Ge7J_޴#|睛vlUٱWf]vlUٱWf]vlUN]EIkr ;8oѵ13j)2>m1/߻vt/ ncԗv>^Se?N_Os=?ytNc滱54N#xv2vu,-W}m&;$#/gT]v#}H2022Cv#R9|p m2?lϗhP1Kvz=!f]vlU؝~O)xʧ Cl%Avp/&A7DŕwX K齡#21<2QhtkQXq-VYs68R!H(̈NaKf&^+}\ܣC)9 'r8c/.f]YR 5a=%ۚXv\?v~QiMkxR3ObfN'og ?S&zIeoG$<)p0ៗrZx/2;.U?2}cŧ]=7d'W_,c4>>{5>>dqOIؚ_'qOvOhqє\eF_]#XY~ز^lKjVZ#dsˏ&?Ήx\3d%ݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v |R%X`™YHv)Kb͊]vlUٱWcWf]7bL)ZUSoCQ .]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbI@i͂P.P.9;TTy0Rx> k@7y+|Ab5&%@4.(M+-| CYpUfkPPaVݼ+@)ֹ P5 BN( w5P}8R:xT 2hC%^jZxThB7 =QBԓib,jz bV1*ëuqHg~A`VR kL))t2!]N`wkKn@(5O$E^6"VTZWR#dnΠ PZI>l p㛅08[Z5Fþ`SiNq(g;9;J+JQb9#0L ]=b¿:k%E@P f+L6+C j5 ¢-<(N9V<-4w>rƸAtƨDEۑl9э|x>]oFG \2sVeМ\7`TNa|)($Nn 778i A؁4yM#^b"7=t*74bυMo 9/ɿ/þYLm<+~)Tr"\H LU.P9e13̹|r%<*ijE[[#j4-qcj n$Qt\SMloU!vNaDKaC%@2BE1}iGT$0J;) }N5Ku_ iG#Ҡq+؜p&#w4n9ZEr[<:} >nD[LS0jcKg~):f \Jk4Bf1oN:T[GXt2'~L^5 e`I¹hlLnc,p\+  o٬.k٘\|=N7֟ѠAc_4)7z.P?./M"Zpmz]*2{;8%u[5N[< oOK?_LZ/SXG{w0"SFz<$Dn\gOI^ha(R>n{7?2+'mfˇ<T_HXiw uc`?g b͊6*k}O_?!%3z59߾s,?=!f]jJFZ|Q<;W p[ ^ٱ /0X9^#y?wvB6ޛޑnR+_.hY'/z^ ~?gm$BP;1/!2?TeN跶.Q܊?ngyp'e>c ,ΏY/84oZܭf/.!/x]5ˋ.ɖouٱWf]vlUٱWf]vlUٱWf]vq)4$]$_8RP}]!?Є|^o{<]~#< i ,s; S++Kx!ؚe{Q_5|<@&WeZYF+ZU'd9RFو^N+ 0jn+M14,DOJSjwE ׫,d(aG'eP^Qͺ W%0=FW" >҆44 ú<5Y .Q9$Li< ˨sT-~o1FE4KUw kS"ؐꑀr4-|eTˠH3CKŜL@Lm8[h4Ua§,prZq>*Ws2V hLGs%xib`j׷L4ծZ ڝstngfczzx3 SLE*s2$(/U#n,=,<(kܸ٩#cD̩-&kP|$nlv8.B3Z:ٌO%\`lk-@Laޭ&JЖf=eH!^\kO JQ#d *]rNPoTӗ{e$1owQ!C\'9udkMW3:dS QB Va0DžQf;p#Q"Jn^/pghcv7wO# 7]P@q D Z0SWu4s^"+hj\tw+~8JLX v]R(hᘀ 2ͳ)tڤ@t9bFp-B6oIZ/]08b6mؓ^``Q='Ѳq5v u"%N[yS1p-tQ";#tH 9Aq1c%ݥq!p£.Kq/MxWU]D.iVS5*2|%f%}x-F\ueq.%lbl# ?X5w TAl*ɫ Z֋w8pe`7V=QmW5  beTW|ƣ 4'vxe/ Q4 ~쟄` MUY$~XMӅ5#18DX >Kd`$zt?v>Iy7bAC~?v>s_K@e4|%P;'|nj5-訩#,N_Fc<ړRl׮%y&71WՕyu}u#vlUٱWf]vlUٱWf]^kgÎ#rN\Yd?N[7-R$)ےC˰#Xl{gQ!tXܣ:0xTHN_)vlUٱWf]vlUٱWf]vlUٱWg;xZd?%GO9~Q?xOY+]n'[M>it,c_w~ RN$&<Y؟e.f9ĸGpǐX;y," Akھ͞ggf]:4h.")vFx-sYbϼK.hO'L. ƹ=ۏhg1 ʍ"уg4_86d|PO\\ݹ{G|0PUf1 flc[b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_yJ^+N6~_u'ѱzG];]~F=fx6ƳK.ϕa`9͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R8Ucmivf502v(@K`Wf]v^*ثb͊6*ثث]uCRN /L!B0v7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ i[?^U-9㞩PQJoYbʝT!5FPcj\К&SDJқ$:X\1߮@1B(ʚB Ip@)iULƤwXIBTx~G!eE ۶n' (,+\wlYr̮"9$(yo%l$:__)ܺ H3i.=:q)#z)eY$';(&";4Iv1 J|'9Z׾U w'(<)Q}Ih;8H^ݙ|1E꺅mL̆2@[> Aqƃi)|5]Ojw,N:7ԨL=dy c^[$aR<ޞ*!n|mr1!k \;!kxGƵ3&Fڸ+RH(FNH8J ˟ rFr4wZPw:a0lRr3*iz4 {L5t f⽱O}B)J{£ȭQ3S'˂$g5w `(qEX 2T0ڏ@Xi] :GTnIʨ&Ҝ~Jkr>kk8 -bRy B:pcһnqAbո|,ؙj^8UVmSS0c(֘j6lD[@˨qf04ڪٯl r nMD15W$ 6G10 !X .rPo"1Ҍ|ڒV+ޥkK|q8bԣBCr?#_MDs,£rkaNGæ 1l(/ šjʠ82CGG ~biWZ@/<thkdS|drc4jmhP>?h?g⥁đUW.ƛmLਸ਼M}sbtֵ8a:Eh}Z57:zHRb:=Rf[ykk9:֭5~p|pqcgY]ڣKriqڸ8n1z)=t7dLsԯxrŭlx)KOOaX\sc il5jzOQX)'F6F4 /Uͷe~R0*CF4媈o JQFkĊd:1D˽Iچ'{'a{dc`ˆ莳K潽Fvn vlUٱWf]vlUٱWf]ONOP>ឧ@Ȳ.1'-mƃ1X?Γ[G$OP>g~Xثb͊6*ثb͊6*ثb)}kXhAEOyv^<8>ؘ0_vu,ikcHrl4xׄVplM>5xH<e5pFz06~d*MUFbPqt]GN?W_C=?cw/_̗L+yˀH'o[4z>ўGj`Od~s_]+uxߪ_b쉑y9SjH_|Vm|wWe/vv?/hpiewf~gk4Q391k3\'f]vlU_zX@+ӡf},3 3Oɀȝ2j%ؘ#8vQB_8*wMCYP?8ǰfrK~e<#_#i= $?c,:xw}_>җal]ko,i3[E$jaKIG&_sN1]@(:fc(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU<3JD;Cө'Ps{7ե3);~w;8?Bp׮[Sgd[<-m2a㶳X'*) #5$r ߤvH~ᎍf1ͤԡbx*q,ƟͩLaQbqj-USڹ'ln5BPNxV._1uٌU-Q=61_ Oz9j@r^f1MV\v hꆟNn{|6Ie bHƵZ}e>LCXߖx Qc8!zo )AomQCd\oJALo|kSe\n(1eOAӔd+r^&3؜V=6l-ofQAAg`(zSGUgZ+ad g&N}A'mQ(; | 8)$"bǑrb30䒒w22&{RBDc ~+~Ȧ#QDq0jPc8x. _Jbt}e׾X0p3MiLl3iS/ 6Lnq V W8!-Lj2Cr'$Rq/Kyۢ11O?vCŇz< ,.SXIƏzat"ccE:m7ݖ4@pDBaR- ]&8RSN)GGBUwpr) '5&4ߏ9FVuFA}@48vF[5ǝ-;7ԈQ䜫cN IʎT@ѧ)S:?iOjQ Tu)L-&>d$8ZB?g"urG &/Ɉ;o,1/EYHO 6? XTI'/ӋK*Q[; #,^2%J Qt,qZUU~$REV,fJS+ $QVԦ a*7{=Aҽ6*ثb͊6*ثblǝ?71 v_FmN.͊6*ثb͊6*ثb͊6*ثu]_Wʹܸk3vlUٱWd;?4JnGoOeG<ljt=<+>;H"P }6qQ.Kϗřp.Y ?-ڡyoQŘYt2sp2vz,Mm#?U1cȗirsw p TATg""JfFv?,kvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU3~~V®p=soѻ}8?vw 9vp? v/1;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث/#LUum ;Pp% ]t^֘ NLj%e iF88cĊvo%fcĴV_ KNeljifqZvan-;7&ӳ}]qZvoRKvj_|Bܞ#sوU+Jᯇn"jOS1\wnw%_>&9~~gj(:o\Sq15 ZNN6`G\7ZajMZ jNAj TQ)iЌF6^tse{],8 % 0ɾ> z7^|57۰Ӧ>!_n|4v޲V77CfԊx%`'s_& `qx[e۾brbV=TQ` L%u^NaF=,n6iGoS5[:rL ?*[ (nx!fXw%Xc_ik㲫LX8Tmb ˍ$R(tVRʮ J1,ՉLe*) ~:ej#Neʭ0*&48JBZr5]pbp*G|j*"*r Ǧ9Uc3`dS1b'R.mV}A݋ ޹U Ǧ^SILUmݤ+_bu8UEV``ddDAOAoy?oՒ6%JwT+)Ztϛ.뙱Wf]vlUٱWf]v=:z!) 1W8?轏,?u'gof]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU?4eR??>}Ǿ_;]?G;Es_G_qwdC4ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf][b8W~䧹xܛl-%Э 8>%@Wѿ2FY/=!Rh+ +% FTRYWeޕvE{z~DPb JEܞ틬g 7 E-|PPu#\aUDX۾9xg\h!> i".A@ؑ0 ڴ|G쁄Ga&m7NeK30-@C &1'/yidf0Zmlckk*rBQ,*}ezrґ}r+C\l/CA(qܝG^a$; -mChG14P~y3G|W!At?F=\/F{) .Zd1!xHIDB|5E?^\(N;3ZD|s_ӥH:1./ܥ*+\Q4V;*tADi>qݫd9D*?/rh|ɕx| -:2)Jd!V?+B<#2鱌N6&>0jG%*ARzXe~4ZLk7Q0b]%ߥ2@ 'S"j]ORWnI2)Try=xe LQlHBvd8Y`M+YJ^E!@Uio#҂AZ[&kS1ip2*{6*j IN|ണ2?p*hAmpcrio(4b (O͊:(% lų+H~j( I`C3iNٱU(cH3W͊8ֆA}LUen1_ld(*r< -dd PMjHNUlW~saJb'd=b/|@*.dB U$ $Jִ'VYWW#j-Z5sdb\ CQ[8enHnd]dOxᕲz+D  %ZBiaRVŖX i.A pep4S!7IR-j1%dr Mu<3#SjQw=Nu Ǧn>ǾA·fH)tc{7\TX XżvaP5 FcK޿FOrrc#KzO\pp1ԜW?vҪ]PW|~T\(ɛu&1 { dF] ?QG1z QsN mWk &c<Dd=eVUXr2SAʹ8[wazSl|Dp-t!e NBXDcFQ6<it$&p^^sѴ^ ?s;;~w8'˶,Tg ݖ+}ֻ7f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v ,I+S ȗcl!حqKP"RA.Wf /8ٽg= k@H oIv fZC(!`ӛIBwCJJO]pڡedm_*dm\DO囕pZaܘVLGMv5pZQ٬( hIܱRza@ %OW YE˛횸- ER$x S Zd25TsĴ[I E5nX-)ʏ囖6PsɈ*;\miMt2F6ˤ$$]p҄Z|RqvQ|x_-92$W7,KJHN mR3r8-9xU(VnG*AĊ\@r֗&@/֝->YU8ڷ*ݜ Tˮ6MUWʮ6cd2@߮^6h"vʭp%9v>Zh}Bji[ii|=s B\{6)j(FX*AkҪpQ=I*q#zmA1B*7MTlШ4Ug BƭV9]p%*Q#ʮ6D`F,WUxGS!grZ()G[DPqo(`JUm؄ rJ sWYZ*\U]#r;fVǑFjxP*9xq 1H9xR :ʮ*%%ٺ2B~1U$$Z ثr?3b\TJ]qCcഢ*xpZ\mVlC!GQ+ J༐O^ITlyv\6z-i, t#޹UiW#dvf֔~(㛖69va -f`OJ(6YRq y|Қܚ)N\ڬ}9lűӪjirkJOf5:UKY b )l8i/ٹciڐ*TWW,(ڟ-rĴZr2`;ckJR]CU6A >-64Ր$nxfr-c iqҤ:嫜"KJ2F~觿~QrpqZҴV 凉ikZYxbJ rw"JUE~q+Ky Ț!QD%MnFzϧٱWf]vlUٱWf]vlU(6n>='C+[i9ݴ/ }q?/St?΃m&8I^[_ӓ3f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]wϾxX9Ex/>׿͎?_;$[s]g㇪Px'?̟yok秒E5-h]}&?3{+ >._?ҸـG_ggMε]R>q?I{W~_hvYgG٧LccÞ^QvH3h]vpX}=v|Jފ}/RNߦKZC g{Du<3#Rv vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]B7͠K/8o2}pvv9vySz܃J|-\N_UG #Ocb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊XVpA:nǧƩGv6U";>Dv+IS/I-4fcKno4fƖL[LimƖL4fcHS7[u3}m1S+i&L[Li]L\_ iQ_-[u3}q|4e}q|1S74fƕپ<1vo 4J\i]һ7=vW=u2+^cJf4o{cJ\ƕپ+}hxcJ[_+<1vcv<4쯭-7ǁƕ[һ1Wf8һ7ǁƕپ;WWe}kWfƕپ<1vX)]c[vo imپ1vct1vWF4쿭 i]CWfƕ_Zһ/CWf*qv_WWfJ쿬. [vo&4쿬&M7-7[vcpi]π+و)v'#o›8C.ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]jVb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثث]8IݝOc2jŠ7U?mOeE2GA_LJ2Nݰ I1fRjqⵥY^U=;p)HqjT+Qֹ+@w1"'S2a |GU*ՠbtFv1J0?X9 Pex1#[k ?}U1J$;TSkwp$^|9U%QVI$%lUw0p\rty%CT=Q{ U|2qF Q9TLV22 ILžhw;xPR(Kp ρXBkOjbmMF?^j*>U.ڵT~>4 DEUƘڷkƪ>eZYRJs5Up*p8FHzA(0շוk/$4NAS+ M+[+Jح|i^nxiw.;űGk"mPl-p 3Q$iޙ4Q:\WI2(zSn^ڶ"|DeW*: ڴ!.?h?v6߶CU*_,+K Mb+*ǽwm]Tx(: K"S+JJics# 6HAPˁ" Vjө2 JhA >ojl6T15X-Di|P[i28Dh3{a(t}뛑8.%m;e0Ziҝv߫.5Fc@;gάMsb͊6*ثb͊6*ثZ\zsS3ƹ.,:?8p%.v~t[ryzc/>~u)G1_M}gshPCfòŀG?olÇsݍdOMۺ+?WgbvSpXAA{bD! VH"$*0xz?zg~_)ӴYƧ/LtLjv^ciuX|%H9LTOY)5g5۱'^m1.'TަGuyٵxΧYd7nٱWg؇[Fk" NΩ }]"pnW'x|xsLNNlpvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc])sȓ[vq?˔7afH~ovXiH}gmf s4MWv-ˈN͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1@5.uPmUUٱWf*]Wf]SvjbF*ثSvlUن*]vlUٱWf*U٩6*ثWf]vlUٱWf]/vlUٱWf]UٱCb͊]]SvjbLUٱWf]vlUٱWfͅ]v^6ʮ*٫6ث]lU٪1Wf]*iٰ+aWfv^*n*v*N*Ƹv_68CYvabثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbγ#mFV9h?T>hR:*@yLFqÔ-rbf]=?2bH(oQ-\sM$(X(Z4~|pl(ZHEOcHre!; RFPyūJ9 -`w56)\j(v|1Bi.t_ ƒ;NN椓\jmg#3+/QyTHTSsL$gd^, ت1!n@rdP FKi {P V25 P 2b~R %W2^3Z\mVCR? 4uȥEHW( cJ܉4|E/$w@)3dUqEݥ(\Pq  )${S1\:m\*'{$3SH-q$eQH(DPIVs qlQ *TNeLd/ĬtV08@sWS0w'c^dmm]SmnX- ^^Č *(,znюǑ{qEKoƑ,E:6 Q̬H-*6%8hvS\qY<Ҡʮ TT֔_KPA^B٫w 8U7j-WbWaC16$ ckM&邠kHV'+]4uwJ=lh525JƇr}uۮX7 ƒQ#܋:vZɎUޘ7Jq4lo!jm `kĆ߫#n@qS>w粼/6*ثb͊6*ثb͊;שMtC([;NÝ#tB:diOffGlC ?̔eؓ(x/aqo9y} 1WQlݹ^cvt ^YٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU9XJv2.s=}{<=re~Lw/C#$@}q|yӼb͊97-[iWb;v58?zw G_dB$@W._n;sYcOm-dY~6fnLOrN?s&I [rDOZ}egF.͊9$T38~_]eЭXV_ue/>>eu?B>|Ol5s# }%Xqݞr3}QٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v r; ᗖb.vn^ثr]*ܱWf劻7!0lUٹ{bv`]*XTbqWfqWfiڿ,U|]݅]ͿbɉUًPܛ,]ɱWeo ZUuzu]\UD];byxyxW*6**ʤ P4]+,㊻6*&* k\U٨|qWe㊻*qWfNJ)Z >8>8U٪| ğvQ-S㊻,5H~*쪷+7Wf&"KN2d6\L jܰZҨבaA@2bK>ʖ4T雕0Zf1-A\LV֌w;`M*Wڽ6`Z\ Ud%Il#i36bdCn8BlV2; X(N\u'lHCH¡TV3]RW(QZTw5jIN;TͰEz@ބJW~ŃO hݩ斪JThz]Gx'-(ogJԄ]卅JܕkВPn:f^ȎJہȞvL %ŅN vC^5`UQSM {~qB%đ)>v籼;6*ثb͊6*ثb͊:? R_J[ wOH;:'l][D᳦C(E9<<ݜrӾԝ҇iv_VCG$_̗E3xGf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWd~˥:0e|s^ /OM8r>]?sdrE>&bvMt޹b3;:uثbIr,}8ܕ1l/u+ vCr#5dLJES.5ΊdQ_BDxfCqaHK}=>2֤K;Y_k -Ciw_;:uث~p,V빊!_,_?߻Nzvܞ|:_h2^HwH 4>ȕ1evpzv.><0J;8npO6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*2E#q\vl ݊p_UA—Myf>ߦ eHZrq7 ]3_G~|y vZO^ _iYO3.](_Zk)W Lʿkq۽h8\x/\vӍx7 L?n7L1;wo@\x#փ 7 cﭧ7Ӕt)G#փocBAgo_F.;w}qe~և{ 2ƃ'1۽4;WoފjeNoOFvNeNoOF v]W9vZG8n}l#A#1۽vw? a{n?r=={?rFanCOzvk[ٿVv_pE7?rÿovw׿?rÇZ-W'.Ϳ>۽ԟpßo{nR}1}Itn={R}.]Vo8{خR}ji8.=Wn}iOY-6G ǿ77? ٻoY_Z8{خj ?j8b;/_+7(ٿ漿qT_^a-PLQEvw_^_8{ ?}fO5{Wg}jO5e[!//m-Zl7Nk6w'_+}k?9G@lmvw'_+}mvo/Cvw'_/COo[ ?9nx'_,Si8Wr~4ªT\ /Ԏ{dINpv7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثCKt"ULQZr4вceAA32K; Xv5IqWbӡ 1qŕ9%Ɂ [H%)"7뙐ڈBMǘ@Ǵ[@rKW"xUU}卪ԵYhi+\p>8P=vnJPr-NxUEZª U,b5$PWJ% +@=xTjжU9îY !PF (#LUbp*LXU9ȏ#.PfG{u\ Uh'a-֑IX2xһە Dh>_,0J{mE-6 @eHLxxKFF۩9^\IC` /!UiTZH.b"[bCP+&E J3-zf2f6{`3S3s8xK냎6ȩ?FS9w / Y(+$1E5%}wɒa Њ$]]c QJI+)V%eVZ3Jr\TƔޤl&i!@i+ZnKt&ý?s Ҥ*QZ Edf!wҔ+2U݃3u" n5j[44햠8\+ʟFe@VZ$05ZBۦQZ"UPe ~U;o"#I%s8`xwr}wE!aN`L kGķAZuSjeddUJ/)5VVUhEM;~8Wz(:A H44 ǹ%W(M뙁 צUrКVjSRZSҮÑq[E=r6mv[Wm]]<|rm$/ QOPjo֜PCJf5lWL +A59"-y)*P|2_%A6$mY+* z.o\)-SR]Ӡ}>i\|r+e8xBk'ö%zA'pC~:y5͊6*ثb͊6*ثbGrMBc?m{3'hK<{[_;B|Ay!;*NП+gƤM}#W'Ogp@|ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU [ғUME|Qf'/Mĝ+Iƨ%u"H{$lP<23⎯ ℿܻ;ΝèV'~= X刔~>i HCQv ̇P!{ b˔b,┝&{6jSA>|MRfF?ؾ1a}_ҟz_KQGk؉g1D\IE?ϩ7;O/Gσ'mZF/?|vOw~bvrٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]viҕ4p2onӦvZ}}ECii*y64li]Lءٰٰ+bL*ٱWf]u3b͊6*ثb͊6*f]Lثu3ba/ +6u2WS+]vjCW ]LثW5p`WS6u3bCu3bf͊+aWf]vV*e͊*f] 6vlU٫6*evUqKCWf)v]qWf(v$p+* {ab]$UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU/]n6:hnay=6VJS ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثI|iY^`v2ózHAI+Xr S[< ]"q#!Lc?kWbd-8ZS|B酴MTqgBq/q\T-3 ch9ni,b^ˠ…7v ^\Jjs0Q{1T*ۅj'0l -}|bxA+6Ⱥˮ ,O71:=>HT)9ᵧ&YJ:Lil1xb Ӟv{YrTDȆ>æoW&ԩ=2|Ϩn&9xjطsĴ q|z~E\IUgȨr2HwWM/uҞLR8R"xOYxUe- k=q:I*M)Q}sizU,* ƃp]pjӧ([U痽+ސ,+@Lh22;n5NtF>H\25k7_Dܨj:>ũ߾$6#7aitg*)|h8LVjLmW+<|Re6fAA7[*zeeRlԡۯTM]8A^E2\Vv`Mw;B#|I@dwU4B=sNz'YWf]vlUٱWf]vlU"fIqad$`Dp!ė(a"А?4ZZ{zʒ?~Ӗq=?qz_{J]B*+;L9&z%[-,T#v;0E)UƇ߭r[.QcZSez-/zwXMUV#đbwStW,7S"V74⤚uT"ZMM|N[{BZoP)#+1Ŕ68e!cZ(|[= ڶGM:٘Ӧ&B!ڙTTb/T2ЊP Wc]L n @$m8:) j7ƵkBWiUN [9IMjԺbNZqGlH V̥֢t96ڙItB_*pNvr%U#B\%|q26BN\z"|d o@I\6/ *}J#9E}铍9]c$x۩miB#;^ըC^;m"蒽b)Ӗ2HB†*h]lطƿ0fT&yf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf] ;͘5v]"[c"e#VdWI( l2ٰb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ks^?H@6_ gbx!g#mCYԟZC^Ĺ31xz{1`7vv;#R}vӐ$̈<}xs'ە͏,,3/S81DJ 3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]lR6RrJ"]/IW¿-0DQ|:2+vjaWW FhqUV^T' Z-w~oopz>c?N<%iY?}?Opz0G\+Na}?ݏ Zq~Ηu7諯}Ӿ/MiiXߛM鱥 H}7-;10w?5ZpC7{Zw?o_\~(k_OeޭJm6x)? 4̌h]vlU٩]ٰb͊51WfLUٱWf .Xb͊.b]vlUٱWf]vlUٱWe]v]1Wf*]LU٩.Wfv]1CSvU1Kb͊/vlPثb͊];~UUٚT]/H; Kݕ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثH(Pj0i+kZ4RCHȯyGl;|qӭZ9jAس9I3C9ZPY>\#[L9JB}Hq&g4~*GZe T% X`{o \LeJJwʸZӖ.ޛ%=)iw˩h+HP fi8rRbH S+4ߢ(T t$'2wZoUe$oȐ|zӽSǶUIr7HpzibA#wJSr^mU%ŷ39֘$@HJ_"dr6L[z@=)يd:.>Kxi} Km1 PH +8!ăt1ĬʕS֧DwĎ4lH{ѓtzVV͹ m\ܩSJb;vv#wR=RhPǦQ~l@l{5ݓ>@lM΅A@{AeWbioRrb#jt#(־-)CVǾJ2]!kӶ:jmY}ȥiS%XG^#RRt9C`rr#`%iPLޝKtJ$ݿ}v<j|jINM!ޚ396ej(E6DQIjJЎ852`)kGS]P;71ߩͽwLzڷp;[5q'h:8^G`+ֹ#$RGJ`d >Yz˧9AlK`1vkӮ| ;%*Zw^\|r4UK|K]2醕j nzPWlI ;BQxm Hlnk#oneuUT1t%}Jv%  Cq35?2*%~)\'POnTi%5t_$E(PuC}zh5;wiT ӿ|֔ VɈހ|j+z{ 7RnJI#1l#Lv†-CU0%7 Y[s]wn \7&Vǁ1BύA;5rv4>{eripO|BO N+% sVz&ٱWf]vlUٱWf]vlUٱWgI=;;JE vj/WWߏN΍ ,j|g@[?Mc0w/)/??*uCc )Z_uKxyxϏOiۘ8һ5NWf$\RPإ٩8xq⅒F=]N%cQX£ȭ.>L sb1We]UxXb]vV*UX銻51Wf*]͊6*)/v6b͊5+6*] SAq'S 1[I3qU'"JT$ʹh J%m!V}r銻+vlUٱWf];6*إٱWf]vlUٱWf];'l*]1Sp)v]/8X+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbE4\!(?yEhgsQo2d-.SFO^r{}L)o>|r2޽\e7Yr ŶL;&SVMDy1GC$(l7[sh׾{w㏗Uz͸\;+u$5װ. H|2@™KSnrv9o'k ndK*~YHw!.*]A&chh6;oJq؍*ѿ"75Z χ|#nhlc=c$q۩2 1]Homrҥp<-J;dn8ҢjkegㅒPSO{wjԎ-GPk\"6>υ7$B o2R#nԮp~-j@;;Z(z#?JW'a"_R 6'ǪHd䨅p!A1Mvؓ׮ $WHxceF$H+w;c L!ESD?GєToCL jʦ׭|r%ҡHQ?NQ|H;{ɀim{BGϾ 61w-Zv*]"Sh1̴R[F9 ri~w4'%*ʐ*6+JZW$Г/WfwS76=.$^hbk`()o?%Z)Z ZG1R8:ذd9TkJ3Rʬ(j>AO*Tvqۦ`B]M4Ez**2&WH\ ᛘ]q 4՗cNt^@wABēS-ʠOI$jEDz0|YMfN:VG@1ZVi_Rzs'jd+JA`O[jx֗ :WQjOLmWɍа]c% F c $ }\m[1Jc8O%SU&;e1#|'`A+ q ҡC/^k,5M2@BϠڝȨ pZPFcʸ4h@Ïlxb|:D$ҤkNAiŗ'|mIo$UU}b8@W1SJeW~G4,ܨcwݥr:QLr'%e-0Uc Zh70=0WZ7WS*HoW|e*eGuP\Ǯypv#'fkpdijaЏK`.O)yWRTaUYe<:ie'/O9L!\:f]vlUٱWf]vlUٱWg鶷2xO/H;;&`ZGbEA c"?g͔呙3uPm?3y?S`fq; =#b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثXZ b ݰ6aKt7iz`9#AA^gooaolQT]qorlwȁ[,+CڛiCQGQMkle#9@,)܃mkz93A^#P*J4A4+1ԍ|Ew'1?͕WdU ' =;֖Ӯ& П+3$T0eqQSi mLP5ڣ,ƚhqePz^&.hjK1ڔ  nfIQG$oX cCmM\_JiwlLj7$KA ]ff \2 Z*S;soq+El^%MMqEs?L3Ou ;o+bZFX^D7m~|`k^2 Y `[ۮ<)''DUVW,]*7%d m6,bRK;儠]5RLƛmM.hY'dP({D%HYJ`+ VYa@:`\,[b2)AJ ^LEQSR J);d` Ks:Gu4u⇸rA xF\Lִ#)<"P^552@'-VH!k7R:֞9dݡbfcN3W"NJֵ3P2P:\znrx Zoir;"(n]YhÍ78Qk QTSڻUjp]d FSȷZeo 4#9/R* u|v%*c}9nOؚ٪G `SlBBCC~b7*"^i :y6͊6*ثb͊6*ثb͊6*:=& Ʋc?8v^t=7:k?yN͝zz [bΟ'-ONwĝQZ}:Cۚ4/,b8q$˷tASt.ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊=K$g`)H\ l1Jf8}N—󾊦/1hat\ٹIeeZ_VG0x0jfN<.LŴġoKNd8͊K?/KT a3YCOBWktVcs#s҃k{B}JªK41M/뻇?`1s]ce_˲l~mzΓEij.!Sm#Ʃ#>?6:nǓi~_?:Wbd8H@=?8>,T2 -GLQxU;ZF%Ft[4і;29 HM$ZG`3ZhJd~kE?|r;Ѥ#䕣1Jc`M~K[^uI=17_B&!j׬#}5J~ q8S[)ɬ[:>ck_M B7a\lTtZbRTY^(V]6*bf*]6*bLUَ*Ut]Svjb]vlUٱKbf*]vlRUن(vHK PUV1pz߆ ٝ(0Gܚ6cI͂&,:ԡ_G8+Gx8J9XKp2j 8sbmUooG\rcVHz?f_`-"3'l-xޯO82v|}`iC\.xő|}pO:yMd?MQ[b͊6*ثb͊$>Je5[{s[fb{<&b&%WZ &q@kNҿeF`uPӋ9]2;b Y["BXps'n#;_zq;EǩlvN⛥.'gLŌWez g񱉑:8>vfkϩڀ+D*[C0zc{3Χ/N/h~Y|!JՔ|_{6|~8^>pS=vH?JgAau?q|yY7fCHsSe/Yǥil4Hr~ĝ[,f{KOevd#CO9=Εݜ*="E\xooga喉s5RNgPc+Oxc)qΧ$2J0Ꮶ'/@ON[hYiJ] MBa:DؔI1*]Y[JHwõg8ЌJDo=u CdY}GJ 1%z$?A:%;kN1f__;%ټt͊<zTפnLl9߾q,?I|ٱWdCV.z#HGE$8e~KKGF;W;@_볧cƻcHalcb͊6*ثb͊6*ثbQ J0rG?اO8qHc㰴19OaOe5K'_IV 7q~zݩ>!oTߛzlSNC˓VQp@@qaZnqqQ)}Ri;T~rjqiHĒFr+D$j*0]!u+?Tz"A4Q\&ָej@cb(jf9Ae1aMAW]urWf*]v^*ثb͊6*|q1W ~o1R½Uj";}ټ'&&eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثhiX"ƀ 'R@]6cʷ:umovfЈy??ԉOWȜZ_<_$Ե[JOZFXW02Sř9OL&xf1?՗  PYHVW?^fq X''_zcS>&xmNMjݫWf]vlUٱWd3yVUkLmOں';IVSV1  Xb2|%=A$|Y]2]6H>>'ĴِՁ(*VJc }!qYS OzHq;fRI\zw4*<2H @X prqӾdU|Ajip]?iw55||p_zCJ{trq=`j zbm4U(Lw 6;m)EXI~O{EQ(zPYE@6HBCo [~~@U8 :h >d:Jx9aB֟vTQNk׾ mE+JfJxWCo Nu%5Zo^A4>lҘ`G%bClVӷLE7,H_Y%AxA@+N Kc۠̕  D lε|' ?IF3JWGjM8}|rdtCr!'7{e\4$({elegix?!g"oYsQ( 50cp;gg_+X"a_csÔe'τᙁKVd8͊ >tHU웍̋ɜ~Ÿ-sN8}KO3~yc__]KC!b9;4N˞qF_JNY9A#bЯs o%3P)}{C;1|ί"Ҳр£nX<\NivhppOFຕǛuGz*W_βZח ?Ӱ㎇#?4'iLb8`Fzo#7E~qaxMGhel`u]8)=2v$BG ; ɔ;5eą9Q2?e1g4[լNęܼ;(Gi^j)U}FH\<0'gy5 =14͝'cƷbwDNpC)Aʧ1Gl&`x]:,\R$SgK V.#Lvv,X >I'Od0o_vC9)_DI?/\ǝ~NL/土e+GůPNto0矜b i?/ۙGa\\}?GS/Z{q BWUyr˻3#rhYDG8'd:'vlU݁9+<fK?VzѤ̡|q$;#ߘ1z(oWsUBKTu}Qv@&fj{?/Iu?vuI'&QE~2^NEҟOP:fbK[t(h [?deWWxr}_o@wqOcӚ&_r20jf/3;ΰy2PUvt'#n_HnAE;C?/e'd6ΝٱWf]vlUٱWf]R-*[پJMag\6bݜ{ɚTf־s"S&'CqK?hf<1c :vp9ZԥSX k>C/cOǩ~_}S. ׻f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vi3(nl]jpnr>"CÉ0I$촭H>rO QKֿޏ eJ߬3Yw31?lU-/I,By>9mj4Ks*?(>oj[oSDN֤}?gsrAP tHWL:B2 oU宷os0OǠwRMI(/fFŸ|!wt4=FO汍q#eb]ITvQD$|$Y,oZ u^,X2;W Y~|^8\SS8L0^h~-],>6VwZK2ܫ4s(iVko0R[ b)v*j᫏V\i)<$ S8{ f["0)6hUN tw|L]MlڝUc*q6gJ5 (DRp^{eh'٢JPPiQC;I(cOs zak.=iǿuI*訾ʷ=?1<}ʺW"nIߐ0B]O1ː=P`TR @Wo^4XJJoop+fWf.qWebf]b͊6*ثb͊6*ثb͊51Wef(vlR'*ثb͊u]s$+K{*4l0Q.Nf(At[}p>1Y%Av~l-p*`=L34Fq.dh`w[^sy!'%Q~rZ-:Z1l䉆'N?OeRy%ĥQT2*V(=8͍ne)Ueֿd{_7p/%;0wbxVv Z4ƹ%;G,ےjrւm vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMFm]Ljb?b?\<_㗣λJN)2^;kvlUٱWf]vzqLDdaL?h`z-@;2×s!zM6|&kc{G6]1}J䭍4EIlG&%k$u덝i1U۠\Ĭ/ƤR #3xxtn$m)k#ԒQ3boAd];cP{׶N#o i;er^;lp&90j;e4'd($luN;䅼Tt픵qJ)8^sᕘm~U @1бhM/ Hf}`wlQSZ@mȪiLqa_ޮGnDBƛ %[%@[qo/ S} {$R:o+Ez` m5{з+-Dn~ܾ+M/)OYXrƤm1=64VP pU+ޙ@ӦkaȚmvp jԈ*R(Hǖ&i$RRA)G%WSE2zXVZEq䥩*@Tu˥*[ȳ)BN[9/TֽY5䉰(1|DM:hHBi\,iM`r679*v FQNUY~ZNffؙtZj*w .4܀vqIJ ~O;@\Da:tV ֢Tczi+(*wtįoՖB SiQ؂j|iμM3b͊6*ثb͊6*ثb͊6*ߔaS:p>/4gKغgQ{#(LgQԬ"-V9T{γ.!&2drRgovcR??d\t5K߾~ _^?7㳸 )"e䘻6*ثb͊6*ثb͊6*~kVSȩ懶rpaGס<\yyg[TQȧM:*7?G9x'Ftp/?YvK?'R)tO#TٶmS`?Ij#(/D:>uo"ثfs;q+˂=_KܝE6m%=#qjsHKL~&9$%q?37f]=- ӳv'5eik/<@?@6]I9÷X;;ƑZj9z[=9M<}W`qvD4gh9B" i{^U,o8dKj5nl7aF#_u_'gY᝛vlU?9/h'۰25=ɼYv2izG1#ʹsd6n7o².7"IO-x}ӏ•g%N'|XP{Cz^͐x8?.K+TDOsV##;s!DcJS`,͌^hy7tZ!'k14Ư%œ\fSXarqI-㷍bBF*1;͝'cƷf]?FO]:?\;^5}ezq/\N}2_2{;=,DB?^Wӟaf8n4iWq ) s W,RЗ;E.?ӏg'Ѹ9ƹ9{n܍?֋z۳b͊ u/Zkot/OO.`tG_;K\Q?֏|u&kFaӸ'ӓ8], 3>πJqwg3.vlUٱWf]vlUٱWg*2*<| ~/Y֧C}S{a_?Ci\OI$ȟn3Kc럪N˷я97_mUA?e]/mm'_W!#N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثf| vXF!` fkeq+Q*N87[?"1PT->߬qU|͊6*|SHDmLePFX>+r?uUm#t87D# JBAA$j)Zd6e>jd<27UևM?S̞X웋!ePr!e~^ZNJY x6*9Apj=ʻS.2U]vlUٱWf]"͒Wcyhnj'AvkO>-/L/#,ho͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثC&b$Nr)]cCF1VOru)d7Jd{5ٱWaV<nEUT#Q.?og~S^zÿ>Wq?%~jbڵV- mG!O#2b_f̽Kbbӛ4?ˇ /,=Bx/?xna/7ˁsvlUٱWf]vv8}ZiHO@sGtW;y(@"آZ2 Mt*lF%I8rA!4:&#'f% u@+YGFTtwr`n1!i]#)4~=|r,^%k 0Mf*|256N8w2ɀ7 F WXQ]\! GJһSW'Ր=&WG!ZRq郇%;NB?c%6۸Z9'awl7;ot($+(xJƧ N_%9,j*1ڄbc_qTn1 5: nِV( ~'WoVY JJ6 |_y6*ثb͊6*ثb͊6*ثb62ZʳxȌHFN0 c8 'cظ/k3L~$vLt ҇!Y+>8Y@?擶tCŏw2~oߏ'^:dqW,}_ X_s%^H>g);Α]vlUٱWf]vlUٱWf]vroKVS8s/*p)U"\o4xp⏫J/7,7Rs'] Od6ٱWg዆8ۍe݁+Ggػ:'tKF )IҼvxsNٺb7zIeUڱ.?C[£?_ |)W L]D. k1T-F8#r?7K\0 ?U]jle@Ӝ>g':(`?o<9诙;6*ثb͊6*)Fc%иcSN~P0@/Ju9у_RySk뺼P!?W l7Nux/M;WT4!QK@';krvp9BKtc5}ve?L?og-G_;#v.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثn+:|,uqbö݂e;+;'`keeH?!<ʔ=Wc_}1bl va.Wf]SvjbLU͊Wf*]vlU͊][Zr8O0%c^OŵYRI䨡AvB|BiS1U|ءٱWf.͊\ثb͊lU͊]vlUٱWf];*銻6*UxWvlUٱWe+;Wupۙ)%+5G>vAשzC#+PZL*,].@6pҵJ-_-/r^S-tfALTM)@oy# rj Q97tI J^aE&2-ey1BN:HIGl m)~m?z^1&L0/!?+&0捂CiA^O.Bx fꪚݛ?W d;W6w!+LRUX08WfE]P]zL{O$L!Ր,NL5I f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*`7Nk_,Ivi'V_K9ןC?pr''5ٱW`3NRY%`.ň同~5f1D_L]6vhN+ kdXt{y}Y%}ݛvH<h|aޏIv'qvG^]vlUٱWf]F]6.ج\c$LKd&`l;=cͦGr4QǁCz3c?xв hu뚝=V?F8D*I5d"_՗Ă{Q`1K@|X$f ԭ~]qoV2XzUQSN玢/ӒVa2Бۯ\1 צ9#L}$1; z}9ex҃+[r56 RqLN ؔJPIH"7E5}8nƔ:S4,x/|6 O፭(Mrɲ9l|st?탑۹\7cS!$m_MmCCTbU/swP z/TZȂ/b"m0U-](-NoӖF&ԕ=Jepހ#m$W= mw H^q_6-W_ L+r֤{IW(5PA\69-4U ^# Zg$WCM5˽!}j7LpR\ 3qۦgQZ`uPbWs8]1\6n2ٸ*PÑtRF=9N}Rt덡9X{%BA'lRW.;5Jno;֟~BG ǃRõ17ȍԮ,lZJ:{eIUnavmS홇Ѿ'*Ai$ 6Յ 4s㚢aT5y/m[v;TS6HsGEɶ>y?5knV(XmN v$Sje vR٩؜|էrU5H& :/!=c1C܏A \U%(m6:+4b@]A'P;o<@;pĮŸ~b|0ܭ"T&N)OZb{Wț;ٔbP-|=KSB 4l@Vӏ"+6ZbހW #UԱ9F WsR|OeP(vj-J׹Ʋli JWFUkna@$xv m ».ž9A:Vm3Am 972|cKr5#Piwǂ(>Yh! h 5/oeq;km[z$fozaU:PE~$fTIܞۜo\@V8S׷|p\BQw5=Mp"ŏ=CG|ZU#: 7F[n&U k,T[ Џi6FiJ\4ěP EjEGlh}6sÎǧМEz׭6įXd-Ssvϝ9<]vlUٱWf]vlUٱWf]vlUٱWd/>;R+_o9_>dwmhhqXdhV;iDHQx(LvpZzȒ F=7A͎Z?C}H g }ghuHuKXmcW_;h?`Kꋰ^d͊6*ثb͊6*ثb:$;I8SWycR@)Jҏi?Ï:^gsTgO{94Z,%GFAI{>@8wS}{O6Rjxt?cc|L|]wm|xL}7<8}]GhYG,^/ Z{:\9NeE/ auQ\{o?^cx8vvl?vG?0Z<袯~'< g?v@(j/bMO!9u ]9u͊6*ثbM78< <ϩ-^ӈb~'e?>J_}tI~דo[ zvB⑿Wzq;NC3g`~jvK}p*|?Olj8cS<;EOŗя?]s8ǹvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vvO.&l}Dvi /1)rOE)OăğpJ5G]H'\fQ,]ڟQx*y)*+l/6w O՘io6$[Kn?F۽9{Y(pq-o8lmmNO?pkelmlfΟMq~7ܿNo?6Vv~7ܿN_Kxlv~74v?V6V߇& YML!l}[o#}C1]asQG[-]|[\ߥ"kwſ)/կ/7K*lC+@?qC5o5^gɴbZQ\j2 H*lȍL:D%:NowFvO5ɵaw=s9)Q<|F6cu= GREj|mP7%stNdO"?>ʣGV1Hs]ԑZeAdH ɍx߻y#ЂpKNVUhj)55 &kؘ]&ܯJjc ʉWʩ;S T kQᒳ 2Po͹L$zi( \vUj0v^t}!ըj [X G*qOjt],$Z;STrUr‡j -F4MMȠҵ1 U?O/Hh3~YAݺԨ`^JA.jktSF*ISC\$؃OcC OlB,z;_| jeص{m6䆘~â KQ^!~{}9|~}ZPW#Q$WF](<1UƄԞC\Ժ@J TUG~UH,F+^527cT |һW9 |$R零}KP()4KO("cM29Pzl3ڣ Z ҵ$M!N%y )Qa\ VG xq $(OB:׭2pH2:H8*@ @ߧ|*܁35>XKM$w۰ x Qe4';'$JVܫZ7lQb-I%*T%zf5ޭ Ԑzv$jȍASXϝY9ohh1 \~W%k~\[ç^-Iko~%Oޣ?gcvlUٱWf]vlUٱW`MZi]F >O_͋1˅.U 7res<}W_NdžyqvIXkߺvrc9GƞH]rM5?JO%o(k>c??auеd3|11J`Oh`h3_(O;ӍN_Wҋ>fثb͊8氌kMïbm' .GG:)Sγ@cО}Po]1@R?o;'o,t[7΀v*O?p`v0dw̿^lfm~:fU8q$q,ǝʚ R#a2#&A;;i8_N?_fX8zW(H:2rtӳ~[iw3I 3`j791/ke< C󝝛;]0* - ӳEYYnXR8"ܨ%o9!!1>mɏbfR xx;:7{Ż/; |[-{ljڧ/k:8j+]]M|#G-th~f#Z[.<1өQ.)Nٔ;6*ثb͊6*ثb͊6*ثb͊ _>n"a?eog7>~_чyAKŗsv򟤿n`D '/GcxnGm1N毪åZyph+:,^kOY!rvyYզn伸5C_`?e،|iP8`!.ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU?L\]n|l E?2s44߫ 4Ob02vXv^)vlPbLUT]Wf]vP]0®́]v^)vc+;6vlUxٱWW6*k6*ثb/WePUٱWef͊+vlUٱWe͊6*ثbQ*<PV1(Qdiw8"jEN6╡A+5\H(0no7ii{/B \{WT+)%\nb["\Ǘ"z\)񎿁zr(GqqIy9JkN]c2QFʼnPo+'1~F}~>/9 j̷Wv+8_;9;[+Yab<6~p_6bm$Mi?%e :ZyFNV)-bdώa.i;P8=C:9VUCBWGSqs0I#Ĕbof'.D0FIO^L++{dpۡv}Y]m4KGd.cĔx]d$,&ʲv8"x[V*ثv;C_02|yѼw20a&˰ f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثM`b7$#~)_?_y<||0OHL%?;S R MQ4m)7ǫ_s/v?s~O?`Ŀ-peUY1u=<ᐇ_Nf>/pCv=T i#Ez2~Ms~'-͖0 t߿LSdg5ٱWf]vlUٱW`>[)+$d0##8 L#a_=Zz $M2^,,xa^90Nii@XJ?46Jm֙Iؒ6 R[c-p]h횂ā]oPO\h6NRS.)r/Z82\|(@Te|we>xDo椴Q~AE7"9204PGZ؎i\Ԁ;)d`/䒹>x;Q2{cE0CdMj{5 V']Xڛ7+Zr'0NcV(Pw&d_K+oPB+\u\bwq&}NX~C 2#I\R{pL R |v^d6P sqonwEI'$,[0]A I U8v,U/Oܓק1یT/JAQf%UkRh+K$ ڛWJ_KR/\CWǶ-K`xhj篇|g-PQЊT1}PPkȆ;W wr}0+wʉ&TUqii&vn58,'t)"2przZ6 2׾ [ 5M;};Ф Ƙ׷|NG{vͲxvZZZilǶz)s)|z z[)RI^~wU>*ֵ=GNr@1Rn:)nŪmaV$2>y܂pZE Q-On%1f#NChe^+\@+(g!xq )J L)I%:Ӯىi6U=2~3u5n7$LE-E_ Uޚ樨'pHUqR{;fùVBwߦ'}C7c͉QV~;LӞlUٱWf]vlUٱWf]vlUٱWf]vlUqzm /" O\N Y7g,/῁.ڱȡb2DJ?L0ˊXc/.qεf 9z3_O%ig/p6a?7O,w_Gg2!O&Nto2ثb͊6*ثb榡]u팼kؘLv~LXW&`v/g_gOα]vq=sf?g o'r?лS?V/O迗}*7sYܞ5_쓏,{7QbPKו]7<,+UT|_.C5Lϳ4Td 1/ŇM|c`÷ ~9 e [nڧ,| iHN\򬽸+qOϛ/dk^Ye`/YN%?fK|R?bz,|xKvvEE`3̬vs??iZCi/QZyP}Jf;G e^C.#)G/^Bld_=| hfj޿bt:9oeIRAQFu:7O7T#Iˈ_r%>A0!'Җӎ?LI$ͻvlUWy_M]lkf}.\?v}i-<95f6v?˙һt'iZSQ Vo~\^,;?89C6m#ߢ?]9u͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*'W!]IC!cOo_ <8媟_͋O@vWsk "g!YOՒ_?L^]>>;;j"@T <6]k/͟lյS8pe79y?S ~ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvi .b̻%ZR]as"oG߫#?ٓs" ݘbf]6*ءٱWeb]LUT]*vlUU®\UuLU٩.bu3bjWf]vP­.1Wf#v_LUZlU*Uٰb́]Wvm*1Wf]J\p\*|'(:d)Vl*ק\VYTJpBp]Nfg_([ NP":d˶/epwb$s#0l!=VL*P2OlvcHS#; qawa$rן 'qc Ek ,%.Sdܑ=F㑬.>Қ)##T5qEז-u4PWj\!g1 ZD` _i6 $uEi 'A"7e=%y#Z !>I4L ÜH`$A8_f| T0ܺNTd>USzaN:wPSds= 7ec(+pc:6 s ㌕UP]]&0Q:I&"R@v8U0ZlrcFa$uxQL&ggE۸ .b6F"(ZPf]vְ7S푏%%@ra 0vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثM䖒1YPVAd&`DE& e!1q`+mleP<_TҺ䖓ӓ׃3C7TLOo%RXPDv@2)vlU&kHQRr@Gc9G.b,|nVmWTQfI~~lsQ2l=o=Gc_+LI gbI'rIY$.b9vlUٱWf]vlUٱWgP{Sqr@#9c-nt njب4;@={e|6hV`,q]Jݲ|5\1B*G93šM@Z1_,88F.P% Lj}R-xWHтPuAi$Rq;ta1v9v߸ ˎMRvژjae'e(ZRO|Jjޘ9#Bd.urjVMw9I7f1/ `+)_@v}Rl@j\@SlOH ɉ-@jd5l=" m-I]a"d"BܼFyz)'^8rcO%ozcTnm7 L}()[PX{a;lb7?NYLjEqֿN@KPOJʭ c#"|JN5؍ǎFDIth(C&$ jc-V db<2w풔lI5lv7aBjeTkS5|t|8wNlHKjAhj1KwKQjFTbnAU(*ሧXH CxvSɑHSH')Wx{Ko&Įn2)#.w><> SquJ&;lq *84zam^G[\fbO@=UANX IQw@;>yw䖪PN[~n=k=G B-n(iVSµ٩M2ӦR]<`)w4Fsp4LJmnҙ\5ycPR7 )+e5V3R#Vq_qj il *֕ plž=WƫC^]{e6ӥ:`?Ch`Jn]{cX:n`|V2n<*W(n"GIT .,@:mVe/]FuM\*ͥT:Ǩ:`T{}pZ@ )\ltnKj;x6#*(&zfe^팣|ءhz?kcU = dB3möDnIx5дqOwL?k6QE(%O7UՍD/CBt/E}GTثb͊6*ث~i階5,q9*6= kbɔ0czˋe)1Wd$F\/ | ?"l7È }_T_jj|QChn'd6ΝٱWa?|mEPW5.kA k% 'FgJe`)me:=Dˉ]'Vx:k'{LaZruس#~WhR,l# N=D͋MމfCv%X1fo5d\ˇD(DTl6`VHv^Mb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*_çW,4$rLſ)e~;8}{Uc Dv.I2?̇},}Tvv=CEK;qݘlx^Ufrcd[+?:mL7sSں >;^$9s{f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vӾRV6;%RkQ3G-&O}|2ptXXcbe]vlUٱWf]vlU٩];6*qWeSvU0+*ثWvlU˦*إXf]vlUt]1K(q1Vb+vjbLUٰb͊50+b͊/nLUVVU_9Bʻ5 D eQ܂P 8NFtXlB% TsKSACYtC-=^\ =0UͮrN8ͲQބ/'6l.3R r sbRO,g ?W aF=:U~{TwoBIgfi`kBr>@dRanD܀62M*~< 64LSZ%aN2Ѳ^Ta2yվǾXQa}: htUc|nlA=ENٗS:>l\-f|mKJbwܦö˭8Fzf]zR.?@pb+ v_0 ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]y^kmXjZƭ6 bCQ;~JEqW6*|橞D uܺ\N?vfQyռEy8P[[ܻEws9q͊?6*ůjI4/J#kyZK۬i/9_MbgyYo51g*%ufOqA~^\lU |s~_k\2 wpװI ?#rޟ6*ʼO\_Y?ۅf[yE$N,ث|j:>Ld:*%u^3p-.d3b_4ãyo&y*q#qBU p>pvY^|NfeVK;rw~$ _woq;RHxLέ~bP 5 S#p'7+o.\Em`մ)Cy0E>UwdȈfPڴi&/|6os$oZWinrC+yV=h^L/u*/ub8VC4~ޣBLت{ywճ#NUіoI?\3bk\U_X׵ %Y }r͊=n-_a͊?ڰԵ[Sm۰5 8v"8_lU~hz|;Wת <кn+]xAsgPu?,v2)6w‹ }3~ľ’lU빱Wue;8écT"sVīW?6*!K@ݸmF^is'6*m?.u;/ǬxnM4.0znlUO#v˾ixb4F6*yj!˾ey BjF슕Y]M'︧EVlUOZ iښ{N"iYQ̫_'?͊c6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbA،U}gZq0?ə G73[:(x̰KR۳mJG sHRq/<ׄn&1f ?uQ?,pzmǛ.x{5KH[b%rR2JaÆ?~hc|S2?Waһ3^vlUٱWf]vlUٱWf])w .H*.'ƈI?akgb}&($=KӠǐHlEN_ ޸Aں[Z˨4=h1F[ۈMu`cއ1 \jt5#mw)Tv9ec @QR7鐱}Y/qwj"w6ȶVSdS׾bzpZ–FlZ eIq"VI3}@,T޹!eJ+^e=G0JCqВ7w {Jm_<ժS|Ǘm$l%_bN[vlM=0ߨBȦ|UL/&F‡|PѪq>:e' hrmdZ`M:cCGzIE!XG_l!iL+ h|r V>q#=ځZާ˶ jXv>9|7DžmZt;yNUjTTIP@ ݾB_wdS?v<~Xbcj))s;ֵa+L\QBh2|{dJW+vjaS-EGNF^o|4-Uj2}`{BjXuBVfWmʃ+eJ vtsIbe kV`(6$)lY˵8lUd,R6 Ks; mcҘ UM╠(x{`岪I**O#TPuBrB"ejnƚЎtj w;+a~Z;u+ IREBjW 0vCLP#юɡLh cu亡H㕾i\9oR*ƕrRGLw%‹R[UER aZҝؑA_~Y ڬ~@BMX - 3@ȠjT#IoX&_iB;eQ^@u%lA(TVJt 1us|*Nx!5HP~SZ ^Bn95 ҸOJUvz.EݳlM}d0Z ,J +߫' ʼnhz(>u篼evlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgaƗx1ݱ/,;+_\~c#}ЗL=_IU{;_7y4L%O?,g-CȺ*kOfD?# FM_H~?Ҿc?,Y?zoڭz#gmQ(K-<%IGpvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v6YR$i$`NB"d`dh;8?1Vh:t\jc;%G9yrS❝OP gM .r'7b͊vlUٱWf]+/;+vlUٱWf'vUqWf]va/vlUx(_\Ub]1KVb͊Webv^)vlU\qCb1WeurWf]lUi%j)>8qhaܡg 2zbPsp  sK(yR:װɍeqxb4 G쒣\K |<1kA,pG%cow"88Lqڪr(0+1i9ģnQEY| O.Nآ_@GP~Xx؜EkD،i!+lB} qO\`8ؓc-z mթq-5c%r[?[S퇌 chD_z7e&qP#%i1N!"z[Wvj͊jMKF2v ;# v^dYv7\,6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*[P5M|{{sw7)'r-mEʉd)qՙ旊G/)Lثӿ%^譨H?I}lY@uU?|?be.Ö Tj7 ETfD&E\i͊ͷ>[ӿ-\jڀP8".I.'$OS4Tq\jwՖu?v~pVlت;WO(\2y(/ JK$I`~H^[C"GU߽"lUm;x/l *5D0VDxN\'-yw-6fxͬYխN70$\_6*ysP\3b`ܲ˳kK GWd~;>qG_ާ|YV]pgIhŤq227x$k ȋ'lUjlثo&yMy %I[jqC.^9_*Z%,M(`1 J@IE%/,|<5͊Ӥ[hRVE.olU>l;}ٱVG%`K[_/&VQN1_͊_o&s?'4m-Q]9dF^ l!ྒྷÊf'U7SMk*Mc H*yʾR3b3soQ;c|ث<΢l4P܊!ZHۏ}BNl 7y'o| z?(;`/$8WwE9߾9%D͊O%-yK@D7^ 2Ć2$'7ٱU4'yCWI,n&~ M#%b3-^D!dnpZ9- ʄSzt=sRLX7'` QICz@īa84$w ׶FҨc,9Rve\<ErZbM(,S'}QD΀ڙMSl+PrPuLP7J~A؊pJNN1E̪9/\;!BR$S{P>X8v[qS:mu篼kvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWb[HB$B FF&%!Gvw#?0[wʼnQ?G|紻(l/#jF9‚D"e8y2h2Q:?ϋeŏ1X2_Ŏ.ѣZ7(YCȕw2vlRثbeRP챊1]vV*ثbʦ*ثaWf͊6vlUcq˦k+usbUck/vjvQov^*챊Gv`1We⮮lU͊KbS(튺V\U}0+!SPwBoa"!ve]vhɋ]'&b1،>_ky"pJ%[ExC˭!`+4R! BP h ǎ N*]G|íYv[jw8]-9 "Q)\Re⮦lUU٫Lثt͊]Lث"͒Wf]vlUٱW` Kǣ;I^Y; q ePrL]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]`:o֩x%ޣ<I$Q~2lU)9u8:ijG9TO6i{-36IgEddyR^1)/S*?3k spkx5~ 66*_̻y˓aZV*ׅ^iulثت[R7 a;'6* !Y$K}9YXT2˛{??'lyT#0/? Ncc'߃CMb*u]gM/Z~(eN3<ǒz\_O3^{ 0hVz8I qBVAe:lU=C*u= x~MjϦƬk#QHb4MC7S8]K'1Ouf1#V@kqN+Mتk[kH,[Ȇt[e:|6*枇 `;uEoByr䋏ثukIt"XTbv+po6*?!?'::e2뺡/rUޱV`87>ݳǛemhĺFlWX Hݞ.~esbG^J;9.?cR9W׆?W)9^a_Z^v)` V7#fߗiZN>];X'-(;ȋ;Mz1p͊[#B$=KP"ZzjY& *m_iZN?[͊ͿG?mbQԵereBH>dNyFGO-SOKDeMi )4" ˮ䌆iHE fe>cEC%\""+ni &s+#\N+풒Z1=|0t`[Ԍjwl!٪z"+K r2\* Ub=SiYvnl)v^Ԍ l2@9CVsmQLZ[I` ujqCFSzu6Vד*jTSjȆ )e)\7\Dt* u>5ZʿZl =3 ![sEb]{wZ `U~ *5NaeWmSmMpD@@;L HQP i*?~FҩpPԓsaZQ]KVڹ`RHRh]:aKAz4J 6lP`hH;:OTE|J{QS"HPo%G*}>Cx׭z˦I Aķcs+)(5F ցio TP6uRUzp تc,zvMFIBQ?4Tq;VAiMOS*ک x-mkpRiR*i9y+rVI"AV#r 49Xe$5xOjv%$5ׯѕB6W FXc)U,{=sVz&ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU;LnՊJزE6扄N/5oV:,A$}Q4zcc8oK*?GONʶaefJu?G.:u1ZYX;96>G)TңԌ׳>qt?zٰv?̟ce.ˢvͺ7%=Gu?goGI9ӴBִ$}YhOge82yy'5슢cskٽzO`*I\Lb,┝/lW<کTF[W#';?A,k.k]b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثv?e`=vOT'fo)cӵu臄M(R,`K Uَ*ثbˮ*إٺbeb]*ٱKbS/u2WfZlU٩T[]LUf]Ucu3bSLa]]\+.LU6*lP[lU͊6*+*LUt-f ثb͊6*ثjb1Wf'vlUGva5qWeWv]1Wf*vlUUٲ*nI]vl6*ثdTdc'bNaT*~&͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/) jF;?f͊Ƚ*[}+\ܷp3Uā4Xi.EW[ӎO}a寑YEٔm X#zqT=^lUo它swanMVH.<=u_K쬼,ث;MGMΗ)hӏ H_M~$o͊+k=oFm7dl}k)f_FH=4އ͊[{SBf43-w5̽0ڼE 9EUcy@Bnm&"YuEF+vyG/ɶ*]^] {H;q .wm 84X̩7__Osb8ᨨ ַ04R)i,Z+q~_GV)a |j2y R%(  qzpI*q/VQi{ė !Y^A'ӈL4mJ_'ت/sy|}in~3bثʵoB|o6lUߐ>@ɰJas,ј\,Gwqz-/OOlU~qYkU'V҉-&dhp~ߧzwמq # lUl;}ٱVG%`K`?*t1G6*˽.UFg{ 40slUF[>n]y:XWӟ ULrNYd^S_S-W̚wtywuZJUP}$RUkNOʄ*V&nAori;hfx䍡BjiOa%|A l.Le / VlRI#wI+Pǔ6j϶=O~dHT"F~`j+$-jUzeR-+MFU)b3JĞ|;u/]R)aOĔRjԤ|T7R7$R`#Sx)lqreV 1 |T <{dD;@'b;iʮIsTL*Dֵ P5&+;%QAQ~{&HHA IVN.yc!M;xO$(RH;oljy<Ǩ:cɍ jR: :R,UCɗnv[M7" i mdylzqLpocjO:k7ZyM(@'Sw$UduBս梎ZY.j~?N`LV,ԯwu|p-ZP1*OߐJ`@ ~XrBR=5#zt˨6zlW5ŵ+=vW J)C[fcA^.X5X]"*0b(nXmVGƇ\J,q_,t8keiD ï9OS| Dه_㇪tod^jХP\AMMz`oT2/B+2hRIhC+ wJ&Ut9T?dwJMJzdЦBIZԒNv$:#-H?F5} H_4*xzZS¾i侅Pq~춑jE4؃a -!!j@: ;dxh˩PCPty5U9%0Rt=TmZi4>Y=N؅jYW]!ɡ @"[SU0m_ך)\%|G쓱 *85=3CLJ$gtYDW-WE'uSN¸푤jZVᒤ);Bkһu—q,9KjM)p]+ CqaUʛt9sDƲ}ڙcHZ]c}lPPbFn'?vRnsЩ%{xpoՒ08Ը,HϜo>]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]:.qܭݣq~?e3 џO0~UUmX~OYDl}_qK*?OOc{_0[32/r%Q2j4Zeqvr8T.B(;ؑg]OH?ҽ{K?vu-y_ֶ4uqiVK7?ᓰ6ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v#}} -qr8T21#x\1R^eX+-j*3'7~?͆o~d]i#~]Z8$dlU]v%#qU^;u}VdJFgr#ȭ&Mλ_vw>n,}N??RXs`[[JWw#/SE_6*_K_Vspw4~fz|*~rh5j}H%c$y+_,\)$oG~qz7使T6}p"m{eRb2;USȭnv*-*bȳI,1z"IiHѿybt_o(M"ȖM~>);f_qs++{9cnI! \'e>ܟ^qZj:iU3RX,ت̸"i\73,wJ%uw~+Y~lU[e_mRHˇ/͊:O槙hhxfGk,>/_NyLm'@t+#Hy<Ȓ|?$ҪّlUS^_:qm ыW#rԊT$E'%f_,hY~kdYah1Eqēħѿ6*6*2IVɦJTi2k9EU[b7ϛbd~u#/Y0zxUlӫ4,D,c?]\7?ث%}տ.ƥq\swI"G6D*,ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻 4ig'$JR9V` ۈ!Nvny'6Ex w,I^p5fl㒕>?Je2~۩a) ;eJvI\!']zaB]'эd=W&Jw4ƃ-hDTxq/@y%ihEvÿO ( Ā R7lc'2+xd +%4'N~jIqō*+T J`YF܀զ!|,9~#čSC;EG|:tʌz=PVJwz6H[5G"]핍풫8lS^[ĥ*ix{+zv准mz:t V}Q<ؒ=@;{ePW Rb)OAqFcdr-V\´]+d(f^I/!Uw_1q0j8(SOEwb U^21mZ&= Ck *w}2Z܁PG÷KǑ t?-WɈoQI` [k.֤>_e kB(kv+,6w$[RXVF(tPK|*H51֛ f㇅mM)N{m‹Z/SvzoW-nZCJ#(DeT"N$ѽb<)rB~SnTj,Ri9 ZRGSƖKpYn\H[rMPQ`m{O!Z:۱צqfUXVW;7 p풵QPx)sF÷_"̆r**=:ԁzzFj҃sњb6V+-_,EUR$:fRҴd!=I ś;r"U+*V]_OXm aY)COW4`TnXK n=fq>-IIW5(oUhHJБsjI$ IM~R556kkg* "mx\ЅsH F@QBGṅl l+6 ƻfAJc.^K@2biTԝO5?!#p>$G`JT}e!~.ۦJTk'>qP#Pq-\: h+J RYVFv-raU6"J){wB(R+WP('E+G;?*mF!J aUNdJ \m*jre(+C Dm=rȯHCQȬj )6^H{ VpP\JJ. J@VҮK0WrE]$5C@S-ꤷeZYw&ݔ q(UңR_s_OeH(Sm9%͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*0u{&nسK}M9G4L&8P󝷘awH>8̟C7'AgKJg_vkzN@JdC.|@W'ĽU_;:'0m-) ?%./FO_y^iQwCNno b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb¿0B׻mA5fW ;/ockNHz)?ALj v;#}Gv_ԧcxƝsďz8U 'v8iG(-O2A_$9t/S\3:) +^?_p,yoQ=-8~sk0 j]8~scaUVDŽ󸿝}j?,cPuؿ}j?z[G9o1]IM ѓdR5؏6.3*' >n1ʚK]~? j_???[(KRbF?YCٿ:ci#C{b=H! ]7h<~p^Cqw~ k%J|H@XUYUaEǀ_ɹ<!=ǀ&dG]e~̟[3~~伟_f ?߇/'W.3o^O.1EfdJFM;~?淅f?~<+ _Mc~<)eqG&c++ Bn0Zl9Lv.6}9, qqJ/ы)IUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*v*ZKT",xg'%cM_U@Qgm}O?S@O'\l#}@]jRY@h@1dѹVg#"իp;e/\!%ӇU$vE1"R:9C} W.OC 5auX^8K44LuHZ%6LFƂmYH'j(j|$Z,#u$UC# րU#'?<W=隕<;=@TaQpZ{@ZJWpƼ*¿F|ipCr"ZPR}n`(wk'‹STS78vViQ〠L !BW!+L|xV[ (=GL V?/@~G,.@[X "fM#g]v雎)m(NJ_b &ԟP1)wc@7܍ !MKV#H5OUM5Tn1CQq'`X4|+|=UX4x1^͖~xUJFte% TR?wtMBSE~U)*5:Phıx(ӦTwzm63P |M#T7W…3#I!E=`U^Lx_Y`W4 fG߃U^E<&tD]$vq]VeRE)+mp@>_XTҭi^6%Ar4?v#{ğ7ǘArdrh(E|s&zeٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v UsjFY (01pqFN8uw_9;Lgӓ=-?_[?L]ZuApHQAH ⋢ǐDɼi>MKqA8oeK8=#ї?ܻCMgMՇd[-//u%÷_.Σoqk, 6VSPFu8d~Zثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbW2V}'OTCJ{[ڱ釯'&Փx%yN'QEW9\qlzMF1Svu˖>ҿicSgiOx]VzqLV?b^eUn doLd4sgG) vq/1^aQNpz\M/⛰0f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcYc9:d=O.p̙c㠚ĝyudSJ+ ].'&8mS/x>ms?ߟ?ɐr.hiOՇ;Y_w_Hߟ_rwCCOՇ8z#_~~#;Cˣڑv,dp'']DY#0-ߕ܎XҬ߿(;w#:mvc|ߣx8{:W:hꜦM9Lܞ;b^KZvʦuNJIk|8-;t9÷q'OM<~pܑ`v~|\mSСVE#]c'FqA w?)CD\aWK뇃7zhX\[]j^864߇9I/O\^xliqAMǙ\|c%?ֈ:Y>4{/[:iZq2i2Kilm׉n_<@yt+O#ȚVW?'/;Wߵ<+ekSF?rN3O//C1v?<%_[d4*_0;+kG e7hܿ%yi>?~;9w/s_ZT'è?ɘmN0[v;7sO:>cS~&V7QccK z;rM 72_!1N:54߄o$?G;EQ!6WK[O/\GwG~7L hf/0tqmsi6r+gXZG O?|\M&?i_/Y~'px=ci0VO#4{+H,y#X'pd_}һ /?Wė{Nv/ݕ|'>_]?_5f>G~=.diK_GՑ:rM)ndU8ȉ-9dHܦ/-rn@ h2ԛ Ļ kv'6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R(F$vzCO,5}Mk+P}gÇm?,N9ݚLrZ/C Q|7h)m(e"v\!wm 3NjPcTy)RN`1iAY3ĵ?=>aU$Qh~`UzqׯJcJcjW)":^Gӕdz%QAGZ ӦZurBrvOҭWS|knsvZY*QAޕ#6jުTu튮? p ;~Tr *)Ew:ӶIVz0rȦB;PԀ6ZpHȪ_(wRt6#q*1W%Tv܊S,ӮUя@XPk UXFKٱr -wLiW4`wl }?\ D7 /c6O >ٺb!I,O*WQ\VH})Cl@/K( _Rnc\Uj2yHtSL(RA=eUU MU*}[_o):g"!rkDRDQYГN4Mz>9U)Hs ωӇ[b#~7PFg82`!BS]PnrȒVʍOORE r!UI*7Si 9.kAQ3S)zr물U mVr*GoL~StvPdW,#ꤵ*>$&|pQ+qSZn( FA7:J+~9{a*j  K|]>\Pd_dW6)_ϊ4-.PiUEiרe7uEf5 _)bȕUpҭi0 )M9xP_L ]zǕ9)(LnI7[ꢧ -]=FYdyGpbjÈg̹},8SOKyC]zbGUy56?\͋'qK_$v!f՗UŸ:ܯN[(DE:DPy <?+k*MyT_,R8}0p?%?F/sSƣ3\9W8eHIb(p)lvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]viYg ⟞A ΀!SĵE~7Չ]H"r+>.qpX|r~v;ܛG֕ n+cC\ i/oqkriI4~_Dr#-&_ٶq |7vK͸Vv|y{[/q' Ak~j?kI1Z5.Aqui?>Z ?iޞ>?.| 8x|$3"Վ_Eh-?؟A?ŠZ2Op68A4̝Tq]+>]}X + >Zhaݤ_Jҿ\>U W~㇓t_\xr> 2ǔ410Ǻa zWcc;kV"18ǼtcϜ5oizSc#۫2~cA a T;5ԕ[/5h#"w宏h?1TƽpҨ,U#?q,*(Ƶ Ƌ |?,URq y뛍0U-ׂNgu&csS "Ue+q¥Fƹ WAt"Q!`~v/eB AP̿]oFU0RtΡ@J502 Ir*Bх~$p*TSU.cU)Y~EAG+lZU=gBU_rۤ)F$UEM~!8%vR- 5EZ:B f$ O~ qdd\F4ʥqJџ@;0^[_qx WK, !T&n^f"6)G*(G]jSlyդesUœSrP\BB ~Q)E[8<+ZloUUq@ͽp+#ȥE v[bVA*/SڍQֽ98rOR6$ w<­}CX-; ӏ^A-zGf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vifvD~!vt/:*Jz@rACϱ윰NLZ"G;,(IasN;rI9Sk… FJ&կZS'7xt`m ᤔR \bUls$*|`mgf`GkU)TӟJI\.@Mvja*;KA8-:dP<"AAbĄ5ꪀTS*Jh7}3S *uT-1q?u?09X;_jbA HRMgƐo(bv#r?^QSQ/EHf>JZ> (#"//H0(=ߗJQFU@S&[i8 ^7z:xdvEi׹eUE@`PU&r(ulUwz Ԧ\Ws SfnJvo1銭?7^H6PR$f}쿲)tHCzP(bڧ(ҫOp]HE8+Uۓ! ˥qS3{-KLiW ߋ@ >A;W6*H(TYMOYU a9d -_)U28~Y(w$585'f Dҡ{_ T#կi^Q;ഢ#,MM>.ƚ\VBzڙc Á Ł `iP;V`k,-0zeB JH[,ŕ#Q UI6`('e$Ƶ,vS֔;U*k+RxSvV6&cO*ߓ1 RxQ6mX%Fr:0njT658UdnǓ/~6ڧ֏JGrH3q,x͊\ Fv呉BIۓG*)(F9@֝r钥KU-5\pR%/%݁Bj  +skIvaUoݖE*F~YDo킐%c$21I"RRr 3SU_zcћ;呍!ov*Jtz- AڃzI~9L_3zznlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]mnfr)e4#' Le1RQvt+~m}}h{ :l_YJZ,?_%m/!Ol$mє11q7ZLU%c3vLC=>z?C/'35gost?M4Ĺ>Ww5:}C΅-?K?7zk:=7dż{?}?[W93mC?_d`<vC|eʗ7#mkT\jZ']<ީ,NQ޽۰<sϩss/iN8`8K¬rvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcviƊ!vtm?yvonpʻiv~99{uq]~Á:-"k)+.;CXVuZF*\ nXhˮYB2VMW(U<6b ͊6*W\ qWS/*]V0t!Z2(v9NgRLh~P[U>4+ ^"Ĥ3U "dji7S(dd=BF#&hw22Z2FSxp?/% ҁ&^, 1`htheb;`,M}1 &*sK:ZcGSKaQCj ıuH Ѽrbm="&tܭFjP\$%Fw ͜4)IЃ&$׮7aB5pz.Qa4$2HQEI=V"r!.6[4%!ǵ" ٰXq,l0 G*ֶ-\Mvxht45Wlk:F'p1e3IOR3CNM(2NjVJb 0†uqKKbU8«*2늵Ĝv T( \MUMr*u0+ fV 0ˮ)[5qVšWjkV)뱯|­>9U2=S?"?."OFs9 O@38Xa<‡$OvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU)/4,Xɪ3_i޿B'QesbcDNKmZ"q"kOKAEE~p:ZFK݈Q'yd4g6*<9o6$M]I٨OQO O~c;~_uכwߗy5Q/?oZUcE8xq6*[>ثvVϾ?6*/պk͊onb9KK1\[s~k˂RXoK$>RBhynH`$vTx(uVFI_quٱU/պk͊t_̟+_%6P7.Sȡh -RՕ_Ûfg;բY3G,)-OsPy7ث!T͊/tyί(pm- +eXﰮX(k$ߑܾҬU aL4+$ 8rlWB\UlN !R]N?PQH@V\pR[PQ)gUtJ'X +Zl4]  W50%X]% b>YE}4'lԦ4NrT'~S Vm ׶_ Uc) Aڞÿk*xQ rBLb,8JRV '?J(^*H&=?di^\rKjB) Ԓxƕk^P׷Թ*ŹFjcJOmֵlbpޢGԡ?vU1PƤV]0%bh:SQJ ]փ1ҵajC11ݺ5ylEkʦ)i8n?\UlG! h?9@SWOt=#5pB UtC۩n3S$P YflUON6EWpĴD5jʦ4딀^<8fUsvڕx%c(́W !faֿNQi]kpр1U9dXY) vk*[%LʮE8|*sW}?b1Jf ˦5jܷ Tn'j CQE ,? *_MPTi Q!onR'in>a,KAA`  64s~|n9q5P??])LNfe,^0iTe'隘Ҹ*& t..`EnExDq%BZM;S|R-BʾO^ ܕPhlpH4lmJmQSL([+Fq#qU) V6^zfKjII$t,*ܚNjcJY/mN(p'?8ӎ W]b&'(; "-mv S esBoҙMPGsȄQִݛ,;p)%C\F໓]BS*^G$tbh.jaR)S_ RGg4u(p3-o(B>scJ9)`VBP|J>]q J#~F\:*kV vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vhbdle)^[d̬7i1LqΝ{;ELv7ǝV!l}<{S?'1J&*jt1󒁉'&O c~oX\Q/kva [L'2=Iy̒X?ngQp hw). 9JcI8bԍyRHDI;! $RGaz@aC[L}2$!:t5ɥDeo+ġyBvp+CU+\RN(mA8[ ػ:Earj5Gc`uQ;}'d}E#^DS?l$кjj>0cRZh ]f4?s\h ]}集nԖv[?oOP? XԻ֝E}I2wȿjE4h 朿KP?ؿՆzigM_+ҿ~.WF;'?ޕ?<2SlKRrT9F/oRZp+6SZr>!n$R.L՘[z&90t$~m@m, 4l ! z~,R2+|O׌r,Enw /DrCQMe؎(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]`?_ ;L5bʒqz|DlU>pYyjH.Vui~H3#zYV=_{P4Hl&'yC0*ʜ[NlU/f-K\9y^,gϛ`wRydbǩfT>mܯ:^;%UBM4kˋlU-~j:j~áQe_6*_̟+_%6P7.Sȡh -RՕ_Ûz_8滈mF)g!ϥ7/>ޢLH&*sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثɿm./lHS4ِG'vzn׬فGs' p}(rO,d$5s4j+FrՍk'Twc-RFِ Z]$hWr1\AB^R=ǿlpB A($7˦QgF«B'˦BچmLUfZ2 ! ŕ˩ :`1n[Ѕc}˦Uj{*)USQv<5SR8e Y)"=O`1!e J(_`0o'T&q6 B]r&4&͊#ݛ 2s: TBGJQSP6˦*דJI[ 6㛦**=S\.Q $ujS]%āx v =߫%jUJ\śvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWaƋmCFnVRwSC^ ^L'SǨwvtM zjGFaoJin2 ~ #zg;ԭlISH9cxyp;yao{sJF91 $c,fL?je^͞a/ |_wۙa/ ?vCgNoVӌw Q 4{'6-v <^u)Mb _ H˳ڑq?ػ$?A}mh4<]S%CIcS )?gOV^?􌝇z͍qWCQ L/:̚|?֋nd͊6*ثb͊6*ثb͊%H_S9Qm?OIi.]KIz27lu64?O;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثm% 0A>H|YgS9' z.FIt@@ =)LNZ鰓^K$ϒ2Bó2c25|uv/sS˔~\G.T^SEv/ GH܈8*F- e=OUx(l6edt;B(iQ#mHW O(爥*l6WKlAcPX4AEy}Xz~PA b#=tFBЀ(eMJn=sH|BE}/b} 9:8|XNd=8MV7Jt>d9e0$ n$e{aĖ/Hҿ Ps'pĄWUC4JFW _OC~wh ܃Ƈ&9(ڿ^)jͅ]Z]6'%$+Žr)QXe\&Uzf?폻r?tCM2 U3А #mw']Lءo>`U,'aW,m!M'g{ ◷pꦄ$*ZeΜȗQl㒃Mqemxŕ3m{]|N|#pjYOr](E` /NV-l-1H4MY+XB´Oj4ځ:klzeѶ+ȭS|9oՙ.m w?_ՔaC}?eL(4Ρ2'!Q,eȳO˵ֱ5=`97mv\C;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊GgG|ǛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]VKw̎:2FlU^~hyGӬuⵚ2ʡ2FkE~]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbvt|sbZľ^u^vzʾmp3˵ZI Ą\$Dd#&MfDlPOUX"J1T9h`RB \M72A tˆcڦ.$!L/az+փ,d p๓~d;mܖ;4$o4J{VdlRݼ[u I Q5ؒ;e *;䔅 tsSVn+ʪ*LiTEJ)ݷL4Zi2V=C9!0%Tm혌i-چ % LUs,d<j`4k܀kҹQ0Dc+ԚBȮ ?NLƕ_V={f4ܕMh*sSVo 9*G^BLiWת~=jSUs, Σ50*E#S_~@cJ 8Ԇ*v9*:MA |ª^S&:eVPżLP+(#vjaSx=򩂒J@;͊H _50%rO뚘UN[@#ۈ㰡D1D +@ k㰡V(=4h/c#nƕVhe|C F6 eSJHV&U0*. mʉ XZ -z6.3S^$ܟLfl̳/, saU;F&0+O|Ol%Z %e;W|U Xgn' LvV ;7j*>oe 'EvXaBL_9lb] 7eRm4+ջOLتǒ'JF +qPF/GxȥTDUFL43,Ty[je *W1= uϧȩ/T<ź[\5QHU50ҭ7 ::f#U+klQ{uPU*2+P oPۮlUoJԺdPjcJ,LiU< (6_+zC{0+rIDªUQEc\0R>")Ӯn8i]Py(X=*Nd<Ԃ>{f#R @'Ff4A,z J3!O##J\һJ'ۍ)iU"%/R”޹TtJ젟.i &mOر iTgV5LiWrMw'q悲yy~9s=5=6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*e}=kY)) ( TZVs?9!y]Ox~?;&OvEͼ y'al99O=c‰dG_2\c/z?݄W:?Oو?0'عG#,}\k:f%ij?̗D9?H1?liq1ޫ3'c2v)殷?^9!Xb{%%?8ueQ[-U2ۙ{)8;x!˹?L??OK]C?V?˹?HC??؛~qꧤV={| /δdğ$eGsnaLHyE$!&Cڜ̇LY'iq>RvW6j;8`{;2r;)񴘹x?{_ʭnaU]䟩CK /&rc;o.b4ƙtҺ2??N ~iNq;"6x 9?WϑvIl[%kD9NJ8rfMe?z CG*%Wq1g_M9qFk3fOk2SM yMO?͚\N{>%.>Y^( 3ͪɛ&OGKY6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bUoS_I^UFE-zaŭН29y_c`d&$ҝCC|qW qتA[i^*}\NPt$(HH#1܍ZXn!VLO" @ʋ0uzq#)6K\\T W14U'5qW5Fp?NW1Z imqFٹSk#ν*؆>J3s­K ˮ*T]{RfqRFٱW $Nj@$WĪ9P8[IؒOX%:}_'rImœ[P4f2HٹW`7\B&B7VJG݅[G>\$%,H5 `*q{+ۗWb ЏkV}\h\BXN}k"E b#$q({:zbI>:/"L9G dvݤ4,aq1[usXi*wb⑃^UË&8Ж %UTU~O0](^TaONqO rBR֮57ng~J_\Zp8ʡWD[Djw,^֝Gc Jʊo'$I$U8m2ٹcڭ{y<: TV#5YgY yZ5hv9!d2)Ah)Ytի<+4~>|8cq֯D'JrkLPN>E1 nʔ#ZbOP=8y$wuđ PbER|Ԯn@Yyt pAƂmFi\څO02늺CUS)ZOA0ܘc.8Av#3b 5ͯd<ɑh M>8=\BM,%%6[qkxjdhȪJYA:-H-Z(aQMrݠVo?kv/nXGFOMz)#!:Ӑ'#.ŴZH1lI|l+J94$^(GfFȿ/GMW]}.m%q$UR|@Hݡ9-o෺xCXb^\%%9 G~ _ Z o$QHcn˕gXf *HIzy#wruyI<2nTEڼL5f?f&cUtK;Էop:?4 k4Y\|HΫ?nd.O,ԭў2̘.qr~o^58r?[t~a\Zb 0jO&տIo՝Hsr6,tEYF )#:2K2AiP~8r}%qy27a#9 f ƫ_s?k$]f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW? (bb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Sŏ\ث6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,U5Zcb[;5go_\=}j_@qPsa8Ejpу.RH`R_,_|U[,w^Uzuh  뿫ޏtJu(H|y{{Jmڇ ( RW` ㆑h;VF904 r᥵+R>'ܜcJn*ZE'Ja+k_̶MeE$ą_m[VR"cJۥmgpq0+jcv RPKV8F=6ڧ|'ڽlHֹ[_/ŬM _ʧc+jM&%ce _>i=cj1+n:o£~pNMNff73];ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*e\Y?k+(O,^LQ*@OÉ'ӿ4=tQE 87ߛ\]ȟ.7b qPq;$-P^:{[K6v'3=!HK)!.6JS6l.'dgSvjM8ö́3BIgx(Z<.Y{Cb<1ɴ+A2#+2}x[ᔝ<8,[Ƨ )#,I4?+E2?'y~e,iCObf?_f~OnSAB>Q 610K'UI*+Hb~@ @AY%.eئZث9ux*ym%?qUK{ҾlGdɾY0Üoß3ϔew۲?çQi &kv1OS%OdkQ稵HLj5y{k,%,QW'd_QQX9˩ɗ딤pq#L+g%ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vZ]֫|v |N,zGufF@j- j]yҿ'NII|Կ@Ol7Ʉ$8B0YJءc71VQR1o FkʹmZV%:qLUE9^ h7㊻F]P~g(JFzU:P,w\7[Fʿd&hq"IF]7®jf N^*Msb+ gۦl*ثc6q')zaB,UNxiͅ\l u͊o|Uƣc6(u<>6 ۗ‡d1B_KEU)Gf(o,o?y]mCyIj,뻅1F'ZM]@L&i ЖzT( ,ytYGvWKrK ʨo@RfC6hϦhԘ:jw s ݚ,Qݟit(Rcq6Ŏ ^;-S{YoՈs?oq?Hbu28˙!Mkakndr}%|tzאRH&k`~gvYv#vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf_#pCH3ģ͊c͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*yO;?Msbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*pjbέY6"ޒҧs8]RjsBXGvv{3̞aŐJxHR(~yI,RhWTH1@2՝/PǮ8 UѰ6ˠPEjڤU6HGZ8૒"{0kum)"һ[Xu||2b#Ry5aATZ4F8Ww-`^ kLO[DJ۬#Q#ߦ5Liԡ'54R'a\z<IR) t=U|qԣ%IƛxҋU7Po+z1/5V=Sё*+Md_s~[3X'S/Ud[ʸczt?vCQ~f)liCaJ!6 [NfcdUإAN+>?Oپ% 'zl劢Sb&A{<Y %M ;S0 w!W˄32S%U]|S+z\[0‘K [e9[_+X ޢ2UfdR0R:k KEW7[Wų#+mOk1iV֧m~9`[qLӧq[mpTӭM3p-&}_b%ᒶ[^$[|"]mmF> [Zߙh0c^W96c%TN2~d[N߻ƕc[x"br)[lB?h\ƬhG=1C7$kЌM iēGM{61%`1QӖ~Z#e՜‚U*Q_-*|139vˆ5R[̭JIJ*u*5x\ܓN#,8Rim|Ơ{e<#d^k̃BMLyO/TicHNL }ʢU䓗lQdQ25XWT|uf`xjUw]+#|13 Or5R=;ԜބZ79$78^q&rPUe ;vN#y!<>yfFFE'/QՉٟoOJ<\?% C(+9Sw[B-xuC~]jLrR0(_oy-:/MJaNZMAO? S>+bv_#-T:Ł40re{IKMmG,K.edzf/߀dO.I.?%_E># _A_~ L8\MqB$ iCrI8|&THșO?r*q@ޥPk)ߦY qeI+8dhzT9c%_+~4,GZIdxrck{40%Xԫu_l0w_覽?sYH$jTg{lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v;v[3F<FLu9!Sq?0vAC.jٕs/N+O.q:?]m:mÁXqؘIv O]zn5o_Mp>qv++R|A7ד\_L/dc5/sx.d/_%ؓ~qjǤVL̽Ų'?%֟옓Qlc<靀feW$|\]"=v\SfS,yeSLGvNI'Rorv'.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثv[-k-"|8;:Sk''4o>_Tz+VcSSӒ'!(jw 0S!#uuVSjS\ت:eW ˘^*1kWkƘk\6U[ǎǩNJȥKa헊F1UƔ ҮIJoMXA-iZe4@;_|kENm\)CaV+Zo K: Hl*N%\\~'{>=Aq,eZ1c\B+:w[PIv.FĦ}9\[1%7дgaJ~s}[yP bVî}ZcOOp-Bq kJ "7}/MK^IKkA=LO֦3E bG6Tz/ԭdW1JRuj}Sՙ'KZz*XEcJubK t;V`FLen~Jǫ>Dym؊&vR4ST NtycF*|A'|4xJ(K wuh2ՕZ>rEw6_~g+I͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb6LJ~-G͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*yO;?Msbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊*Hg!P}H ƓCiss'3rOU)DZFMp`Zv<@ DJ!u{7ocź:@awΚ73xG CE =3:L/伴4Q='m8{(vQ=ictA`< O<]jNG`tCˡN~psiz#CK;qp\>v*ӵ0^==UǓ#W&5.ήrsZWBX`t7 sFA4TGӕ\A~]4JW=J)@ ?'oPqvJ.bO先;צ0IbY{EitaGeV:|3fPӓO(n#ctch a' CWq!oFWS傫a9)N/ʹ!%E[q4ڠlIFT- [!q/[kdRuԛrTkƘ:0ҙƔ6c1F櫕$ǻ>x
Z}y̎~ I>eÚ?->K$>1hÛ/P~R|o5;ГdD܏rPT uQTfh##~VK/' icO)Z kI*KEn{Oݏ4RHE"$wl*_Iԏ3~TLݝ9z*>2<) *de}z!C<[_ "'oI̱]O|ed`BIVjk\o7"5*Td27AȄLk So;x oz"ӠO8!$c5&~+ @%6CDOɍ7dF+~hOуUӽ0 ?((TԜ|_ 9Pi@qH?0PWա#+]*J{r$lPbۏ9˽z >bۦ11xZ}ѹUaԍ,'~8-.W2xiȈ ~xF] QZ?2X~ْWkGގOƌïqi߃";ۋwIBxFH>-6m)S޿ QiqGjƿ+~/߇l"!֭OW7|ViENPc*6+:0f^8wh ok^߇?MoaM("޿;pܐя(E<`Z}zV,'H/E{=cC5`i$ LlttL"M5A`/c5j䟞Zq6x*!T}lƣğsyQ&|wnxOHw h#bj0Z|&±ǽOF5˦ŵ㈝az|< =e'. f71#&1BQm@Ď~x a:5jwA\GkPzao1Gf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc*;P(Ȗbփu>? Cu@G7+SRpHy(rrR4]7!$b^(S/®rvZ;1V\Um+#(bUOlU}5%\H2銭/|%U^zf +aQ kX_|bidBk[R]8TkAQڹ*,b_17nîH*; zVJBxY4TlUV*3wNBB{PlZ?BX@,SWryxiN}nWӘd#])H[ӭ ЊFܿgW}r)d-cPJPgJX5Vplۭ޴>y6+cy%TyIrcROlߡ-?cXa\yD= UN;fK(948<@5>\q0qS l?A5q\zlwO$Tm>a8LGhJP:,kR A7y|S)0kԵhza0^E4JS*}ucjhBc]zq ߡUI%rM~6D/U_BGRk\a| (*2 I/Xqמߥr^|5m[ȓeik/ua8)O }mBSqî*(hcpq4Aͅ[6*Wa1UOnW P[O«oᚭZu­ ִ2*8Bj JTdJ{e4"zSY!K$oLI1Z粠8Q*[ 0iԶmjVlNm\][J1bFVl *$ -_[8]+0)>ҵⳓMVki jSm-i_f88,M*{ 493$hgYrչS M+mBmId Jr4ZK%ԭ\KJ0ЅoK+t!I1 #X+W$R RC,cJ)#D$r~E2O:e)7oc = zmf5ţNKg'I#; x+iZo2鶣$B*L[MҡЬU,ƬrOJ1 rU^Z* "bvq]DL*dJQeiAQayJQM;1iq.RPG֮*i_QOf& (S 6HN#ےA?bԐQG3qjO^dn],}CVk1!GYNJ ?bRiwlU@rWTe4tjvl oc(⭎Bc kL*h,*»eh'l*振Pr)iAƜ e헊lWQ\PZcIW*lثW\R ءj%Qq.̿3F;9F5z' ?2-)>&av($]Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث?5_f6*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*تm?XL?5͊Ob͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثG~ܛ쌉.~1XQ8EaJSa  '*1Zhw܁aoVo倆A@v8,YM4Fر=@镐k/Ne#~L6sVMRT9| 2\qN) o)ZodP %5rQ2T(;Z|"eӚ#J ӽ*xcW|Vz}~X%1E5JW3VMFw=d`+]ZъҘ={oSk :YF"Bӽ2zmJl2KM4G6)3Hw2AigVЂ;!\A]AE5ǹ)Xl$%4TS=G W22]*q'ILxcQq4"[*TՔVhaA4ԲjI۾=VN4썚bq2 i$ ^!*i=OL@ZmPt-7#H:X֠aKȡ ":ऴEvc–iL`vpJƴ(0Ҷ@e|@cQ={B,6o[)-PKcH`7 uek{\b<K6ALb 8+_jJB 6o]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc늻ҝ"Y:?RYo9$ R滏WV^[^YAK|A|6,1!!#|U(⭁I8aB|3Ww5prV.TՔ6–180Ms U>WiTVV&*)=:b0օS-Xtn %F,ҨFXjB֋zĩrۮ(m2q*HTl ~*͊n3U˛Z5p51WCN9XJf\2U\UWS͊WL 뚘u5E8k|tS\PjKG|ث͊w e sbW6)p9UW 6́[#]\9rNo0QezPv)hcH튶f\w1W7jⅿ<1U/h\Ub똌P|Lp$b~eJV1? דGnNF?#1'Ӆ}G!vٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUJ/3u|UvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU_5742, ~sR}OL$^`:G6lU2͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*^|gLJm!sv21#߶Eتl&7SJHf"b9Q.]61ev5bS A$PPҙwlo& GZSWP(әiW)h( {dP);NPح5;KK=:NKdis! jR\U{,bk= kTׅ$ F_h;e0$q!Q%ɿL@X 匕V=(vY!!;KKXW#"7r2׆M MJ޸cZSS$ثT4«W1+@q­te (s bmN;5p!r,aWT\ =Vxu[.ڷlLxaؙ F$Tqj(zRZSoKBn-%M]AT5KpUH"`)Y6*sb*l3b:f51Wr\8Uu#,)2/q8ڭW}|IqkAՇ3poc6?v6}j*Ӛ ދx됮E'~m\u rO!D~m BSekkj73F? C'¶jux8[I>e]e}Z_8-x8ZK 5 g!a<oK^ w'ߛ)k1Xˆ׈4|`6W7%\ >~8xlFļarǼf6 >x̖-3A3 I<1q2؍xefol߽>K'-7ݍ?oRS$qЍ,w~6akB6s}QWlj kKj;I1k4[ٓFGߍe?ۘYľ io_'xx 3Gؓs}QF6 wǧ&<@Dw'?V>#_;C;6ن6 T_2C7?70Zy#߇C 1ZzmeVQ 0 >6sS#iףj،}S,+xɦOAMI>Fh]ƛ~9Ϧ;}#1ڙq'Cw f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW͟gүiyo5fX#T ʷ Y[lUlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf_DM;6T6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث|Ly&IEUo4vF\Nǡ b^7;95",~fϋpA``: 6E7EƔߩ%- v:f2 x- E5J[֘\F(r+LrH ?_U iiwXekJ+7jARIl +\GәWd3#P400qM. zW &(zdKMkM-\ĕ*lޯwƖƹ TN-@r4\V i+!-I޽qio4$<+Ne+؝KM3Tr "eNᥧDiCA"Ɩ)ʻD4 m#Lig2GS֕0YRFli[ƖE[.|;"awPPӶ4w 1+{oᆖVvHe[Fӂ'$RZ)ƑMq;qƓMz"놐$S'sK>_7?ަ_c/Z3_l>_7r+RoiT|B׫xjZӧ4Nȿv(+ֺ!2->د\ZXf`o~ Zu뜲Wx%'6d%~9,]MbEwJJi74E`I Gd>pƑ\W72^˰ZTBHIZbYƯ/6*4ks96Ê:5Wqf\ث65.[M༵YhT:ӟZ6+$>™VeˆSҗ]ԋ @ ?`J]|9VsBo?6*?#yWСs#͊﫟lU(~F}\3bC7Gw W?<LثPf]Bo?6*?#yWСs#͊﫟lU(~F}\3bC7Gw W?<LثPfRp"iSYH>)lتIB=oS6*?ȅWЏiwD/T͊(V65>, %dgo\ث$\l?ثI<W?O6*kjF6ы_6*5ȟ;h,W:=۳ mnYTU?ɩO6*^XtX{;'rE,(SlU*͊6*ثbӏ"?LتyvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثhA#qbyv<aeev % Ȝ[]VjBmcVeM)p:OPE2pN>mi$POR¸E4Eqߨ(vT*X*qN$cڽ1@v7N.-SN'tBjbcry^kv=,IX[XCֵ%u>j_MpUW,  1ls:1"m;vTTG69|+ULJmLW/L_[q9)63#r;bB7$56*)z}il bRqi G|UZJf.!]JerQǴ)o oxӓ4 wn:" CdVk,kB0ӊcJFZhяvpR)o l.W)M5978B)B3ԥi iw;xi sO E4#^#N,<)ztǤ(]%4ɹ#5߮H2Lho iWS44˦S=.|{fIƓMr~#-P(1-J`cП 8~ƴziih1Bþ C@072Ilzxg lӂצ_"h:bWUKI\(:20;;qPؚx5 SQȡ7Ƴ AZ(' M.: -8 `Ĝ<+Mqd%KMWo-;[ cHS,"ZUNu[=Ol;-8,eZW)Olpm&-FmxZ9lSAw`AA Lw0kN;;VE47.8SN㚻`)S,9L -;eBk,eɽ6o]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWb :Mھ+"(Hq4e2O4<V6C` KV,RʒcZ|(qBM3 $~8UO SyJ4lhzYj)1\*名æEVArI.bkr:Ƹ!و[W$Lt8ڴ6͊+ߦlRtJuB2«I9-F}ڔ)Q @-ثǿ; KW)\QN= R+z0ShTZacM&9u6F,lvNF2 -;0\܍ e)34)g~EqEv㌀b)H8lw0NkA\rS´16i%@'ĭ4Esr j{u– AA4cCT"JKt#~CĴFTm78l-E:j0+VHh&s4-1އ:RO\UfP .UKҽSTA5 uf ;wZ+NC^m;sĊcik(t\m)b7>5M*)J`ZkZTE2ԩ*犻|4`+="'e|qWci63 Ģ|)Cʕ86@|$N*Ϊ*zWZ[y}ؕ㌵\)`zHlo6of]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWbl|Wa>=6`=9\ `? d4R}q= `.\. cD1yG\7L))ژUt^ >(똚 U3w?,O4xtR YDYM<-Qfur'mRM~Cn(OnB/9tB>xmU_{ b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊\GoM3*DY@3~ʮlUrcv[U6H| `~r~͊M~c*in%P"r98͊)~k~ij -M#a99"bp:..E1%wid5yVMxp^1U^חJӭiBV6*bP6 تثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊zٯuk`PĴxM}n?6*_[rmV'-ƤH$*B6Yw}%UON]M<6*y:ϕI-=H?}͊F|(0vm3blUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbǡ*j:Y[&^ԅqjUGVCnQv xWe;%w01%P֧l̠~θ)v6 '`,]VtR 8J#2Iv8J!ĘPO4v,wD$;$CGli]:"(+|0{]q-6 a؀cbIvdcJ+N3ʽ{`d\H 킘L\ S)'+@:qט'%f60LS*ȔST3aM7Lric21|+Aclk^YEr,]ivj@šu38i1Ol4qaʽi(urO| x'뀫LTjvD1[^9J۶HM|~|i]Niu&A\2Z &72y)kR=2(1鎗G=0l%ɢNpپR6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊!maa_ד6Ad~G;5y̎IAkAo׆qHL*XW|P98H)W|Pkv+.(w5];Nw*7P0®2*؊lU~bWqVP튴oV צ:B54ivW Zr>)_w6b#;/ PֹȁC &ڝsaVȩ\ mTe Ps m; p9=P\ےC5qUI'1Zᚔ\$Sa(i-E2+)B9|G(PXƙ}1U$cIUXo|ثxfs!Jf82U2k\_-OjTb*iebUSS5FkVT51V֤\]V+noFrA'l!w0lU\\GuW<:b2aZuLUN, R(h(U@e+ ;DW4l U#,VrW=>i|UU A‚NE6y5⨶/۞0m|# V/ޕ?=,ܧ ²n0ctw?~z C(?mCv0.8vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfT'YR5fbܜث|9 /(Kư[C~ҳ4p߾͊o^ԯ3ŮKJ)?i'\ث6./a_͊'oɴ͊Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ii(ph;!g8a>@"T.$IP;|9f8gnƆ~.nݔM~zIv*|Fo+->xG(ƒUe*)ڥ *)B^8SN!h:lE;.;ISAE;(qӱS Q߮ E;YNKNn|:"L|oP qE; ڿND&FTCއ;r\:a.1WeŁKN[mPMA€즠q pIzt+N#*GE)N8 iL&?vv;`S|*hiZd2oi|&z*x"~DĎqWcH'l-;0`vtv[v  HjyBj{O |4)I|zKNc?A-:?0iاACZcNfPU0-:0nSػ  SH})f2WaN ZjA(;,z\2BIߒSM :Jr U _b@)kO ib&׶eUA1V8mc1szV8Y45ƕكs_vW5 |U ߾h4I^9*M;+MɺeS- JvPpJuƕPGzu1(Gœi|S[Rg"-;948-5Jc }yD1v5c• +>4S-oȅv8* wP) ֟I.9rȥ_!S8l_']vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]}CBa&9)*͐iglSQ { ꇒHk)iB!bڕp9@W#%HJOe`OZ|7V8.J`a)%O×As=qܚ׶]*9;WN*ࢾPc&&N__lUeJ@r*2)`S6!\~uۦIVDrsP +1*$B3lr*J4ͱK!U}8&.u…6Z3 Uq)\*[Tj,m +Z^*CsbHlثklU1=E.U`jwͶZT­e5kR$\U {f>8t{eh/X'U]4qJQ5e5#|q7!V5EkW$^{bX49`U{VvNUF*6',*>\͊'înOLqViف\Jo9[iր7|m+Өu eC5I*O^`@rJZ*i*)鍮V 4UxzJM:֜ R#}kN1-ٗZ0#&bidwث/(}v%Z75nxx3;om2.(G/+I?B ug_bzɿCT"ԆVfEŴh/>KE͊pK xM+^sWf^ ^^Hc`ۯ 2N?߿)YNMd9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]`ߘ?~] 5!B?b4x[}+*N#IMb忕'"<9hM(=UIK3FKoTIכ n#J(FKhD4ɳb.?(JhDUi$}7±~6*ͳb9EG)}OGiO3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbÍ+@Zve3:cqF8Y%>b<#eڦ|pշ_F.9b?3h2$!o')KD((ex?pהN7iY׺8?KC)xO/~!)̝-7JS킥+]vOɋ. ;C6-|xR?;jaVzI*[$k1i募2'nV Lsr?^9}p9UKb͊6*ثb͊6*ثb͊1Hvt=1ѭ*BT>8ðRFFP0;oO ۝)v;qb+taO"cilRh4%ǁRibcQRw =>x )Wc'qp+ҤB7] ɀ2o]UlUȡccoB޴]׭(v\TPw%#{aK4ȡs /|B >!QN]dZN4ӹ"c >$R]0`O)v?~߆,]34 2bcVڃƢ1jdsQJwmO-+Zt-;m"bqg(~vb̞]]k-;3]L!]SkKޕc!;rф ?SBwhvhHbõ⁅1aC |SCO5\ 2X`Jf&X†VxUmX#l1UuLUJ嗊G,Uo\l mi !AٱVj+\#|$VU9bԓ^(`V߮)]1W0;PQA_՚PS+{( UsIŽ:>ثfe޵ ޣ͑VQJeR@ )IW*/ʩr*NW(PHe\ ]AQ6"|pe޻E[`뚇w%L)X\w#(*zt9v[iTR}eqVQﷆjb LUp#IT+N 2j:S o_3Sp49t|Uo*F4 UPo])ZMiLP{%74n;oA,h xaVƑL*_jmuM65k Njb$u)r qv;0U#m鉐wQ֊Tl)ųYZu dClK)SHªA_ ΖV-u)N=O\4Tsd[]c]mO Ⳃ)/QwsOW`+`]0vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUBepJWlUz򟔘t.nq[d2D|[sb2umM򦜑O/$o_Y^Я%,lU)Ye(tH(_^OLJ.lUypKndN$ 4o7d_f^+F((-hʃP8Pzgvwت{vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfRg^ kN;h-#<ث8Aki?,M؄ dXpYU*$:|sbo +BU&xL`J+MtK 6*G[)~QDI,B\C /HyU͊~U(7k^y֯Y$wVOQ,u*ܓ|9 ?b}H- K?5'6*hIcOPʊSNsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث@RGvvgi(d&fi zqdO\=VsV\q}/Cꓱ޺b~ʯloPrяas->a?2 1f]vlUwkb˕3y[J}G^S?Ӌx3C;I'սH\A?<)Wz/Mƍ2$?.¬r]vlUٱWf]vlUٱWf]v יc#'MĘj()eVbi*M~o]̵] Weإ٪7*& ]xsju=zWe?;P޽j{bfW]vh܂ 4®+3|5ۮUjoS(1C(~]vc% hzS]15Ɩժ:m i,lv\r E;7fխN4o"7|Uأ6ݺ@ WcVSJv$-;|pliؗ" 9 v*.EE: cKME{ *]zt4P*RG1@vS;udi]I4ɶ$WcJU%xָؒ۱UJ:bceFN70Z(kfp *h¿īv!|{bzN&4G|c >-,y ,QN]Bס vž׮H-;)e7ȫ FvR3o}Lii'+ҟF;Z)'ZtރOvn{o^FE] e jƛ2pl[F*63 V('rsS"$ orHj`A\UIe[W~VsA\U&+,t?~l*'57t*rq^Z啊5 {f–#`s 8T49W(sRڐ@ 銴hES^f *!ڻm ]@59t=Eo[cAW]ꎔsPhȤmqF*IL\ƻ\Rҷ:5sS*lG^٨:䕾d|$WhrV$W(aWq?F6UA4 z }F%POnʮ*UWM1W,|'1mK U!{e-*E7˭qU0ab#.F zf­ت\@⭲3F,D#;$cXbď|RD_$tĿ {^vXGN@m\M 0%pvJw8U|em"CsOTܩҴ*9xmv_ܫOQAz~TdUIvbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث)gd2E</hN}_|ثb~c#խm ki洁Ncл.:#,2W|^lU;~`u'כd_knke O+".j* 5]uĆn.kǛE6lUk/ Ѭ"!#Xz"&G,2~}Yd 0_y;+G7VvQ[Hy zȩ}^OI~3b4yR4zmR8֜cU4Ú>~͊y Y-S5ȇS^99ݼk4zlUٱU "{$Qwc 7ثMcZO$Dc$MqD}~̓|:Uy-٤hUy"'Wf_~f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثI>KME3{ܧ qOt4,q_pٻ6*j,RQD9c˿n>Rzhs&^!?<\?.bnITN\#zXᐔ>+Y,1+gvثGhR%m>~>'l|\&?ŃӒ?f20szK/?һ#vn͊6*ثb͊6*ثb˦*NӜ3 (>y^0L bB҅4EwKۀzmNƱ$|)vZ)C]`d췢7mTҞ CF qZv7R^4w Ew N+D٣@M0] ]ƀu8m]HۨO݅] Oiy!ؓ;с. H=Wff<<CFR +ҙ%v7^r5{]FoZ(v5[`z+$ZCǦL 悟dz=)OSZdi l4,jwQ6v5e mZ=qKč C)&dWUO+H8\uFVSʧy7_Sv>?Maդ֯΍`As_(8LL\O]N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*a!fb/C ŤZD>_2O4kzWة9 ŀ^E鋊abj*\ $zi d}xHwjU6_XolUMHsj_,1–j EHD bB*sVUL6SS :f1JFT(Sh3LR@|(Y*N* |UGZf*@rU f8cc[SLWlJ偊cO/)Lzf)l#\kZl3b$jr\#k\b*WqWH8-~y⭃jo@+aVEIYACLUUژӁW]saK*mqVS(nFbk|1V5;- (*;:qmS64MlU2`KH_ UpQr h;.9qKAއ7#h\܎*ڣliPTLhQ6*@/|Ĝ DsƀJJrW k {US$d[RN>#ڟey$[b,=+^_,81:lD֝+GId P7Qg`jk9& 75Ƞ/\.8X+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]xoU5 Զvc%RnYW`y- T߼^+fX"1t>ukKv15ϥsNWэ?:?OU{ftF8n]eu hEᑗ3b9!LڵleFI+τÒ͊.?$H0޲{ei$*>n?e~9T/?"jaj2,g1R0I׍qتYߔ7"& 2 ?6*ȿ.bmБ0Die[DYcY&u[1K+~7lث1hq!N+'y=~V(EW6*/-4/ˋ)#I<5Y-+$O?ԕlU䟜󕖺ˤyI $*Xre$x|_j66*¿,!/6~:\]A%*ҩXYZ}Qb~HG*_Wys^\4ȖKd (;ryI#3ٱT6*تW?0ysOWXm-ǷH#O$f_9GyRK<}57Ɖ/㋇sb|;:lZF! ~Ԓ7ߴ|9QFkO͊͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^/ZE8"r |/SJc$33]+/ppt1v ثW/"]yzʖ6m}-GzqpkJ_Id7^%( jIrxӋk12xvC3JݛvH<W?fx7a'8whmNxqvG^]vlUٱWf]vlUٱWf]Q]HvOoliR*j?S#vv?v{p[tNnĞx`PAMӅ;(BzaZi̕o,ve;z2o+n˧-.(NcCߦcn+]Q  L:o7ìhiϔy8i~̏Q;WP25G6V?^bs/hR Pe'i吨7oXnWxyC[%egi Q8]r`-Vi"?1.i2Zr`OF- U;?Uؿԭ(v#usňO?JҼ 冀R ;>O%5yg&?|; %k{1ʻaic3!'y,r((eLݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]4Y,\7badk`V"}Ve%q}b`:?$H4İy|]j e.Y| {fAC 7\Ҹ(1mTؒԥ]qV|sr}2FnM:W目*()YJ}@28 C jڙCl*NTf8B@aJ;ǎEV(p>4eRa+ᗊܐ)p*j^L oPO\8VwaԦXfc[Nf\Pf'w=656!aӯ(l} Vة啮i% sP2 Ssˡ |Ԛ RECN  U\wLUMw}m]0*NG|Uz"qߠlUo՛*q=إk 1U4;Z ]9UI9 ٰQ½S,ElRƿT*]a7.:w*ebFth2J%HQ\ MS~ L*{`V٨6Qr7A9*E}ʠ8>_4N&i͜JiqTS6Y<\sN|֭Eks*AG#]&%XpvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊;CϾgYl5-J[fX-&.hUEf|+MoN"SQ T???lUCgjsbCH9WZxث'4lUl\cN|_glUykrɺړͦeRTI/6*^6*ZpW{AlUcykR,5[ 8bwcٱUmk0KB9(%rfn?6lU*dY''?BÐ"w>lUЦy Yf?ث"s"6*-?-3b'? f %+C}eH5olتQBIUX͊?<ڗS3bחto- p$ [WP\×+=Ĭ|^lU&?>?6H>go/==*͊sv AQ:r>._fScv1b]_̩&^erxW/͊6*-Z#qO!גe俴TvlUy?Z8ـRAە˂?͊E'G=H F:s^s]sxoM}/||>/I~6͊|Ӽln5$Xi9`a^B5i_ r׃;f^vlUٱV5?~G5UqbSb6&ibEJGH?ݗ,y7$|ثbP6 تث)6.!敯!K1E__6*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^oFTX7rq<$3@au:4_eYn/A.,1OGa`͊Z]i"n92BfxKLpqE;̍ntU9ӽUdfo,;T C>v90ɓ1PdYͽ;b@N~M+|79mN7BE{vlUٱWf]vlUٱWf]]:VWs\Ӳ?;'%Sv$ vX }FقMiR>xY۱܏`f cLTS\Ex`C#v1K¢v4*@)JmͰ mENvhfb@1Wf;U}AWcdUL!FlR]I'q\!ٛzW$f k_׀ ;5uY۲b | ve?AvRҪ>gHva_qZvWP =Ip"z.IÊ֜ztYbk *Gz )vb:]`v\UٹH" W1vf}HvWޛK̆J8\u4knvcmD\Vݙ\v(幩Iv7sҧs2E Tu'H8Zv#$ 2(vS٠].~Mhzf.G+t)AA0 MIv5)>;d]R]=WbA1v`E`F!]Y+3 쯀[z!%`թeV]ɮA] J8һՅw&i]q'eE @)ߥpӲ].Av[r5ukn5y0qE)yS&ݍ`Aebv>F?gKJJ$RMLyraR)nv+"ݛP.鄆V"\v`GBv03%vlUٱWf]vlUٱWf]vlUy-ͮNQ)eo37K9CY4l/N<9; u5m 4a<)fo?~ k#ac)WM3חaOd;4ٱWf]vlUٱWbBI 7v vMtẕ.N6I|yŨxyY: Yi+cĻ#֏qܵ{#/jspIi8; svlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]tqdp93v.B\shV;E>ge{˪ d4/"Uы.%VP}e9*J/*#…- d8.u'(mf(OOCk\޵{⭳?W\Up4h%ekZYGm:mҹw;Woٮ_\z`W0-޾`׮*5qKe; 0+\W OLU`CUj6)lҙC e\PU֟~mb7AͶ(lfV*l2ZjVeW[p+a zF)qPǥ>YaUrbz2*]|MbpJj[(w ָzLjj% ¦j U9YSeo1saC|jw49Ua~ƸN\Us6i#u«H}^*ZPe b$|ݱWUt{c@vaQ2BN. O|h>8Q_+H!+e4gMpqMq0Zcn{fm|xbi`J:iҘS\3mDext'O~8K!=US]+SAb^ߕ&W`[p.녃Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Ajg>zޝo4Bx)F⁝^YW?VP}Z=7C'[6*6*ثb͊~d^愎=rňU ğ6*ʎOYP͊Twg"lU/ֿ[SCn鸡u͊?#yWСs#͊(<:{\Z58_ B+˒?k6*G"fRkptT_ӭ5.+)%GrGbs_meT8qsN r R o"'%͊VMKyWʧY5/CXii1TYZӀ`uY/TT͊Z4my4{k֌d?g6*Pm[Ic}m27VSXfP[nx+8`α(P YTpIwF^q.Qf_!%kOgMGH୽ޞ,|Jd ^glU蟙Z%Va`.xdNkbD͊6*ث?ybWٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثGmuT݂i1lj鏅X;2}2vG3Z읖=Wd-|\T  S.-'?fCF}W3֏O?g_>sOC $=G0ڿHP=1D?VI;#Yv͊$K;HxRfoCe:̇g MkvlUٱWf]vlUٱWf]$e*N,#A9-c׾U' ?SE~N=wJ Ap'N]p۳#(zwcyrtŋ4*ijݎއvb0%ٹV4e H&va]lmĜ o*PKՀCz;Sm\2즠&ه=IvP=cV vQ< ctő.j~c5ܞ@eNʡRPM7 c$}[v_;hcH.rT6aChEu&YcIp)vR@ v:.'sh1M(@iiK%:❱Cт$Z]}v&kSCL6~.bcew)Z{Ɲi:ө =ƕ"єx@Av7&$ez;] jkߦ.Yߩ.ˎCDZm(@S|i]tC|*?^v8I(+Dv7 Cީ*/LكR톙;.AAbَĎb˒cFzcKnXY:bE׾(.T$U6ٸ8i]wc4`a ƕ cN#* cZ ) Amj@vm=1v[4v—c+A]L7lmآ 9v\&݉3R' C%ji"v> ~wA.ƹ 廜BmI޹%vbv3]CUd*Oe]4c5Rv`\;9ne>Nثb͊6*ثb͊6*:ZێRT{3B1ד )}1vJ٨E[.i{Y$_Smk211Tz]6/d/!=;f]vlUٱWf]vlUٱWdKyO:]luj?7e~Կ7cSÚ?sTĻ ̥ V#bhH݌f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]EqWa!HzYfHC'a7:8??VelKG֯HHR,b7%h|jqe4„>xXPbRz T⫊j僊du aāȌUo,6*$`|sr[Ͷ4R3Z~ cKQa*i毎 UޕvLhj*Hƕc[I\!ʮE['adG٩\Utukm?I˧| Zt8UG^NjV]1V1bztqKnA eV21BԚmAVjƘe˦h8q 7L ڂݲUyB>9Z O`p*M."(hO\|)pR*]qU}̇|q eLUʦsWsF}qVf*M-zbJZmXT||5luqU00*ہ5]zt?j튵\SmaVUq c_qU7]3.+Qn@?,<*Ҋ }ӀE7<1J6 jqܞ*51V:f87AWS+|RB@a3s[]Juכ+&ȧ[ekN1?߫%1_ۨk)S\mp!,KXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊O͏D5fə3b~ɛ}7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]|YyZi??jWxY&HaO7ۑy7}vlUٱWfPsiS9X"w=K"~[ OhZLث&ܽq%99Z_Usb?P^F=ثAyqbsZQNrnZzpI^lUBu?lU'^I]Bu?lU#ֿ +iKT|j|AʟAGbw좠ŘvSԜY;(vc]Ezad :bo;lVңt1K8ٸڧ"T.zTBW .O\P2%;,PIL Nj1`\BvnPq'rv +X7$+P]rOO)7+~mښf&S܌Vݎf{كR8Ye ]˾K~[vnDm=:1Wc )AvX;PtvbiP|1WculUѹb{ Vݖ퀫i.XxC)I.ͱ&bo4?,#OqvCF%')7wVؖE.͊6*cY4~l7aB͛/eϹC{Ilz}26?i;&ލcME dgjU&C,k8H%b{W>Lsx8c_;8qOvثb͊iuwpIF])!(Qjˈe;$^h)o'=ڿ~l{Kcfn2_^^ܻ6*ثb͊6*ثb͊6*ثb͊6*ثǿJ0KlUlUٱWf]vlUٱWf]vlUٱW˿'` ث,ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊AS*8;2B[:|`P{2@nǦvktg;L îP(OZLR*1Y«TJvZWrw`Uƴ)9P;aU.@S\qKF@s[iN1\P)N(tīqHI5ڙN6k@FeMkj RMJ\83 Tuˠ®5vT[r3Pv-T(UxjS;bTTl)=!Q?,W eSЌ•ʢ-W,u؟|R${T7 22M4[eIӀu@1bsM!mvܑOޯubw%Z(v4C.1v7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWDkiDծmxVTqH%eL͊pK+Pj7%?-}#vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]|M/>er~9yiO7n9W9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUi%m)`h."zN~ҷ\ثثb͊{XK;9W^?UC1KJmpRDӢN|zI?SٱWheh0BD|ۑoLb͊6*d0/2ݗb9=D̥c鐮/?#?2yLZY>ثb͊6*[7/+MK $iͳwHP?ts֬H.nib͊6*ثb͊6*ثb͊6*ثb͊Y;1`ƀYbXrQ\}\JXfYlUzfm[匋5j͊b>'燗4)Ѥd4anٱT7A]6S먫E 7_bI5.*OfXރ}M:H`!dt ٦H֙T6_0F d/ڡf?lU;W+oTFT Dc^W'RUן6*?to+iN`3Sr0YeӵY%GƦ`ÚL+Ϗ͊CA>l.k&,GrH)_߳ثУ"[bNlUGoVlU@FmV"1VsB D͊*yIm_hW+wlS 2'lU<͊6*ثb͊6*ثb͊6*ثb? o,hyPŒKgp(Ye?'ś}vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf_%JA0t_6];I $QVHz;ȿg}]ir0T,WW͊O̭Ȗ}=!CbǚxoқaCJTbُRwLR철׶>4̽~xو{Kʝ 1POLPʠAө—cQYe xTX۱k\ ]C'hh2Hl  7c=v!r<LSNƊ!kܝٸ>J5%.+S}|P줌So| ʚI찤ƫcNGx1Q  Wba@N  n6i^ \m]x*VLkB>,!]#żp).-C؊6c8,)w rE.۵N( Fۃ Vs$|ӱzN]k )]ͱ'zQN1;IJnmȀޔ ikZ(첣ۉ}-vaE *Z%KUٕKRڦ2+Pwn$oʕ;]R5=qk'g)̗]vlUٱWf]vlUٱWbCH }(4~gI]nXى#Af۵#1b5K%wrثb͊6*g0r_;_Fdo-Qvq,AvlUٱWf]vL<}[mR{7>K7]rG#?LK1Nݻ6*ثb͊6*ثb͊6*ثb͊6*ث/"haա-.j0iث|~h7FqIgثk4փ+O^ OBIxfY燛l.oFUH+b?OLtk0f#׊3ث~[ `&OafO'ث=2^+%p?q6*bct䯻~r_ث?ɻ)MK5BĀ'_yW{̏:}A ,Q"^"=%C-Pس|_}^6*oǿJ0KlU|ѮQC$IH}8͊wCVg7>b@Qs+jyTɑy;Qt5RBD2\~{閺I!ضlU 7^Khq#_DUV8V/kؿbg2~d| ~!>v?֍sbm㷍aBƊTtfUsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb v[1lyLv5u9!.9`Y^2́yZ:z5Tl  +Ey%NJeYnb'1B 1UHLث e.+VqmM.2J-'z~3>>MfS_$^ȑU3bOS6*?pl·8G~,b|OUӮЗO˛KuYC5"Twrx*lث2}HdJҪAlUmìjM*_YU~*Kƕ_sbثb͊6*ثb͊6*ثb͊6*ثb͊Jމ'E0-MY6͊u(z۩vZ V+9e/NLu=Zzzֆdg0k~>XMZO=~d'.T{H &V5"lUD0(#E*@͊f]vlUggi\DJW'ӓo| yRmWZ4Q#A8"J3~۶lUmߕ$3xB[GPJ<"%_͊͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثBCyJ"ßPKUiSNRy6w h6ƛ,v`Ҿ?N,-T77L!\Iڝ[6)[!C1 tp1rA -a@<3RvZodcml,(|A÷Ft;mnH$vȵޣ /^—f=v:2 Bq[vP=(;ݔHڸ;,'瀫@Wn$Ǜ 6ݏC.E.Ɩܷb]CʽKГCQKM]u)f B(v`vWN.&i]5[߶e0>IvZ׈-c*S`KWv7z{.ءقJSNb5퀨vYEUbk^UfTo 'f>X;1& e(+зGʸ Wc;K֤;(گr0&ݍfxP]'~v(V'ihe,ve)+P\ l!)۾*PXm+z@ vJ͏^+5W}i4%y6`0R̊Jm\Vri4e?;76캧+]lQNUkJmWe `kiٽ7|! ;/A Iv`@>0`8!JĚWeym@<6Ȇ.NJ®T$ҧ졺ӭO\T9b;xKbo4e3<@8Jc`KUBh0nMA&Y;*E( ;v窎FaB1 ]"$TTNR(pӊ܊zc!vrl|ٱWf]vlUٱWf]v Ӛ7= X\HvH3#)\ѽ2?6}+<qS;ܝ\Իf]vlUٱWgm?o"3s'ϳhg b͊6*ثa5)E}n{7avogvثb͊6*ثb͊6*ثb͊6*ثb(O/WDW6*sw'sЩ#̼ث$cq[ʤE3b[\QzXuٱWM?i$> /6*?&nMϕ4n?$x\ث o5B*bW_lUpmu+|8n',6+YWĴqث+|8)B P͊+rB`_mT\3b>cgc'¥__@~en;Cg/d9zYWIJK*تOm;ӽCŸտ*/UAˠ#STҹ}B޵2V2zz⪣J)v vvP_\U`SVʩۦjUo5Lr*1 ZR)\)Y 2銭bIV %FpmBr[{ LI'Ӧ fLR횘0QzW69zcUwʮ؄-@:eW kQ5p+K+ UiCL%ieWTul⅌ kpiAV+1%rV5nUUaBklXx튴 ^6تը~\FQ4+\AqUNFQ4ͅ\ v=jb:TEMsWvo1UzT?k펮*59U­Ў䃚f-(p7!v;J@ ]ĆPnSaFTcGS3| rNd$#,CrU 5K<7huZuW8Ko^2=vJ|.3kvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*yѷDXַouI4؉.|d͊6*ثb͊6*ثb͊6*ثb͊~PѯekYfsVw6*ż 1\-ޡeDIqY!|+JW?/?O7?Qw Z3b68BEnV-7^9[Zj:=q!7*+E+NJ9V}o8Wa.ic_!>~ٹ|[تQB?S6*LFli~ah ~jOe6*8M&}D8\O٬q5~?%@y@'W$^<}Y>fYWyH6Ocw_s=,LQAPx͛e叝=SN̰JHߐI_|6/6*oE)bF UC0G*3/u͊sW_[:c"Hv<8I,F˔Mr͊o۟lU,׿1iɥq{1p e}*-VlUrSbå2z̥:I~͊/^>I͟WG"keTu9V_m[T[ʒ׃lUFԅ8`,ت(WCє3bWf^9(}7YW\~ykzt!n)-5X"LҲBC/N?nz^>_EF?yoScy\(PDʑٙ1|6*|ثb͊6*?22-MQMVJm f_|Imn_Rf$*(⑯~'HjW,ث!S0y'hʀ:7/z|bB(ٱUWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثHث:[::D$dA锓{49xj⑃E#'v¦W #L4D#MpS(+6I-;)[`Md$Px.cOv;(ğ.o@¥٥hĻ,OqLVݔ jt+ PKxE.ƪ:q@v]jA= .R1vWzqӳ"ҴqvZ@;E7E>Vt@#Ul%1v60*{|84 )v1HCZ1Wc?d ƙ>z‹v8Ÿ6ޘ +v84Nv5|^ e0" `We$ߦ,ȍl*T RQ;`Zv4ڽ8Pb:*~%{|Vݖ+ ZIvRң'fd M:lXfq>C; 4403RCW6k^ ʻ]CCA48W`WcQ7P!ـS]E |Y;.:uW40&"RA^Ɩ2֤Ȕ)bera£wezU|#{veBƾtVmلD婦 We|:CGБNR 7NثBd֔^ H nAX(Gǭ:v]e5;u]փv:2,hz/| w7X-wF`KPAPZF*z"/i^Uһڵe+I 1;"sх1. jkaWe j)]ܫSMuȥǩ?6bw<٫Q6WeJ ֋Dg&̗]vlUٱWf]vlUٱWf]/ n>ղTo$/_O\c<~G^<_YeKWxثb͊6*g0r_;_Fdo-Qvq,AvlUٱWf]vLt.7cpۧJOGޛz|T?tZjqLK4Gzثb͊6*ثb͊6*ثb͊6*ثb\/д2i\ث'p*NlUKb'r ͊?6i?*(%zкޛ Ѧ/f^m99vNڬ|ث>6~UaBc2y|ث(O/WWYF_q͊kx٥:%YWLf4rNlU %C6*N-+M6*{k+…Icj&W6*OV;7{{kH8QZF+i9f^Y8[[nI4."NrH+c~ٱTrk9?9VW(^/O̕f Jܒ|9Ǜ}G|e7?rf_OI"ĥ܅Uz3b-n4^[Wӂ !Lc_L)3bq.ۭg&O.2ثsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ZUsQ\hvhc|yR~ᓇ6A~ vεkl/)Ԉ][Z15޻d֭(*1$g xjv,aKN l;cB6h)ry ebV3TWj]qWS~–N ءŻ]VȢl>,UoӱG]6uZk7,U*T01HUuW&NtM+_/l QLܱV:U[*iJtiTJDUxVnU* zڸR CU4ttޠ.(~?]qU֧ͽ0/*)lGʭ0!V+Le;aUPv{`VFw*lv* ]sWq^>Wއ0-jU Q aኹwv-/sqB@+Rxwe ^|W, s+-P f'tc.xe *٭h} U":إ`z1Um(^AuZS.bjG|nrܑaW)sr*ً+ySV2a=½qtVL6QH׭ۦp=vd@rMN]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUpuj;Yi.2FoێTI#ouW_6*oWyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW_^(N0q~ث8͊6*ثb͊6*ثռbje [#>"3mBʧY4CRo#\P>of,fX7?|i҉G͊$_ћK[~I V^45n|lU$?oY/מ<)jԛi} ^~&W|?HƟzEWo%Eqxe WK̪U4)~q[эxP.c%g颳rb.9]6_Ikt0}_6*r3SmTKȫ.h'ت>Ťj[p"%RHl6*ï%i-\qx/%G̲qo6*C6*ثb͊o~:McXҵI?eiW6*S>tL6-UP;m2]Xv9/А1JP:cicBʘ;.P[c銻(R]δN̼zJe #WcEUN ZvQ%7O\,]- ]mUَ474@t;l=J좠,,k8cIjj$;ZTcwثSkSO b%8HbpmًSB]iv[Nf4/*]ezWenUقNåwœ%7r+C /;O mȈME$Kφ(v8nۦ WfYU#2+qb\2_#vlUٱWf]vlUٱWf]vMt7l co?~&/??t9O"?vBHvlUٱWf]L9_wOH̟>;%.%#.͊6*ثU'`-ӲcZivvz7]CdMw<wd/4ٱWf]vlUٱWf]vlUٱWf]vlUٱU"FʂOћ|m乵 6Ҳ?c7VʿlU^sy-t100o|'6*w\mC鏈~<ɏfYO$Nگ+vD;/lU?֞Zm]G.'O'92ܸR1~m+}9,PX},/._O}-gg1@8*(UTf_2=P_3bb|~^yjBeocdlث6G絮3ڕ!JJO͊W|ln(&gӒ}f_Cy@:eƕqNyROG`[6*˾bֿ)5)lu r !^f{yibN.Y͟c+FGUZ͛z'7./qxؖ^3FHWLdy=d*9Cz|_˛{/Ch4 1bgwD_%Oq06*i+KG߾F ZP}bcY;Trjm7&y'!HV6%I&cXֿwLPpN;a).P:mbprmƛWbo' ,lzHWeT9+v5* M 8 KN͊6*ثb͊6*ثbï+Ϣ_Gx$2/!kMI1/paa_͟܋CzC2vb޴v~ ;#Yvn͊6*ثb͊6*ثbɏحUèk_%Ŀl1F/yvc24/uu/'5V,~er_TCD# )mvlUٱWf]vlUٱWf]vlUٱWf]vlUk(pUA؃Kl_eqMK; ͊Yݱf3,H$%kblU ycozi4}xsfPZ eio8H\تgb凗uޡd95gRX|S(fh١"hՓpk6*ӭ腽Q ԄB()T5 Z6z)<$׋?i\تK~VoD]"̦ZB=fتo/.Hi^1!>xg͊ygK\KZ[ܺ!lUook *4UTP> A~]ufW-`dS4JlUeeKmiC *"P?Usbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMaSM2-߈\P9r/ҟ ?v[-^>rk,ļXڴV?&PR1F~R:pb!"W!LUOtU@J9})בJ W YQ0]Ko!ڛҘPcVlJTfU0*!|T ~Ԧ _lW ȥ:m+*$*H;I銬 rZ=;)\#l˜ r)^ ǎ*^?/ 6;tU '.U=>y1h[ Z ytVtʦ*ِ6 *ŕ`|nb`S V]22(h nr\kP} bR+zt>9Uءq^;}cmg `2+,⅊+7;aKaYLqU5ƃ2PMk1)ZڿUp:uqJZe4ͅV0ƢenqV҃08 L*֕4W)mڇ<]1gW 4lNliT)={e▊(45*0+JXm\=VJP홈)'}) Z_s'lQ(fRk0{5epG*Lj#chϼ{WY1s2]KZP ~$n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊!Uկ<瑡\[r$JGďuoϔ_6*{6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*soQ;c|ث#C/ثڳb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?MlU#:$dߪ<ثsb͊mv=>M[X`u=Yf8<(WWߙ^LZ+kr /^OlӍ3b{̍AՇLOrJ}-iZҴV X*+A$Slثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊iz;9Z\|s-O\E;c˭i3v4P@Ʀqej!٘I>=+|6۳0;֝`(v8C, 5(f0찃*A)fH0(p^ aM;7};m.O)`mCbG_1Zv[ J iى;W &A=Trz]hcB^ ӱxٕysiقnNv8*I89%rRNIî.̠۝NE]>=MOvPN@R3u銻1Zǭ~Xqx`Wc& nUߩ=v[Uֹ$ӱV4fys+wܓ pڤ y+Hz}2uLRKZSHv9h =ٖqJb`hM> olKNa\fmji.Ɩ=qWc~Jnw';2;WfkaZ&ǽCP+޸  d4zVLT;hKCRz Gaڠo v&My~х.̤njGlT;]w h7]zy|;|4RK(5Wc@#bБ@h~XJ]ҤBJfFնvc*@5'ǾH+$B늻է٨+MWcX]Uo4RWep {b̠t4;ebPt=0@hTt큋` _l@Bj:`K8v](zҧWeF7Mzf6Dv9!z.R PߖT%CSLY;)xl*V> We\JOo2]2!vlUٱWf]vlUٱWf]vlU.ƿo%hz2sfI}2RN[QVk^[Чm}_]NZyQs4cq ; s vlUٱWf]vlUٱWdU}Xz|;3l(?a?eީz1CKkFLyF?E-,S,feӋќ ~?EkvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`!SC[]à]I~_F] R1-lRg[8D-b^9w?r^v#S+2T =rc1P0![ze &ٱVC]en1UCmݰqtNZS[ʔ;|* 0%`zPPX7MaB0oPw뗶Sfj|*\~Xw;ebncme)uP|Usߐ Rsu]ӧnX6޹W w˭qUxo F5*i]q8(&{fpzf PҺʦ\$50屡،8\ s0'lǙCu=3q­ k2J aBT;z`JXT­s Jf#lUbƹ-w˦j뚛rA\W*f=1V|3GU0yarxi9]wW$fǨ2X:f\h79]qCt2\\v)h2Z2!vۦ4U"+#lvZh{J:Dz`)L  Qe6p;zmpͼtT,kVߜCb!+]?jbah䚝]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW?sljIiy^pQ?gfXfm&n} b,8Mm4AOxqO,ت7G%m,eFYPY|*T>9Y@P^\ c7/bB۷oSΖ}?y}?8+6*ן|^lUhEK۷rH&vZ'fSk_ ^Ζj#HfA?,kTd<W7!TD>#I]ޤg(Rw&~9T6*ثb͊6*ثb͊rN&6*bgc6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊r%FoH ?76*تE8iQe5yVx~E9W?ߙ:_Fݿٸ'fS?/̫&mgA,Cȡzz~'dٱW:aoZ 8# jxF4͊b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2X F|exߥ2CVz}['e֣CS䙻/WepS26r2ۍL|A w vW W}e$b좝jcIcׯ@1KFO8 Kzt|i<AۮFػ&I.0o6Ȅ,W|KAz"ق Tw;W ]Pc*=0eGTF*:] {Welo5vo ]Qui] 2v8wu2(vbv\*](Wz)ʿ K' ]p7vKɸ!_*?v@ ~ҽ+߮IJ;@I4;Dž)MJktlC.Z)iS M;(1sݷ70[ل׹=cJ짡eO~vYSSƠ {ZHv1mL4tۮCr5S:i]MɠWeԩ *Im"T0$Hv9bʩ$w߿liǨ߾,ޔ&Uҧ(+QUL os!DP.إPT>v d]A=`b×(\ 'MH1v4օ 'ev]+*6N.ǓZӡ49 V鸮WcG.p?u8D6mo|<NA/s;g v 2_"@?_?ϳ`ӏN3 ?SG #5;LL\O]N͊6*az64ࠜ)d5V\c$ßU27Ǜx՜}~?tdtK?w)fۢ,G0:fF8841?/,d{5ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v !p»[]5®(V[d4ӮVs4˩E=Mw8*Krv1,f(5;m\P-ŲS$R)Q VJ)Jb>c_|b=ߗJbrl 'ztL qUa2~/Z8U+ҘUHwᚴ2dB: ;`b=\U~+n⭑QJf'QN@b5߿_\UNM:4Njqf-fU;eWZqUǡ9+Tp8Pæ`|0%S֙\v#,erUG\(\\*\XlX^ lo"Vni;0R L_Pb@>xoޛcLlI>?WcBTƴ5 ĄcAoo]ԍjP:|e1zّiJ-A-;—f@Sezd㰡߶;-#y 7—f t톒-vcIv6X]`CTlF÷\Y;-Cnn:o-ٍ(imCN@3R@KQ4 .SBާ~4;(G-+c*Ra?%v? (Eh2v6 mJ}bքߦ(o֛ vj*x71^+Blթ9S.HkM? TYƛt WctwHv;*KZdZ®Ƣ'vZGm*5ojQc`&V]dZ-¡ّ jjHثTJt=pvCZs We$caNv]@؍"Eق}iv:tlUٝ 6Nt_׆IM'OHvdP6=xUأ 7]IU´=qWc(w\4cTtiWfƕQHKBALibSSS;)EEOS]Q* iџzȫM&B]&)]C"54W!X S̠|[v6HF5-AOq;9^b͊6*ثb͊6*ثb͊6*mw5kwh^>07p!;$b:(rͤ{RdVA ldg_rv;זn偻2}a(vPJU?xٿ/?cv,9ZKu[)meu۶ULBP=!)J`:!X҃=7T͊4hbv\iL.)*$t1\ UuˮH!k%HL @$ҙثDTT, UP{S6*໐sRۈ!OU)mb 3WZT똜P»7LRzW(PS5A]ā̦R}4:`VݛhM2LRHW*ֵN*Gbh2†:nG|ܩ\"FnX5*F>YqV!ܱR0bHSZqlPW6h'>8#/ (U[ 1\Uv\*৾jWW7|RvˮwC_⅁ @\ ;f*OUB«;+@w1Kl7\U'Zb5w]q18ӘU]q KtN)n8+Cv,6,d劻ҧL\ѓlǵʦ4隸2"Qjv8Fy\dql[G6y5ڽyO93r ! zba,h䚝]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfX|yBMCYHQBÛnjQדfU_⹱W󑺏%k $eӏH.8r_4v|o6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ت:=f%q*Esb~vfBU$7"YF9 :}9~ڎ5͊_;xYȓU3b4?W7ܸ~~ϕRq8/b73bsS 5Ֆ'Uj|j43v>_șT^KdxO@jW6*-??w2[C@d(!UWflث'VכDie5I 6vV)Q(M3b͊6*ثb͊6*ث?5_f6*8{XZ%%Wo\ث?>.?0nGimRhҵ8G<7Y޷~ךl(㘕33W|y4_n.b, ӠK;4XB(vTNlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R'(c8K۳[?4S؁*/Av  M|;en@v(>#Ӌ0Q6$; Bn̦vZT'5 =7>;0QS_EUk‡chvWb`k1ZڛҘYq;_޸ݖ8PW%xWc5`]P 5441‹v;HvYC bv1P%I>+n\VݔPGz imٙ|)c5&lVݍ64m]ڛt`)NGjt놐`A7x۲f5ޤ xP lj;VWcT;)] MK|Vݕŀ nG[v*cj*x8;\+Nw㺎)mcJ | n `)Aኻ$aNƖݘ5)ijԜ)e4 Wƕ\@1WePҀ&ݖ9=vQB>ҘX۱I4P1MAޟRiқ e*W!ِU{cHvZn+We+Ew#|HduiG4Ļ1hXUӾّ(B]nƴ=zvS|DVuƐk']AJd.|6һ/ Z] <:1C ۲oA'-, NƖ݌aQ.]zd(!Ս)vHP*~3;vƭ6좤b*AQ|A'qM@AZw"݌+V MS]v&߻4E6CSE]b f RӈWex}8һ cD P|#ƕfBPS|*PjPn;cJOz@WcLh~#Wei҇®R\i]ܚǦ4\{&#b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ihb; "쳸8I{|_BG VJ: 4,@2; 姑Gƒ2;+i$xakŃ\lPPI]][Iw"\ 6V71Z `V߯ӘH=s\P^kjo-}*트sQ\Ui@(:pP")m5`1eT^UI T5|qWP@U]rAV0ڞىZT>=2]‚bT{f8ҹGlLԦ*U تs[w2qU>j9[U6o%aO|Ug5.c\RJ5ʡ튮 ˡ*-jsq8văZirVޙ+-W\m]{.-1{b {qjIQB6G)\(FR`V搱۶0jZ훉[ČUj#c8:؊fN¸UTH8jhf\P䚇3S|UuSN@iL0*b;u6lUкGU3buZ&fXgM zqCP!}Qs_lت]?DӛsyWVPYBRL/@?sbNlUg>gf%̠Og*c;E*t%YXP:3bYvҿ2olyn"KhVD6I-c6*WpYi[PQ&Yrگ͊O5zt->} G$m TrXU71}%͊Ͽh ?c:2..Rh6j2lU',_ҺzWTV͊b͊5]~TKMx)+ydٱU?1yr˗iZ-oyqJ':lU+͊6*ت.Rs- BѱSO lU,?G?՛e_篝4dgH"Uwn>5߯U7z&lU9Vsb_fTn9c,u="X-j,HWKfS_'&"ث'п'[-̷ɘ! _ث?)5,XhW%r `BƫR'lUz斷v>Sr!OVQח?6*qq(fk Ai(Ppf2;*5}D[}8P@@3bb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊'z$F><2Z1#Nc@<<,k^;cTv\|A EO@JP7%v=hw:n7Kn?6 -"wlz|R۱9c[v9c5 }E'Ĝb(;|<, { 1vZG{T̨J5cIv7Sy" m8vA&ݗ HaƑ Wqq;7]Kt8Vݕ,|j~Y["en03{ac[cݙP4yjz`bf#qL4Bwܜ+nzlH#_xVݖT+O &ݗJP4넅fxv$#Hv&V>:MZm#ݙA޿A6lԓnE)SM2B ׶+nǺ3 b~cS]1lX3v=qv۱C mPMN4v&=|4v={e!qև )vR+F$xJl4 Wcք<*kĤ++${PJsGAŻv6BO'ƒss$-ٙԭw8]NWb΅kRh*0ƑCM,mP1}&ݕq_MGby'ɝvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`#Md,ݖkdGs#"6"p70J [3Q(-l9QM`5[q OL Wv"fQ[w*3 U_ Ja-IJt,U {o2JCuZo(WT4$׮bHĔ/DF; w,miCZ⫸7\mZZ`צFJT⫖Eԏlԩ LԊ*רKF`Nn8T])Z`VӠu‡!/MKcQOlaU'*)i~aqUz)OQZb j*P\|h wV`iN7bIڙ{aVf bf:W+Nٺukx®=\W:59+*:Q+Pክƻ*JeVPҙt+ ` sZ (j3ShMc|> e]*4՘i^*eLpՏje Us({:aQZ A'^хUqUS~8] iWĚds3Rk`HDƈXS¸G+\Cff@NOTh{Xa4ۦ(vfPv=+fG&]f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱUFG;lU&yћLt{V$Bx#b ;^zG@m={^1Y%^?Ƞ4]t9ژmS‡c9UO0۱Qv\apR۳rjq1[v3EiZWIc/ET[x/+Ё_fbԨZS¶ x(&ƓnY B74mF݌U'—eG.=*j~LimfpR-z8۲ OS֘[us"Wzvd@~`imo7l4j'#҄}-(TZ2"v۫-Zq4Uc-"/Eb~}1[uqƖ1)VzmIurhڡ88Vݖm ۳o ۱?KRKn#T ۱3ҵO<+n,̵> 9rQL4NǰA;nNcK9k - & +qd(X DžTTo[xfHқ4B۲t+lxVݍ z' [v<*좡@ TN[v*қH‹v5C@jxR b WW/(tW4HK^[hP aZ&1`X[HS1)B$ i5W ;yWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vXdGz,vYT|XY~_+(|?*fDGf%mDIgep~-3o%Jŵ+։ D@J~;3ɻ7|ŊT̼M)\c}9+]F`w«>5F*+u SXTɡ\YfVUsO| +NXt\~.*.}9u8̊3S$ym+l*-wJndj㫊ccL*Uzs ׮bNic^^;5UGu59x`7;*xJ}TNAtVs|qV̡mVU~yN(h6;'X8c SA͊@QCPhw1XKv;*(6إtv]=Bp:f8J٫ \ ֻS6hWsW_*nw8UN>'6K5qU)_|UpkUEOL *V\*0*rS,ث\@+=3bڛ i߷L ̺aU-])qUEj+3lG\p_ 䐒v(*$sm[mFm[5͍+Gz0'߾P|miPۃbqW*q54IJ [/8ispgl;1 iOqQ{N008Ÿ|J3k.ıCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbcGw>iek%pdU'S'~>dW\G&HC,RIY]SaNEY/?͊bCGb.$:U3Nq!totq6*m`{*(#gh͊{>֟XZsRٱT6lUٱWf]vlUy/ɚuH]!Mȯ#Gi[™W/g">kGC$kfRHi[6np\W \)ܱ88im>cInPNimו<Iu]Li8);W "ƷE;WޘDR0Ӓf>)2|0p9 @ b9Zr᥶0=dH[o, <,mژYV" aNA$m`.FԒ4ݖ>#N cYjxd[_Ķ WfXUۧLi]\j!$|dJ伺ۉ0Z~4v)WqEFrTGn>cHe04`ƑnN"Au%ic›k* ~61T}~F5?Dž6Czr\)h ZWDžmq unq[uqC;S"bZ'ƃ۲o1[uq`TamIhB8 J-vw ۉȡp&\@ ׏-Joxn(|T׃Mb|]7p/y:w;| %i_LuUxޞ& +u=xhv8BkN< urPGSpl,>ک&Q`*vmoc^&(8Pֵ?,8\YQMW)~x2n:-S'#McD;^{cᣉIvDžx\T 8`_L< Εn|7:РiO۲CPN}&Я2ҧ 8\&*z׭Mzb"&萼,xܫXTs  iF^'W+ѭBp/S(Diw-\>۫CJw5۱ *;僁x'ȽOQ z‹q0v& icVEZ1=2FŁ|0܉O͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊 tʷ"63.iwtvj̜F"ط.l=a5Ж/JJ8CIt.u0|{d+\UOL* {bQ=k 0µ5ltV|Ct^cS`G|Yw41ќ(T]Ϸ|ܼq'mĭ-kWzdmiއXlF`{V6e ) M]X8ڹ*rV3J ء=zf[A⫣Zl ]+V0Y\UޡV+銪 4o|RoOPSS+{\$kn?N(q0㊩z1Zb^DW0܌*04@9GP \JSeoRĜvR/WqC+"4v˦IV2LPf+i7=wtpe+51W+eb=sSl?1V9WVn+ Ncru⭄^o**P*W5d 5qs@4&8n,|T p2GʤL<*Zl< n[D9L|5ciOzfX(שxhk';vnShu+X,< k@`KG1N/Z{a[wl1@w;c HA]kMZSZ2s4;a%+o>uǬTm8#)\3,[L>Iur5&l|668QqE|kD*G]mo7w"No@?xIr*nr{W<%e<6=᭺xv lp8">EN; {\MnhTcZi$8Ev`8׉߉\q~ >mB:ǩ[v4Fw9 q* |0j{87\ޘaF/ޕ+Nd+#4d]^'ZT|%n1փ"@I1J,|Pe84NJF*l;|6m}E{cnV M6f)_ |%]\FJ1#rFdH١|vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWe~vz,f;vHS<}d3!T9ty$' Xe&Q_|NO8> X|էY8hsi%a|@yM=.#-4)I)?H7 /t)VXOqr'N4([>Z|x2Oы|OÉmyH#Ko?3uv2{.U’m+[XcEӥ!U?W_l4鏵2B;߃—rm|a$5MOQ_YOӇ4ݿ;*Nf\4>um>O4204bߢZ{/%šiXxWf08/&(C6ʞl&4c9| ?,NGXxjuRK}w:,Ulq/<ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^9Sv cqo Cmޘ卍Hr?0_" k3; sGB܄mydo".S>~֒؋o"a.~d6|%to,@hLOOÒh!dʘi1aOՔ-w`~`>r\#;ƈǒ2DD*!O-z.Hh L#ƱOTe9i1~@%6^j1ΖAAy,^vrq`tD~H#6>Ivƅ>x-堬T=?1_:)N˟cmwQA#Z%v*o )G2}x n#o=X'%B^'6\8F!xm?F4~# F[CW4#~}ݍKŠ(7:vSycev0~|0.яv5;~(_|<#ݖv88gzK16n:rDž<Rk7j]na# ^F7̧~GN˄k77cnǀ5Ƽrp~Džm5&x쏻ac;mc68a[>졯Nqh;Ov5V?~mt)u |1iM>,!m#(ҜB!6cIHw,ppS79|O߃ Z lߤOO*6c&= 霯<ݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUkvj#_XȖػ3vRfngpvIoĝI˱udya"@3RE5rbUU+i*; )X@ ɶ85#/کq^<zjH;wjojJ~ U]+_Vbr T:a1USR+7qW.o@Kކ*IZ+m QExUFRLށȲ^czOLC$ڙ@'| E}K?μ#;刀\vF*ڃF*u&c-koNB!UMߡULޱrXURaq/Jf mZkamco19'saV51Xf 757W6]]/ SlU5+U>կLo *AW⫽F~h\7PbY iǾ*ԭA*=2oկn~#ݎ+NPKn6,pFRzf\d#0L ќ˦UhnMEFZV llv-4<ԦE.MrI\sv] i aVԒ7́]v\إp#+]Ө, hs1q)#ze`J05­!Pvj"N4+X9=r.6 OQ @T=Wl}af"fJ,$g$UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bdf}V?NLarDEZE(%Q]>~ቶveo;Å#p EI۫#^eNc3rxcHZ#<8jS.~#[p@:s[<16hq7cM䇫 Rx7N{(u1Y~:BwƑeeLݘ9N<+;w8Qe=u3}a"'S0Qeix?~u1ሥM>xv4O|e8]LC;,ILC.'ezQfq;7qvoVyO#%8B;$ȣ,p C׉` uƓn(f/۲W ۳Vdimٹd۳rf][vj۳-1ja[vV(v_,m6N*i9urkn൷fDӦ[\U٫)v]i6qWfmDΙOݛ)fॷer+n\Vݗ\Vݘ+nm|-\&*Mȱ%saٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]N9b]v) &F\0e䥎zvrwge$ԨֽkbOր`%̵Y%ڣ Г2~㊴dN`8Ɠb|u |iGR0Ҽzuğv$n_l'o%4è qJ>_(H;` nW@Lؙ'5~ĞO z9J +s\GOf/q^ + |'Kk#11#0aR($`}D @GG|7{k¶/'j0!N;/ m-@p;>8I|GT E&+]j78x_Rg$ 8P*?~?}𡏔+FȒ+SqJmTVE~X{5~fUJ¸d6f %<֤q  3-cQ%=^2U{a*[Z􊱪RX(>rM.]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb@Waf5}n4ro''..n&i ENu:}$q ןO=#&_\?]*P-͸??ʿYyۈw@\1=xrR_cnŏ'a]'W5p.xeU(nvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v+ `gxQV3o(v>`7hG#X[kO!PW_?"ncEh+6ݠ'߂vE'c`ǭ}FʋSp@|?g>xJl+/ut< D7h6J}#|-710q^ =|П̸-xBPSp$q̩~% MLàqw?¤ߔxݛF+w#O~6+SHljxe`8T%jkT~Aļ ,yO ^?MHIW!ļ 'S9_Oax*˵I/> -ʲ~}rƻ ?xߖ ?F_N]f8P~_j58O|mxTZԕ BYS*ɮ<^Bw*/DfYkA6ŋb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb2?׏ȶ\Sk1Ƚqf.b wXs4xx;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثkyDnC-N0q;3j1ƑL5Z/ o:j$q&r$6y,1{O3^IJ^%t~ʨ &4i8鈛vW֟e=[v7oVݕ7*f+n6(voX6*ީ]UٽC7qWes8s8s8s8s8s8s8C/oU7*޳x⮦oT⮦oX⮦oXv_m6ejO?~6VLI8[vo?i󇈭/;}"3o#[u2HVLߤ?ߏq+n)q#[k:#x`S7 󍕲e}~ooಶߤg~7pS,jwG" ܏kx\G8k7cG"2Ƶv?x۽5M8۽5M]Wޚ ߦq(p_rtxx}_5j+v^"ѷU=|qljxg O1}B_(yRӏ}B_8zljxѶ^"ѶSpq/k]~cySoqljxcN#_7j-fljExtEux}ؙx,<a?ߏ[kSO2_IljmotOS6P7T_`'8m.<)vmu܊zaKp!졊:Rp!٫\*n;52*vI.̸BC+WeV٫-} vQ˨.\UGfjvUqv:R죀N6?, g:$yf]vlUٱWf]vlUٱWf]+eoFiOEVltSPyg?;ͫ,_Pl)+rNY?ѤИ/3./SvlUٱWf]vlUٱWdG-a< q6~9cf<tZK_0_Li]\*50+t\Rܱ[vcCWecJcKSE1®18۳]٫^Qn.\Uc %ٱK(vQPæ ;5i`e6CN We (v]v.Ͷv]A—e]—cFف)vaQ.vV;6(v7v8B]\m.Ɩػ6)v_C/66vlUCvj`v_\]li0𫱧"B-~X%9y;6*ثb͊6*ثb͊iZlvJGeq&F(鋲IR+8˺iE?aI?h_&m5لKS/鋨!O2w,_ǪNni]b͊6*ثb͊6*ثuNh: \KHz7ƿ7y~k/!/?d:d.X&1 =A EXv#Wf]vlUٱWf]vlUٱWf]vlUٱWf]Jt5Wdv6*f]@zP+hʎ_ fW;I q ʡdW1BٱT~lUٱWf]vlUZTbmBxfWTRW'*9|-_ꖺbh!$8u)ت/6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbV+Y{Nj !3g ӳq+W WvnKiv]H8SnZbE]:a vX%ٰCWmn8 /zᵷf'[vnX۲a[v_,ܰ6 [vc۲L\+n--٫LVݍ-@ݗ$vXlM,۲`[cknˮ6f68 6;Zdn\(ff]fe.®Wf'Uu® ۲2vQŋ Wf Wf®͊/4®bʯl mى8)ݘ 4۲۳W[mUm}pһ++`ea[vlimtIvVvQŋb۲m\y&ݘ6ͅ]\U٫mXفٱWe7CK8ثb͊6*ثb͊6*yPK׎ӷ=7?fIR_b}'CovB$Nh󱸫b͊:g ox<*29tedGLL޿,Q"ÌO?< -qQ}7_~4_eęjǠGĞW2̺ Jy7NJ~g#Ӝ0?U&?Ώd&71ٱWf]o$.`?g\e cһf]vlUٱWf]vlUٱWf]vlUٱWf]|zq6ҳ6*&V2lثռ;?1YG zxS/pv n%͊YWf^eϝ󵝢5!QH)SڂFuf $( 9|L?6*s\$5 V 37^Gy97h #S '͊^||jnt!$O=9oe͊?__=lU_~w}}K\*n7o\ث#%4ƂP?t/baeDF`|