rExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:16  "*(28HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TLI4))t'IJI$RI$PZv[K|e\BYS{au4:^%m~Hgxv ^n&E6k n%88>_MS^\$Z@:E?gۙSq\'e~onoQJ&&bN15 e=?G{{'[ُ72NeDIt~Ikk.}@_K?9)d?}%t/׏_qtY oϳW"潡!pj=ik,fbG -ܥ 8ɐTMQR]ɋ cqTX` RXmVIg6]O?RVIP1 lA><;bw[H1-FOhьDV84``DmI _ /n5.mlYc k!!Rw>mf+!}{E qmFf\w6a2s\?1W蹷ˋ4ˡ鹏z =elZ.3K*k60mi4)%,O <aR6[}:A{k.Uʬt~LvOQ[XΨzOc[c캯 k9f9N@ֿ+&(ぐ>x9}dcnh'sZ6Jޑmuvlt$GwJ- _g~oSz&?G6vY4җ5c5:J: ;p~_iF6Ԓ~ewu%7q1W} U^6.ֺhwkurP ZgGjŗ>\zNjC@zxUmsXC=ŏ,n}L{*jk/14YZFE] U Եjg_Pg>bcd0_}z~깮m CVe=7:vK\q/:[n5=6Ѭ3i췆9ۻo{?Ul»*mW}E6=:_ee[6oad$se>\7w Ju]7r@^.c+u;=EfnG@(#LqeOb]c4sXKeYJ?BQuS`ȩϳ~遵z_'uc:f}{6g)Tޕze=QS38-c"Ue5UuFpWNX6I%UVPò׭vXY՘[oKVZZaXL!L6ggDs~¾ Eɱ@ ڗ>x±yMk2mLP5i}:J簯}k>. u~ujV~~S[;j>LFYl/>{"#]a:ג2LY^޿cYmyOuvZZcN~ U{_kk/G0NNCǥ0'% k^=SJѨC˂|Gg(a|@Y[gBOsޯU}Qpw2<>, *^^K7;}\KX{VCnq.~'ykݣ\Ѯt;N-84 Jb6c1eDWz=8v8vwv^0]߲婌v{2*6_Geo쪘FGAq/g/ŲYpGl}V?;8 hk:~nvMlGZ~n[pvMN[d1](O*rFUHW}WؽF,?}}:[LLT@='uY[Χwyq⎛_v=<'ce s%'9"#\Ѧ[Ktgt̾枫S*zn[89un;,3%f;?߳!a6\gn5U_+j1Inܴ^&3Y~sze؂5v8kᤲ"fmڴ| s'V ?~JSp0ܯBIOQp:5a~+m9dEtEmk[f/TqŶ]nwN t60GfƵkWr*^n;s. 8Lk=,.oJ,uذ Ys?՝<%9$]Z1!(GG|?rS ﹰ|o[UӱX$OVF/Ϯj[;R[Hǭ?EuWoMH6ߠG p2|rN_4i/1kzvT`_wZآ:Cd>jkla^{FRw/9&D L5Jit f1l4in:bu+eJq w;J9\SP']lu!7d3kn6U s˿u^?Pup`- K[?thA[cEuq..13zk6RI%aO2ߍKn|o0$;!ɑ8UVX!3/AG_܌[N5mWtx6c}K}$x1koh!seGoˁCm,ϗ;w; eݻ♟3_Nq9>|.㠻wG30ͳRY}R ̞NI$)TI%)$IJI$RI$I%)$IJI$S]]ٙbߵ29'uV2=dZl\dwDZS-?ٖ^fImq?!TqD z|?e_MS^\$Z@:E?gۙSq\'e~onoQJ&&bN15 e=?G{{'[ُ72NeDIt~Ikk.}@_K?9)d?}%t/׏_qtY oϳW"潡!pj=ik,fbG -ܥ 8ɐTMQR]ɋ cqTX` RXmVIg6]O?RVIP1 lA><;bw[H1-FOhьDV84``DmI _ /n5.mlYc k!!Rw>mf+!}{E qmFf\w6a2s\?1W蹷ˋ4ˡ鹏z =elZ.3K*k60mi4)%,O <aR6[}:A{k.Uʬt~LvOQ[XΨzOc[c캯 k9f9N@ֿ+&(ぐ>x9}dcnh'sZ6Jޑmuvlt$GwJ- _g~oSz&?G6vY4җ5c5:J: ;p~_iF6Ԓ~ewu%7q1W} U^6.ֺhwkurP ZgGjŗ>\zNjC@zxUmsXC=ŏ,n}L{*jk/14YZFE] U Եjg_Pg>bcd0_}z~깮m CVe=7:vK\q/:[n5=6Ѭ3i췆9ۻo{?Ul»*mW}E6=:_ee[6oad$se>\7w Ju]7r@^.c+u;=EfnG@(#LqeOb]c4sXKeYJ?BQuS`ȩϳ~遵z_'uc:f}{6g)Tޕze=QS38-c"Ue5UuFpWNX6I%UVPò׭vXY՘[oKVZZaXL!L6ggDs~¾ Eɱ@ ڗ>x±yMk2mLP5i}:J簯}k>. u~ujV~~S[;j>LFYl/>{"#]a:ג2LY^޿cYmyOuvZZcN~ U{_kk/G0NNCǥ0'% k^=SJѨC˂|Gg(a|@Y[gBOsޯU}Qpw2<>, *^^K7;}\KX{VCnq.~'ykݣ\Ѯt;N-84 Jb6c1eDWz=8v8vwv^0]߲婌v{2*6_Geo쪘FGAq/g/ŲYpGl}V?;8 hk:~nvMlGZ~n[pvMN[d1](O*rFUHW}WؽF,?}}:[LLT@='uY[Χwyq⎛_v=<'ce s%'9"#\Ѧ[Ktgt̾枫S*zn[89un;,3%f;?߳!a6\gn5U_+j1Inܴ^&3Y~sze؂5v8kᤲ"fmڴ| s'V ?~JSp0ܯBIOQp:5a~+m9dEtEmk[f/TqŶ]nwN t60GfƵkWr*^n;s. 8Lk=,.oJ,uذ Ys?՝<%9$]Z1!(GG|?rS ﹰ|o[UӱX$OVF/Ϯj[;R[Hǭ?EuWoMH6ߠG p2|rN_4i/1kzvT`_wZآ:Cd>jkla^{FRw/9&D L5Jit f1l4in:bu+eJq w;J9\SP']lu!7d3kn6U s˿u^?Pup`- K[?thA[cEuq..13zk6RI%aO2ߍKn|o0$;!ɑ8UVX!3/AG_܌[N5mWtx6c}K}$x1koh!seGoˁCm,ϗ;w; eݻ♟3_Nq9>|.㠻wG30ͳRY}R ̞NI$)TI%)$IJI$RI$I%)$IJI$S]]ٙbߵ29'uV2=dZl\dwDZS-?ٖ^fImq?!TqD z|?e ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$=s&0svHl[؜:݆y/>NcXKDd48WR )3$<9bVvfC4e7y\[B*kfdr .)6;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثD78Laş^MxdLvx]e; f}19b' .'e$*}bI_G26bv1¦Ğے/ 2R|67vTOa>`..qj/=9!:e(; dGfZ`=$_8'`KW>N$_IL,GR2NL20Geb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*0Ӵ4=W,9sv4"-lv7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*ba__Hg4Q! y-bclrn1CTOpq6 tolSTPq;޵d;bCR)AS2Z.7mj1'x{*o T1'qL]uW݀.nnPv9;P8!&Ƈ$'OM r Ш>n&PvvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b~q|v_; #̈́"yvRCMf6N.NΏb8h@mLdghEiNzf=\ C׉s A4 ڮbSȧm`k9d9ֺT-*=+sVBL+gdA]yiB*iJmV&b h@Vko;Dbʌ´)HR7'B. jڽcVLjԊtdD Ѩ$Z6- -Ҵ޸8cnKjfR:xJ/x%⡧,N<8>Q{a56w[bFm4UШ."qw4񛰶mUl zB9` #dK7b8͟h0[ڎP1 튒' 8׆&PדE}骰f, -+]]Q&"la|&eChټ%Դ#!ra" h v#ӛYi"¡Wa4=*}/z$ud8 'qZm1Wr5ثa ޔj§S`ޞbC&.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊, UؽM¥MsvH4'ǩߘƞp9;'Zg f&&kvIVw pڮH>Gu Lŷu/f*>pKu8Dmޔ[&W%~m"Vؓ,D +`I!~!&bKQnxmz±q>l:9Ob~<"6JG\:MTwHJ8`'cȂMӐH=EZjڃLׁ<N, ٬"H^*`iD5=kdzIl2q:*܎.53!ddr˲@<ne0.Dr("{sWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]e`$ =p.xZ)\Uـ튻(1VЏ Sn#5KNbᦟ:BBGs&@KH992~N1c h+R K}-pORxVZq2 ?[%H ˥+Fp@T-JϖGntLj-?kKKSF縮էj} p90']]I "5޾-ҹN) ^i@qc@i54냴hIA?nOj[Q%"n:t?m[Cg; +eW'<)$OC,l_„I8NJքnSF+ɭ4$V~ #%7%dNC \d\pVtbg?l(͹quܢny2i>u#6P.:d8إL(|UD銵1bMm]/W #F5$!I-]"1Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*+*ͨ826]@ѓ0Yyf TXi4ԙn%RuggHvGI"&@GzYLKX)-wmsm n}8큇58BҵIZ |Mm:Sq6\㋈KC¡ڿ煴PpHTcK1q܊t@w iL֞S YK%_qְj9ڇƩUܖO1pާb?@_U*+qAŜz?¶b|*G#^$[B>yGU~ˋq$K)世2\<- 0$lrkvx8X +q{oxΤ+Ӗ FNmBl>Y n[S27(IMh p f̨eddR[F*hy*S;bQGRj? cH_h6KkyxW ~lybܪ@z~mѿQZT(6NJJr7r㈕-`v-P7\c( ;odnCjKQc4QhwO681߾.zۥ^ݫP7aceFY#34#/_?1 rAL? |ccŋlzP"6ɂR-L|Af_UԐj^v;4G|ە\MJ+K*2R۾k*r?:mP'H@lMq(eH ni.l%UYKܵǨU mC$WĤ8jYp*"m cҘGxH $S,Pثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊D*NiӲk&a,[U.]GsdAr|3G)̝9  "; sO~\T8o z+(9Wg[inӝj=eZ%keRiRq^2! |$JW#mc~kz7\^;r5iNn.P 6!A1ShD(YMT`&Vqdۉ e :<v==b(: li1{CƬ}~xl쬬V5N[{8qAJ"WIRg4" nR@+CGvʃ{'QU~F6 텟0o* *Z6n=[LQWǑ${m]-bDW$26DrM@r@|m|DA Zķb=^vۓxdi >$¯P@Y[7t]\54&bn^i[ls&9\dvMbԮ;Ɍ` gOJE2 D;"`̈́3 l\ăeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbܢsaB["9AqhKG,pa48ԩq—fO(v98֕8aQ0dHTkot#t qr`񚓉JKאָե?ǫ/l wXr Q?0>?jM(NU(OkS@ i)S ĩE ˶K%|U5G Jޟg|bkZHOP=kMh = Y~ѧ]q[^_4.@ VDJ^ԮݲÊTx9 `e,}Ie@MrQ #(BX`j zPҗ#^#o hOym.TSaNCՆ@7F 6RvJfT̈́--^M;|S۩ vCi\[Do<:}Y,Pv}yUY`R86O_=z"d=n4۶m )'#\띏QC^R/z [ b[C4u;dL6S\%Q&C~8lRSTt%2jvlUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbţyTbv-$~)vm%kԌf Qo 4uTv`vvi^Sii~*983)媒haQDhzbX8=02\dz SҠ n "b) c )ڸsxe#x}8LuZS|8mwi0CjN}q^];Ub:݂ 4Z9oU?*)_Xo-޽{Zg x'S} %VF!8Gq7$d͵3m~8?C-B6ĭ輽T(dOI0SfV4@iQfoUэ(^ *ѫPMAc7Z3t䤃m bUA;|ImyܧnOzO+2 TĚ>ގA?p8>1CP'ħXQq$lڱVYx8Yqk!RX)+ޝ*nnWwrVjКwdC-lG#JW ٙ fzȂf^GdIС„fkn*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊豙.QAr4;%?V`}㑌ķ xrXbָ)φ*֗OciQCnAI ^ #AsDF"j]w&1Kv9bW ;olca1汅 GLiW W5y"%we+:&)h߯|o%)Ӌ)ӧ$ݚh&#ܓ/zk~c4qM*բ>b3bƪZԮ HU>Wpq•|Ai*E<2sfUWl/}ˍhh= cw?b }%(AmY\KI#8UTw+1ۜ5ErxG!(oq71B@܏@[Rr9SA!Y b#;44.]Գ4O%7d$^5 Z ) ǩ!@-%dw1 cf;9ׂMW*8j=~,n12$N/cPF~\vhQZnڇJ mJmr!#4'#2@ZPVO*l *DC|y3$ZCq9M:.Ȫ@(Sk+b5v81tEcVLjO ~!PSZUɪSqmԷ݅ 6`JQK-y7Ta2%UNi(vw+ogͤS3 Q:= %y8WNMpcɊr۸mS?; 'TءXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWad  vGȶ; *v*jbckCg/0(N,D7p5Ƭ9FHqrh>M#Lkr:Q}{QyN 6<! Gj@81+YGʠQ~(\# "p.$'Z@ݶئhMo8SԞL#(^8)&APF)}Fp cy`8 1Ȋn Qa\bhѠ(TKeyo㚝SC&\N:T &IU? mr[#*:ؽ~|hU@)]1;#̋ ?eMlarB&xS,7uqv@)ЯB)7ŔÐ N;i.,T}6i*ꠐۊ6Yzz3/UmS|1.ci_kpo8_RZ}yk&[ӗ0~,̲ 1dj $֕x ƕA' o`6漖7{\3(4#%0*TOuXU ܎!BŝSc=?YkOK=2_gǺc `Elhk` +լRY3!dus#&c:4̸L6vD5nxZ%svDnmR,;fh6nİXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثV17a,7` vu%V w'4y=fm 1Gm;S3l[e rMMQjڸU|n]KDazxJO7HB[_76cf]Ў%VP5wYB)TjJo7Uؤm\Ue%eW Ds@rgm&3.lӊ`nyNքef>:g?ĢH(DV/P]h#ǡ4 pCWXƙR24$QϾfG3 .!Rnע\+5a$ժc֘ZJ~1@P֩nrLF̠QͅiJu?kGBix!jQ>D=hk4Hw ;V# TV+_6i~"H'Ǜ"( tbE_|Q%P5pXSNߴK]~*6`HAۇEOzք'?CO%@aq:+r)_#, KńN-^|cz KbQK8]dOPܰjZi}992}2_Z9J'cYӆ#fieE㏹}r4ͳQW(LX4pB7(XFHa!Bjcv$)65@hIauؚ1"a2ڙG *:lA8 A 7iFItAkȚۂ;O'i{{UݜR7ޙL&C #"A5f3pcPkMgCԌQ^eFV:^-7duԩ :BػvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]l,}wa@Q`l`KZbXZnqWW`VwqWb$`Ah.*~g[5ʘk7v7p50u|Fo`/FO9 r+)L:j!$$GS0B+k;iMUӝ6'ö]uF?5=2>_ O^8_- r]8w ݱ}agtL |q$Xn<X7ʿSu6K +ޘ[T~m%>͈*^فn;iA+޸I_S%c ¤NVtčmD;Nͦu:&'5 Gz¹R0m#4lKb-i!NQi-z}6Eʯ#<)\ H["ZҀEh[ױAԨ鎙:M~clJ"(RQs8Ī xC P;IQDPJr(sEi;ҭJژڝײ=T~6",*![Mn!ץr%.vul+-d:v5zo5EJYX SZb˷2iCҾ8߀ĤW\ӧ!Guji]o0(AaAqPrȃTwr܉̐JQ˦X {rR~KZuieVL/nL(0fdNR3RD{ڑ질T"؟J{8q/YGsJߧK#ȯ`M jV> ң9aF1%2RҦXf-Dl^Y o$1ؓyFݏ|{cplGթMw&"*z?0 <:uVL`Id@n$ohO N7 ?>l1'7O&W`:g;5YoI6tXxN"|۴qFbz{Ltrr#"VMa% ke,|T$rsMᎍ.`n0i5\D v p=@NS{gz~-ǥ:Ə' T+ $qbIe3[(i $6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*yJkV7 $t3E`E}jqj!.yMKi=ͦadGj&SZ|4̇W^;C.U0BNM|Ui\3Hb ,<Ӷw"ņp&N*ZUb95UZ{kw=?QzVn7G.!miE;x_lj͔+(ng:_SZ3 դҾ&H1m^"4P08sɯw~ nʂlbAPE?C5`1En>xSڴ¡~ykuFjr5##v+xRҬNsfba4tiA2]-j0QI@ mLts/Fr6)ۉ"U@ⷎ*kޠ~, RԎrT&O@}ڭ6ޣYF =14xG-Kd6H&^{Z-NHJvυPsE p4qК7"P؏偁4f $@zdKhnM c$HyE;5j| J5F~hr=Lj15f>im-HumЁ79!\@(Oo^;|>"ƼhcE3Q]Cc;wXйFbъmnH1wo,= wB\DmE6(`Eo홸cR86=Nf X*ō<`;U)]FaOraOfooƸp_~*Օ7ɛȡ&n8(]ulpĮ#nvkm 02$N匑-U60JQAڿPS]7D36Ðw'%ͅW%%Eb],rR2QO7Rvm>$ҽr5Kdgiz_8x͟iu)&¥Ug4&WY?'76;==0L-eR)Ab'2)"ڮ(@ t8;2v텓q0&کǕ W##cIw,h{%C^aCǵz5>ӚP(,)=:gA`;lj`Z oȦ8+_]ዑ٭X1nӀsH=i\ XG*JmҥjO@ Ei㑵pTAWa]=+L@Ħ7Z,HR6+CvpI D1>?F@́Aޅ]`[2Қ;a n7{͊rGNX{,&AOsZIp@&>m :ʁݐA~ Jz*ķr@$aEC.ׯG&vh@zm/OWn}H;W l|>dFMr/hbU悌325q1&),MeP14]ŃWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU'OP(>8 CH{[#D%M1ciChqkym \& mشcj},JӒ(jU֭Y5xCZ0siGҹ@(F?Ni1RY Ł c~H`̉Äbl21CӠ8B9Vr;&0W`[)v9mp‘]V!ؚ, L6w[##lVzW!SG#jhC{r@20QAlw*[CQ@jszfZ RB*(OLX RL5ʼcޛ>5>XB, 1}F*kѡp5#44=́*%T')V$abH;J" o!N!ݘv dcܵN5SY ɘ'jat'?b^t1~)~ /QM:e 4ta<}!Sx%MIzT@u%M[yGj #E2GĚakR&v.ƨw8h|0 hFhvl wV@ȱ8+Ū=TN&EdX B9+s+^őJEkM$ٵ9'=r=qZ9yܺYbx ,kBkRM1Cx!\ Rฮ1)jzࢁuHn MVa(J--`Uc*JIkm<(@|(#9Q+&pEz_o M {f *+RN=K_+ ·a_Uv=hqXn7 xPA1ƵaX5B >?q%i|NֿE7Ͽ0n4$q1?I`v|n'IJ圣S7"/rZm2NQA\ZN^])8iřM@Ue;pè\<2\ Cjhi_1j /1NS말 ,f0L>!όŷrLvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻51Wf*]SvjbLU٩6*ثWf]vlUٱWf]vlUٱWf]6*UٱWf]vlUٱWf]vl UٱWebLU٩51Wf*ثb]qWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊(َf_iI9FI=66vHAQǹB\aE e sok`(ӱom,华kD dP`k …m=Wz)q2kimٕbC\p]=\rKH HQs^Kؙ%T@͞,,%H4 w{R ̠]LEr=p*5I⑽jDwvsJh _yrfr߆(U `u;:':`%zd!TPVcm%/^w; ÃM4soePlym0ݏV!C'ힵDK]-%1PICF۱C^8znV>Kjf5٪F\ZI%Oq}D+Plta( c3Jшӓb Si1;>8"%JAzxXZ̯!FnU#?k4'٣rQ`<+[* pTo|?a 5q` *gۭiiXF ]«~V96,Wԯ5j  -.P z m՛zp-A3 h1c4w$r}<='uݜ"8˖7e*wǶ%2z QGzWaU= zrt[#,h vcfN9p%ͦ];M)@&3c՝B\0R 4(@RcWa;uH$5Z};?iXIvGeWӓt#iɈ`J֣L^up9LMzⱑ޻|]Crw߶V9 TuTWu=4cl %NwPN4 wC%bw"Ǯ6p߷X *ޙ`bBFhr:W&vfTd8"ZI3B>/2+t5FHX]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbF N1WvrDE4}"ܟsL̙8AE{f/8Ӱ:s"##bs;Iaf>c6V-A-* "k!q90P/[^./ґ0=B ou](톛8-q7mnޛ+a)R|^SҚ7R59`m(zK+Mҙ?l#;hBjNk%.)_f˾)4Rg Fc%279( FjW}RM*sr%nJ(o >٨B.lƾG~d?Ź(=-HEؑ9AiG=q*:ՉAz6G B{ʒ)zCf(894H߮k >7QMw@RN䚌6h ( ) ӿpJ4CJӢPqs=ElXrLeԈq 5` )k! *?+K\ wGCQr7Ɍ}92Z'V$8OJnNWNNSWNQ탠@KI~#Gޅāo2QZ:/wR!Q%"iJd@g*DNRj*+߮H[(M+P[t>9n>cv@;Z0AWLfuYRi^1Xԯ^[-2ȮYߗҤ6O׸iM73;K޳ѦCgN=8}Υ5^*Z6;@+LjZ8!ڮ.W-'bhuro$,mh~/z--1!1֛VLs{bpPFTv=s_CEUNyɨ"&GaOf9ivswqu4#7v%.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]SvjbLU٩51Wf] 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb8Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcK8 hgv;s`'d0xwCn&݆='Rvrch4 KbӃc*ނ},J 긊WW-",-A^!T|K\=ҕ%R$ jaQ!d0K52G$a>c٢ eeUXVTreAY lD V~+kkxZ>4:ӁAŨ@!!+DJ^,"Jդuy"S62,@.ēSm=ެ4xzXYmj_]1Ws)K"$ZȐBllH kBcw&ʗ1ץqH/Щ.RJcr7SHڧ0~{+r& RgVJ Ӿk $6'c>Z]ңs^FN̒P04(HڠdbJ1+ &"MK@7W3" /!(8Ss] yr^boDAD lScO4{n+GFEX&N ֤ dOh -AWܟL&ԔԘv3BtR;iIvm&`PӮ^ذ&?~%nvޠmJިzW ~I]p!qqۮI.w&܃Ʀ'lHT#= AɂeԷj8Zr2fT~3#+tz7E;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcvIyI~~هQðq;:l)4|\7aͶd?j}Y\YdvX!ʻSG}ޛEh : bvoS}I J{("YD5ЮǶd[XfPiNI-Pm1yU@^+.9S `'5 ])ЍV5JqbI5\W85fÝ:bnY GחUEhFƛICu^H}Y•`z%jH AImwX_}On֙)͌DIu]>;9á@54=4Sm t5AQF#sͺd\n*: QTTbISʀZ+Z;TZA >lcA;12TIjhFu\[bwiA  P`68)6 xAiʸT ??ಥf(@ Q6T!vEV"aL,db#m~\S x@dr&ރކQb[1 *ؕhȆL*>6/<i{kiސDr SᖪFSBĚ>3Bn Rw3[ 9nR1SpCJ*i_ xYEPFuŃ$;a#zQhpm$}BOi<Љ#SsR)=U%k]j}=#}W*+Ɣޕ޿>vѯBjv͖pe OktzRl҄N4>y6n~ p\1`bJ;`l1+vls^&+zA{0ÿ#$\|m )Č|7.%1)bpjuŵ=9ѽE38Q[!dZaq v[f~Nf<%vs+,eh&uͼd$,;m$f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*bLU٩51Wf*ث+bͅ]vl UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v9TA-4% "e*N=q:9B oɨ;(be62j߫V S֟g+,,gtrTRVLIjtt O\¤Sp{}*,(;SeS݋ckU~ѧ([% ;7\PGŃiEϔ; ~8ª-}3ۯx[[XP17ӧj`u0Eam#hH?ծ Gȅ9˃шjкt#~QHDLt[mUa\ǶçqԨ= n-uɂ-z^XIH̨Ė5U5P~쟻3#+yV>W&;+vlUu]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b|o$3B#f.|;8rpvtkBSwcOwO) l\ mާcNn4;V2ѶVJ[]WY@ @Vkjs}s6.Wj\4ČY ũ8ɵ?TB|寨&Ix}&QU <׃\5Flc;įpƬ~;dKG1 @S.ћbM, 8- 4# /efK2ShMҹH7?.5speGu] 0#|xzaeR~QOoベ=5DB[8Oo˷ Z 9 jm*HڻjpG<@;z̈́o&/ p*ZVc%:$ ]0>xC\(YTН(xXꦌ*TtR͸/Q Ƽq:mCs^,wE{GDp*a䴎c;`AOE~]'}7R+O)GC@5QR\ %#J)C *W:aFX`EGMqP6U;x6e&GV&zdiNR(kZCcjj}U*~&Ly xH)#i3M X5ۨ݉iJX=WJT}ss ƄkMqMUatJMAL4oϹ/}@@e#܊D*{g$]rUY((kO|s-$n It/FsA_llK(8}9*@8;,3d׋TsKmb^X*۫ě׶68&ǟaA+ tKϛ26Nd5 ~K^SmP9{岝7jE<82xȠe?pa}_ S[6 s_XaR;f2; y7IvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vjb͊6*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Wad$&Vh2$ӳQvJ*A\ƙwЎ] JՐ,+9pj Ƣ5Ҟ8 Gpsܢ-`ڝ?Q~b2OSQQz R) hB 1!!YjjzLCW2! ^01 ፵0U?޵?#:00~ *? @YgleRIx‹ГJաZliIZint"𯿆i - S$EjER9 ۮU↴b9d_4j g=-Lk5cyV:f[,nk^M2%ZUrB0\d3xYXqk1$WNFNM6lXԜ 5}TN<˿89с.d7 !8QąT %.%.j3yǛۯQC8ߣft5c˻ůh_u5ja]ˆnDuqOG#)J9suu<7ⲐG#3:8I46 ӴoU<5'oNGGirdZn%rHw?,Ʒ_!){n&WS)CF2gc56dl2^k *^ ho麖|~YE|B!áTr) n@O"7j Ԉ4Rb5Bv )}ѭ& Ds%ƴOZo8SfF&<_$qYwCAC ˽f9+Fᗉj /CUeH!MĒyH,+ס B`fHpFQn8]v1`kv4vpFm./ v xvkEE V$fo)@?:"AU5qѸAi;hįŀ$TlE'~~c#li";Wq^+ +,(%͂91^z t 3.Jr8ڻ P.S}F ዤ~Nk Hy`7&PZc՜'cHlT$HJZƝAg݅k`V?ZF+vt-rfBG}f\fv-\A/5d琪n4 y$A n#7СV EGO n=&q@'+ekpL(zR둶iqO $ZFoRzc|4nA\*|$=!#@HjT[&+Z%hݺ (%ktkg4dedh J|ǨI+0U{xfWu=I$qrK85΅7aOO PZC}+PJ,LT}'23#g?R  6Z ^7rD8a[8ˣMѐ wuH~#lx?a7=)AWSBnNؖvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*]Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]cqCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bvjR Pj9 G+Fh)2]-e#cM8ነ5kKkX刍H;}-4ፍPB|~YQb;TNLwxL=n'´=% @+'mdAIDVNVtH$dkS(;ĊkNs܂^S6{ o-dcdCP4޴q5&vG}oɾqK F^ *GJ` s43QP6J1N e^U{v @OvчL]WB ? m` m|X#7#b)Zyq*ŀ|%4)d@3d^zdG@h;@=)C -+oPJyCA~*32P R1nI PPԯu!e֧h&E*uɑLT{S!_BJʸًMylO$٢ rRi]L=P٥j0T(dNM@)CA;lN ǹ( ;oۍ1 U@8(L9(_lz oH0 i^RQZL !74y$^":V!ZIdܐ$J+ޘn&'ڽ1C\? NkZt'm*鱧ck+TaݝEIBMo^`Ho_JAbi$F~I(gJᄷ2̲H z0)L[E- AZ9Y1$%zzcɘ*l){U$&KC:fƔ떉ՒjTL2\y@kzx=iqŎn*n9%;[vXpGёG1 MiL4\6]_K(QרT&e&( Woi!Aӡqfxeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbyG1ۉ˿9ޝn&z>Y9l~}C{L3. b[ veӵp6X+I(O-Oщ,x̹)T $f-PE{u]V\hߏʆG*z{ l)U5gF<3O#қ0in]햗5?Ц),jte<'zE}ipO8ꭶ&DZ!bU(ӨzJP zt눙秅s+Ӈ_'T/upmBYޟN[ P9T#UGɆ}#KqZ>ˇ Q<^w8A#w]-Y"/$5[(SȒ)C͠噴RQxVo+樤2!Fiܝ :J:5`U6>;طV5LXkb5??X5N*[0C1"DT7ӎnMj+KڪR+ߠ=&ƔA)] nRcNL23VZz+٨ރ߉ UhI(ˣ*DZ;bB wʒ&n<f 7QF5{,M}C#bgut)I( RF3is_Wq4pA@ڄ( o(!"+Z XX)!VZTtԑ@ɋ(p &}.γG#׈催"gK I:V"PB*wKPWb+R6~Ja Qۦ$8vb`\!y ? *K%GqIfWad PiEvRMA\Z;r~sa, &@HH҅h2xDĪhz\x6zX%MJD\QB*+C\h:d(l$d= ~L\vŇN[EpL6(R3&Tu醂&)nrn);]r=ufNTJ%p!%ĿȖDʑýIhނ<l"IR!Bhs/6EvQTG Q") qk"@$hQ(Hr2ܺ36ZQ r<7%`ēE>*mB)*  n,*[6E91;a p3wIE.Ѱ@6ze[I'JP22 g9, lC^ ̃1e9o_|}#wefA_nqЫ76*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻51WfvlUxUٱWf]vlUٰ+aWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]t]LP]٩51Cb͊51Wf*] Rv7;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Ukif>푑ij@0̬.>ȯ|n`#W*pK3Qiȃd2kF0*q#:CDWۈf@$ o9a5XӐPw*MmT1ܞ'&-pc ?ǸYnU@Y)6{ ^Tz(%]sUzl6o>QJm*`;h*=䭐()d:AW &6,Wqn;lSD-)r!y ֤7Tis6zW$qX),[i}`•-cNg&(rBJ>8#)%TT\y)ݶzma`gCփbHrt qcT&U4l#Ȁ]A/bOzdHKulDPqWW-&(a&x`Fhj[͹U5%l*2At1, G;]}+ĀWT ъo2A!_. HU\ַ&&9%wbUJ}9TؖCQ\+)]+1AF;֟]XA߾LQܕ'oaMQ;H`OqWzp %pAEp);t$[YѰPz}&x`  lRWhX$n=pF4㑁*08Y%DZٲqe}k:-&-rk5CĪÉ-G 5^GTסn.?9 (GQ4n,]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbMK~wN\"\"ݝIXBڙ啺dNC *f˨+l(~)+}1ߓJg?.?*B׭@7d(>]p]R[́"7l1$Ue962q핸ҘuF MhHQ֧p{eq'qxοw81ԧ€t99mq8 P,7ߦFn.[F^<.6QQBGL20ImJ1N>ipC_#B‚pΑۥs'غOU҄sPpA6mN ͠=I4S+{fU3!5䌚 6Tn #@w0m؈'F*1PVpP!z=SA3V69!"Á %҅$сPXER ڌ#%[cր͸3#b+CcJL[T<#oeGi' SncaQхf9PMZG7zd㰶sJH %('?UqSzm{ؙxs7Wq~YdH,H!F"PkASNVZ[qkQQq M )w߾߆i]@')нv̵=q nF<<%qJ+JlDҹ~2k"F:6 (wˋN0x|+,גukhw;cd J< .HPTDR8!%٠˓4tPW-j.H`Oے6@cEUU80POqݍqS^R0H *:u#(!F_KT딙$bLb)`ti Pkȶp>}5€0_!DJҕ䬦O(dztQrAK/IX` & :J⇨ + fGgݤ%:|QǿwݝF+$Hh+RE+JV3#I` 5< +#L'mphGm\P*>eYJeYBޙ j-]lV+@D~Z"`'U-tX`3= w>&y; P%xs1v<&Zw☹j^[<NH4ҍE yvi^Aܷ):>eڧFnǍۨԎg M'˖q>$;eR1O|*$Q;f$YqOB"9D|#*揵BQF=gGPkJk]r.l)rPG4@BӐHiH(WH݉=d 1{|G.3ʏq/XBO0k \2$s1vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*͊/vlUٱWf] 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*b˦)vlUٰ+b͊6*UٱWf]vlUٱWf]vlUGv7;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^H#nŏTb!mA3,DPv€~nH*gpF A5K*~@WXrCKMT>ǧ\Ib r[i&uj -CASӚæ7LRn/&PA4]>@-r6,'4׸œq^gFn#vds/ڜYB4\F ޣ%`he;-{)cJj˟aqΠ VaDUb#R*6$ BUĐajZr XP 6=0 ᵭfVfZC)CBxdYߚޠն $~Mc=ɫmd Ā(1f&~Dbb5t 7lxWB (XHlٲxP`TUE4v6Ѕ#IڵxTOd~KoSp(@=w.$9T)ҧ=:q  )rir.'@BAz96s,Ru,k"z}Cm.ޥ oZ:4mf S=eoRIcMvUT BlQ.ekZ10.\n#pUP0 څJ/k6ޞr@0hVeO_# ߊ(,r%k G}xqwTm4N2mw&>hY*1JPyr?-=YZ4gTnM]a!HvۄZk[CF".r:{dOTQj:ˆ^ގW/k=H|L #{?qrbkp{g.t֝T1do ,Y+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊.S/vlUٱWf]vl*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثSvlUٱWf]Svjb͊6*]SvjbLUٰ+Wf.ͅ]6*ثb͊6*UٱWf]vlUٱWf]+;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Wd˶4_UӽGd>7yӰaN;eVʝ\'=dpCZv9X h`P}FF+ xHҾ4pRI}Xث![Qd ȎDR+_lN` '{mTD5`@?ˑݒ.WPVAVr(}OY KePO/gd-P7rR'WW"ʁ_qd-F 1^䟿f*DvvČyPPֿ=pzDƄtFZ짥k0 lO&? S\,a;iq:EcZ*ۏ?V-nRBw)޴G T~=1ҹu*ۡqZTq!ƵSOl$fY[[Qȅd(B~wǪ`i (،*h@ $u۷Z]\T)?BRIJHZUI:w- &x.Ȱحa% u _.pRMMը\RTeER |1~A~.]l1P֜'0v;< < SMii|H)rktI] %"X^rHu5vUY8I *APM6#֠Q]c&kaJt%$0eR )S pARpZ7!dHE)0#5d W璺U[FUunl#}jIWE+apQXӶETcGZI:v=`KȒ0Gi[ $Ó5$:cn͂ )ɋFFj|*(5NݎZ 1g {bE[Hb1mA\ýFW "V^ I튊w?tXHVJhff ")O-jy(hhk| bHp{5~N%]_›*Qmڽ_4NW;14#$cb\Vq4G"T ꦛ9]&2B:cJFC| ɛdꑈfTTT눒Y+' r&FNdt̘L\-T}؃ ":Z.ۯ̀m]2N;b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ m#QVb< ySI[Kt+ޯ/.S%1EUA5nvԽ!koJiv\s[#.t4(~{;L4wJ|ِpY1x9)nCIIbuc5#, e p+0*%GnE(GLlvj&NbF_Ŗ2Ew_je6 4Pvj 1Ď2#Ji `G@)(*Q l-vBhAڽ;]!s]V~#ѓiS-wڣ~vHʛN鄛GC\y dS b*JCq<7R6Dk 뙈V)9B:M45Jn%<=>dQUTC4pޔ{by1Y}Kc5j+_;+FҴPEkUo5!GU=k{c|y "Fؾŗ޵#_}rz`f^wk=ͮ\\XG>ٮy=kM6S׶i2ss6T/E]vfPigWYx79P=?36ZE(5ׅ4(tFLdjzeH'o#M B2V+U~9':Z1Ut;"#[v4+hs5Ws0#ۣץ:f )]qSگCw\E# .-$~teH(jVE94J\/ewo[j.s^2A"tukxA=O\Bԙ0i @BASbr(OK`퀮CЊ, GiUxfDgn6LWUZմuJQs&2uCaFq+bf(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*yNkRXv \|oZm3$%}NIkD/09sv tcM> kɒk cQi"N\K\pUA}5$9$(sdkO4:D啈*֝bFc U-my6,kL-g7il)bd!:lzdd9w۾[[TFw2B"œ̷ mH ԥ~0@jkc#id:'m}8q^e]ZE05IM6lc:x ՚~RkS*5-/cl^ܰ;)de> t5cCwKn-Ƶwv!ToJu;]7Fwo[v8hj|"ct44`d"V_.Q;uu?_*v=:|(lC~?ۉHAPkLTBFȋbC0ܪMz HmcOFFl7ƜFt92+F+Ȋ7IZ;Nv,Z52C@c^o#u%.' ?5,dK ?^J% Wj@)q⇗I=Vk W@ң2Yq@zwș2TH%RFFiZ pb7sswTƬG x1醶(xt3"4)$զh-z'5cgrr4_˺3=Y*?k ٔ3r܀s '*;tqVC6 zCSfA|4AC$ݰ^H pT6q KLb辬+0;T)()KPb"u5lD>CkYIE+2C]dj_/%HYBAf_*ą2(VE\pn!A٨N\ 42˺jkrtdEDx R~]f9aPPVIjxOH טC]YM f4}M &ՠULy2vÒ+7MI:onQH4޵_|ǎHP?ᎠIFP(hx >bkt]ߤY%wztF5 GVk ~n97Z)7Uҝ3~`1FU*98% lWsr3d]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*U٩51We͊6*b]v]1Wf+aWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU٩51Wfvjb˦*ثb͊6*ثb͊];6)vlUٱWf]vlUٰٱWff]vlUٰٱWf]vlUٱWf]vlUٱWfe*ثbL ]LU`aWf]vlUٱWf]vlUٱWeUӊvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*h<nѕL.'d`se;-X$ usF˔'| ס[=2A >SAJA <`O6#-;(!Ȍ2`5W h6Vָ Rۂj Wǿ pja%kʌ|UZ״pX%^x|*2t? L;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1WgK}+oX4>iu7SxM8wk ˇ.uwbv&'2 6?0Dᥬ_$ Vimfpo5V w'ǹ@Ƽ@Kx~Qh GoLDmʆ0QQ˜VRM"9m#emMhۓ|Ji@&kQQB0 '']wsQU59a*YOAF_V )^\w*{>xk2Dpd_O^ wiζ-Ѕ|b; /nrAQOcf\\pM,Qžxd[L =  Bcƾ#ߦKD'd,r>#i"挠tmt`rԧo[|)X۷?JEWؐwdoA|- 0ڕゖ7e Z4>\QxSGN…8#w_:J 8(tm+$aesOkcّipѐyG9/s.}6 vs- h?bM֕?d[z-~.ceEt %F.j +9nc$ 0l(1<?vU=(%O:aC4L|H{W7 ݷ$`؊z"#Z'ǵ:Gu 1Wcڣ Ku݂>&܊άmn?]Wx.Hjv8RqI0ISY];Sc .5 ;TE 4_'ޕN aT)ECl.@$$'~.$g5Pk'2T:H8хGoj (sI(,BP|pJ y]MWfבdRbV={ A$٥̲ ʇls !=[k$' x294W3H݅x;R"3ΣriۣeJDE 0dvr=`#vB :=w4 c.v3BjTnqXޔ": bu$6߾ UK) %܄kІObrH˷b22C(ʷkՍܩ#`_}pKc2"S~cSCS^3̀()C1iE-enP*M[VvcKihC$l-Z8׷$)&¢K꤁AƋTśrFN#t݊+DC@wPNz٤%9?cx }T9- ;֙gSLT|Dy뎡4! d,E}b?12CI-}JR?̧ūy٪ЎLk=XqQ7rG M<05Ũ>+iǕ8urISjMODdgZ/xUXvO۳[KP|\W9tkp UFuX &-0-lvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb˦*ثSv^*ثb͊6*ثWf]] 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbLU٩50+銻51Wf]vlUٱWf]6*ثb͊6*ثb͊6*ثb͊6*ثaCb́.͊6*Pثb͊6*ثb͊6*ثbLRUٰ+bͅ]vlUٱWfͅ]vlUٱWf]vlUGv4f]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vjb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUؽc;8ok@ EvG|Ƒs"EHk7GR> h( ;WZz-`G-XG;>X& n¡Z=TnO2ʬ5$Hh+)^$ڞ`(:8W~]E_nC[],feƄwSpءJ!J?9.uE)Na ^EE#-2Ҵ=i]̲;WibeX5n4 V,)A^x6&UOl -\U!NLP0"mZ2h]*JCLDU ŀ&trKk3z'&V7|G$4V $3đo`/"4ʲv$5؜$%BHӧA1ڜce4 GwSi1r6?<.i#:?؀K-2ևj~̅?-k'["ZtǤjPQzozk6xQUHz@`>\Bjv!UFOx.(>(P+@SQ|$ A\2E,fÑe(7i J 480-N5,~GU(9T`hUE#i{T9QGeR_j{ܮ&a$g%h F/9Y MistMAVцK@?Ol*kldˑ5H?2a]BvɀA=|(nj1X޻HM4aXݲڌTm֒)I Wؔ2; + *pv 'ɉ~8O|?@l Hk]*_,Hޙzֿ/r` T0+*:no qVt_ 0\Bh6+V`}1i6mOVQ8ϽLڸ+%pBʤQh pS0VS!OX)L&N ?c7ߴK3#+t:5z˲>rVUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]4CwsT3 kN\"зgX1mڂO "I]6A-bJv\IN˰Zijf4qi}jzw(.!;銋U#ҡ^j<5v#c rc ^}w5J|%ɕo =P$Tzddm$r:GۣRAȃteeb i (C37 ~i5x֥TPG\#{YC1 iڛfkjt9.KpTVq=F!wi י[8C$*v+ cN5w6N´`0tpҪq$lolTmMiMk;trCv4p b-Ri4;>IWU8J; U=9xZ*%w&0J8(EN{U$SPcآn%/H\&̣qMG~%Y|[i0sUߡ)@W3 R؛OH´'p`.ֆDFZ_mhr S\Pzi8@\ ,Pm55-wS]='5IHoIJ 5 YcFq`kks>W7DqX,cz}+TzH5'da(m}Cs#-, Vm5k8 hxԑP -riP()߰8nVIiL$c Ң#f7erΏ5*AƨA0TkPV$ v?G\j& צWy@Ƕ6rwB>XuCɜT .TZQ[ '-T+ĊSNhu@Wok (A>ʯHD<z™J4A2!%WqӱrL  y{8W-ٍD[M{LD@J\_qS 0JJ)P qd)1hjɱޛ{ZqHrsT)B6bLQI.+?cG t@H&|ڕ 0N$ۯnDz)(S5j6H|eTbjjk۠wө,xPBTB+һ| _AĞ@]I^A zoqSp>8vw>8aOchX S=0?diN)WB*>G }LC{+uŒq'2A&4Hd+S]${`Я*h$P7 "AtP1PuMg2% DaZ2!1jsNp7[zrLS=AVI$v4p4F陃1gF#a$a+cj wF+)&?wҵ+u#^R5 c_WQƧcҔ!=>]0ֽ)_orQMڟ~TRꬻkqE-9)F?IuxOnmMz @{ҿgڿ͒.>t+WQO OG, dG$@*bW;9"Q6T GiQ& PTkL``AGrZT~^qS\ӃdlA\$ E@PaΟ=֝B\DIp)q&K8 4:+C^kqajx悠|x(@~Wl,?~Ej~CP7àĝG2)-Ҵ\E.}Nh-f+mūK\P^V(jGђ!mp+ ~2 Da3+ʍ Z0B7!tе%Hנ0Xڶ_M@dBN6HZsKY?%o3A͏vd'eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb[>*$|Lx}qsΏi䀠pNhdt[DdFIf w`2l§}L0iIE^ eb$8 PG!^mƛaUa?_"7ɲpٝKl)өxT)ҘCwKbCP 6b9u;e#ȞW$TZ@r N4nc=~^+B7b*w= 뱧l/!MM6aNDs1CoڭCBVơ#LJjĎQ |5M-Ôj)c S,5^]/k_HBhG\ #XJwĪNNTU'd<; }돁>ڔ,c9nw Wj|\(H^R ˶[&%,-vۨqnATjeTf5vr8Eƃ֫N"\dd6vjCZ5W.%4!Tn+@t\dF M 9M= אv킭VF(˴Ub۵(2A9$@-UBѡ> wXJY&M͑J!W+7ijqjmlշUD=XMRP ;0e+6`X|JX܎?dFsX"Ff?0ؗ,Ao A)]:S=&6C"hjO.5L9n'^;A5+nyPV,AdAOjP޵S f#voc!_%ak'Ezo@;b{/TdjII6y֦=:-oWlw0T\XLKQEox9"mE$q(AjPe%ʊeVR`>,IAȷ쌁*~5Ǚ(E7֭G&EgqĵG"3d-J4GMhmT1!3*b;$ޟAn,mA4n(!()l #9|_._y4PE7r\S!iStBj~qo $Y' (#7:-HkH&FstrWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*Uxb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*]S50S.b͊6*إٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vl(vlUٱWf*]LR]SvU1WeLUٱWf*]b͊6vl*ثb͊6*ث`Wf]vlUٱWf]0S]٩51KSvjbeaWe+ 6*`Wf*ثqCbeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]qWeaWe]vlUٱWf]0+WeUXUxWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]L ®L UXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX銻&zUAש61DaBE@; b uIFOMRY bAwJ۱Bv,GʣWc 'G^"ɍ[6>0OӒ`1?7Ȗ@F BCэS+-\7'xt9 iQ[* o^îSkXotpO Vە0]ڹRwjrqN8-ChʅijAYB79I ׽jw*N#`'!*(zE =:'zS3fbCnGm߮M/h/B޻ʐ&E(M{0:0v vj( "ִE?SmJAO(qbjX`G@:}ž.xMGJ}<|OɔzS,1(JH;bED*Wq 19ǭwC\V#CHϐY8 $f(OKF'•FO_- |E0m}V=HRIbwbB=hY=zT/I#h;W~dRE_ OzuaAU,7^4j36ZcȨzaV)RV#okZF<¨A54Zd..DEF^KJcC)C zoA)Q_گ*E*zu5^6qf;PoA$ SȔTye$ $LubqQߥO y@c ~z@'jowo  = %vZkSKx*2hn$Pr-b޸"SёmqHƣdRpTӒxȻ08q +yic'N|Ffo3kx Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثkKfaOh&:΁Gg¢G363-nfGKn=I闈ЦKl2]e`36drA,9شpbRK9)9íp(©'t,\0)RNdF;GY(52j;S-ZL e<~~b> iMs /A޽ iZoO s͸gt^l&µ5My#HAbv0d}{TއmHQzC` OoriƟy@^A$5uŧ 5Wb2̇{6 mR[|FYI݆vTe|ۣ"j$v,g72,-4$Jn7D8dr6CGZŔW,nm5@½Q?`u[&o|R<2j%w&Tu<1|Q7S]1^Klaj∎Pbr)Z!bz} !޹KT254|61];2[&ڙaW$ H2!Nwzd'"#9RuڅWwQ`xyS waE"$5U^_.U~=$z! eH֟šjEͮ\ud;wP>z LO5ݷ`v|E!\JHP\ jW=zmʁ٨8޿c̹8ŦZ|`ڟ!^XX_k|rF]@i9!twg%:` 5% ´0|,FFcsV (@޿ke~. R9q ׏`ɉS`B]1(DQM~|$lb9^z1 o$⒈Dǒ=(YƂJn`jF}ģ7ROaZw/$9r `hצTޛ_ [Pq>WJT*# +xkZr5䂄P#хN#T+r5a\Ѩu8[Ҹ?-^.g 15U#1Ac>.;lM7;) ':Yh-$/0vYm&-LX>y!U M~8)5MbI/r5I#?Nݲ%X& 둭{E1P}.uڌb1(SN&&x,6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1WdȾ_4v<fY.Uvt{(FTv ɷK;bWKj҄ Vpn} ƌy1; c2Vd %CmĸĻKg5#:oMBmW tAofz4b'NnvTE߿o,Mҿ:Tm@;POj~,ɒUw+8grxqP䀲TB7=)9LL-^!ITicxԚ,['h{RHW&ZƓb(ڽvrv"=Ό)R}w&T6X;mnEBkQIFtc5 EYKU'm{&HzsEZr(y}WJoʵU~&EQ7%TuAn5Pja!em5q._Zᅝm`cQM\~v;ik5Zj|,Iewm&) QlFĸS HQDl^&&2?`U9WC`;b guJx*@pD;ݍ 79["vW/D.Ƣ4(!TmWMdqsP [k]b<9eгK@#1,Pld1r j62",1T)ZEZdD??|z R aA־4eoUfj>x(2HS`T y*6B%UJ7SD҇ޝPQ\1SSNy$V՚ ((6Ťr@9-(rfD,0b9 rWo@EHDM`q? c}؍+Z) xa֐(dn)AJx vUj)^{fNK76(tDMH+ v>^Bze~.b9Q="hkPӐra$} lGM8N;{%Oa1X |*07]20c#6.$TVBdv߯ q^2#+uG5[F_+ddjrv:0 _(.2f`jצB|<{?n kSH$FyTӥӮRH8(ZG_!&TKBb`CAZB[eD:oE+arɊȆTmO lC4ynvڤ{dv?<뿈)isxoDz?!](7ֲՖ~Z(eMC آF OCnէ%m^.hFzSp*5+2P:C҄nR`k7ZѩŏZ -/+PAۮed4rW{Vƴ5!zq'sҍC`BĤf#4FXҙP~h|wCqO bƔ`*klm|8#**#W zHZeI=p ;`zGF"wU71FR9JxS\~!޾8UU^Kr6DdQƩۧ.ysH`HWV)UВ@†>E8(O hPN؍ ĤQZ ;AnU57Q Vk!1Av_+-qh?ai?8d QPp$8Ϳ*Y Y=h$Qfv<ŏ+Q{ovlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vo$վCW\1%$E;fg JS9L y̲%ٮnDcޱ{+x2y,r4? ~se\ptvSB*kNStM4M0J¼h:mdmZ+O27 q8j߮/"cSǧF`(\<ʂ5CS5$(SjIFأ5w[aXM2WldԞ'cM%1TaS_-pL{‡|Ƒ%Y[GN`kZʕZ+9GһpFTV$Lw%Oj"SwQ r@[Y' Vcl=cN܊W2qRq5)V"zԑħb:ԷJf;8Fġ"N,l@}"˸+xlT 낢O]x4 H k(;nL߱\ZC@F98$BRjfV߰8,tFkȯ~$vޞ' l(Ih RF,[ۖL)CΪY>ҚZрj%橞Yؔd=~Fv=9XzJk=ȳ'K(ыr"j=bۮ߫$KTP~N#b2:9$D:vR!}2M\> ̠C4+|5Dz5a)Z,I+O DL-m9P)JMzZ0 +e>j@(zˣ7>@d" >J{t5%ղ'e$]uEzƃ&['d$ lч&diIJrRH$PT|fM" XPL}.AR5n{?N&u .$C= LUˏ;b.ў?L5$҇z2xW~MOsa=$܀},M2(F?3Dz/O rc3琬hWq /-= 8YGNg L,]6?:-pG z]q!˜)9ͳo+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]_TWf®͊6*ثbLUxٱWf]vlUٱWf]vj`WevlUٱWf.͊6*ثb͊6*ثb͊6*ثaCb͊.S51Wf]vl ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UXb͊/vl*UXٱWf]vjbLU٩0]]1Wf]vlUٱWf]vV*ثb͊6*ثWcH—cN.eSva1]6*ثb͊6*ثbWf]vlUٱWeb͊51KS;6)v^*b͊vjbqWeb͊6*Uxb͊+vjb]vlUxbqWeWebͅ]SvjbLUٱWfx]vc+vlUt]UXb͊6*ثb͊,bL 6*UٱWe UٱWf]]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/+vV(vlUٱWe b®͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rbqHieDXEe/O4vZ˱41d]#AaU7*;e$p aGNQ-i8wojkkJTTwձ؍ب U-lKY~=㍂u{b 듰9!զ"ZTSoJиc44JUZ"RL^A ooLZpD.T7-ZDUr;)?!5x~8-bvߐZr!a3*( $0A_jpPMN)~1TҀ_pI^ƒ2hES (R9R"7jgՉA['8 䝕íFÖȹܕG)kT ['Ԟo6jTքl>}yjEw8ŃyTa^k1MM:Wlb!Y I5o:a&ƋN8Grn>"J Z6,NPHJ?~![QJӾ RM xmzf#OT*A-?>PTu68:*캨 {b`v=9V{NL8R~ЧmצDaTP.FૂXm4Y`Ɵ6/%Ԑx׳Wp1SWƧ<7SqdEXT(E 6=+wZ|MZ}M $I i*p\J#HiHz*ixW #sJXR ~;Ⱦɍ ԓA\ӘSz|O^% 57ߑSS ՍzWwJZm۟+܀UH4L+Glp$AMb LP@Ej;hX-6$e4S-ȭJN3*Ai_jЃqA_ IWP$~XZ8aV^핕C"Lo*RQwZUP lJP?w=~%D$[MϱۦT6<0Sl ;tgjV6'|rCj?B*yх^Ш5L1!p8%y ߥ2MD7ZcB-Txuq/BLiծP=Y tUbÐLUYySh_nR|J8V7!nDmPA>Z Pw|6:Y4 ' *)Ëb n=<ՙĤCS0HgʌkU:荑QD x#.9*z,d(,|ZCJm^ *? Ă?d `+QEs҂7C#!Ԍo*&>&ڧ`(~*aXփllZbr]Z,G\V(Öz`bM-wǘ# Rӧ$I+bđNQSZQkOC$hedO^~ҡhEws8RbZ*7P*)ח.TUjȀMTzCJ%)h.Aq^@VRyߗQ 2_UM8Vu߯XM_-% *vlv@Ulvsn&!b+R7-iiMWKn޵-E6;V5 rVICȏ#)))**zmtbv4y$@hEjbaTaM B(<$j:t5P17iQ>VUcw#jb8#z\n4EG%cZژ I尧)$@@I>5=:j=Y!ɉ; u w큤b6Ilh^zR3G'K(dYF4a94j@{o؁ޠ!,5(OZC VbM^y[\@@Fֈ%-J'r !+ؤLYdhAw,iUXG$ndcɪGt|I>D@dCʦC{}8-E }m/-h5T?>,|2p# A#C'ӊMj;T؃¿,TT#=) 7j ;+:bnqclGԁY!,u 9 ȡo["fFxԇ<?n챢@lάH(r@4٦`]wo[!Z$N8x`y!`)edS 1R;ǿňz! oj]A!yXEpQ cfqbJ+-SkҔF+s"@LঔA1R*FfN)nY )Qv&6vӀPTÔdǐLZeͮ]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*`KaWf͊6*إٱWe6(vlUxٱWf]6*ثb͊6*ثb͊6*ثaCbLUt.LUٱWf͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf*]b͊+vlUxSvjbLU٩51Wf*ثWf]vlUٱWf]vlUٱWf]/vlUٱWf]vlUٱWf]]+b]8RaŋCb]*Wf]vlUٱWe͊0Wf]vlUٱWf]/6*ثb͊+vlPUٱWf]vV*ثWf]vlUٱWcqWf]6*ثWf͊6*ثvV*쾸ٱWe͊6*UGvV*ثWeb͊.b]vlUٱWf]vlU٩]vV*ث* ثb]Web͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbcvlUX*ثث`WeS +vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]t p+M)'d&$B.ûX .lZ8*o<2ME~*l}լs8եQ^m+eA0td*xzl0!mHؚWڸCxʨiQdZlL(=iSVmxIx5;(ZQ+,^ y)VNظoJxFӯMLܸ$-(:q*)'6 wG6 -7!b~kr^)Sdͅ.5=0ޞ/E6~ZVHGMi^5+5H؃$nXgPjiOqo̅RJ lJj=n?g PTȯZTcfJ r82;sAJ/zeW}R§~j8Aqx?㍥p~ؽ̌;ofANxTavXIv,>YCBȡaBjBSbbĦHO2B.q7'mq Fޅ;JvqhSp$r=z_@8#Hn(hZw_A[#9 A\^EX qH;Q*)ZbI޿gr]{tEZ=۩M zFDZlj Ct PNa4PvȲ]Ȧe¼I^Mc'}EHjvټWU5SΠ}ހxnwZ]AALG/M7$q=2T/~qy9.CqMଦJKƳwEz]?$AA0W`m@&$M4ȀRڤRhsL X$jN`p,{2W~U|tG A-׾%Z` 0TnCZTSe'nОr%ZRB:F*ARA&>q\d&^Uާ=a..2VUIQtڝ:abGLLm]:W %8hզ; k:Sc|>li8乵 D5Q郿xm.קcӫV`W%>p8] oTe` .Ɯ/eI۩Jy'ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v)M3UiIgY,ۨP+LrI|f݃ J(i3@WWsݒ;Kx@SlÑ!.8gv{[A6xRKS|;V)R!#cN,vP7̀+B7Ōx:dɲiF"1'GHXH;k|ʘ)ZB#ߦ5qƦ=2&[nC}c WaS`+er8SV {@41T0_q7ʼnrƐԊB5{V泗^]я m5$QE!]x-irA r;| H: F^Hg@%M+ր)ȀA' Clkݩ"y1ʕl"1qL欑.~:ȐvWbe"hTAWeC@7RQΜѕmX0Zvdr/3Im @@:o#OoNw—U;=qi&pXBŀ ~!!ГCB+7ڲUb*>d۾VZqaWjvkM1[$;?g$RWlUaPv ȴH!P{"2u(b )};3.ۦNPdUkSqSʦ9~w}z%`QVg-Ua;eoĚX1ĭW/#PEnC1"=0tUXUL8Gr_71plUH$T1k*eHVlc9)9Sʷ] 71#Dc CKktOaOnaW1W}7J;O|y3&!Pn |5+OJ,$+t%ڔ6SʼnڔɌPjIc3-7!+03I"0&ߨ9IW4G x,Ӡ{=.4y ;qA\0Պt03Gņى(mM %HWk v.`|$P,YdRZe$7j -zn< [WcPOpGjxI%+=rlD:TCj _f)jP||/)E8JK n;ӽ2uѭ ¤v|k()8]Ƒ=S$!xs lQNe ")ᐆ $~y]9bJrko%&uu9lçܞeRAtLobo'Tj ^Lg(~ÑwpqBO~In 97&raiťsȶ ;fԨӾB]Lzjj{tJrA  r{SJ#Soi^M0B(צa wa|`b@ԀԠ[̻&AK* ?4;/LJAG ?θP h'%iu0E"WSvp+EjwJ9 hu$m涷]攱e8E#nHʫOqʟWwVm[];3z Hjo_[aH>YAV q[εJ4iT?aE1!6 */ >>4m9.⌡Oq_o_ˑ!i} qcPk LG`v˒3XԞDSzn@▕6ӵ?qV9SAnU?G1zVS\ uHr$V^\| G.#gARFƴ؏8j@qpe1H ~S4 \^?x#*oŋ})dڥMK Cb2j $_n9xj 09f&guPo>n3-d`iLIX7p}4fEǒW6ۦ'3-\ {IJ@\ڃ@RE *;oR1ia_MAbMX"Ap> *UGB;mHԠ#wl x.5Zѷ޸AO>m®M$#ʘvhOzǦ7W,Q~v4NU)Z)dFTTZ\'Zr=ɦȞj܁m]Q߉R04kLA1 tpD F : \ wcTBi$ BvLc צJAKenR@= 41Vrgy=Ad}@^?=SvZ?30LqsHZy G'qRHБNC 5Xi:~.~/?6A`XS_׌PCg+&V@e:K|L\K5 cը1ׯ㎝7$)̴DB87H`Km{eArFZqo\=h*QR7J)'q=Sk#Y&j̵(w۞N#4$;wwxKFFfRB琰{TDj-SZtbBU4j@O=MЃ%I%FӋK@#f5؍w] hU߼U؂{RX<)VI< 3C*UM| [2$r4j%Ic@jII`7e8Z2 ) FIp ӵF;Lа!_P Kv4P{QN7YMHl kHҿ< .Y)lk)"2c Z)4DМ}y0Xj`^tXn;{f'l[)5r,h$ue)(Zɟ!R7M/6Zel@W6ſ% +_~qAR(ǏZu$%U^c~ xՕ֥nbaX:=۫)\#pM4?Nh]H;="E m߂<2*hH= VHFըP=k]1>YO 3A)r u2Sc9)D6QɸR@SB1xE rGEmtA :fva3D˪mJB:9F?vĀ26\.@#;Pxb@ < OPŻiQCWnF?ÒPmߍpY +JlƵv$a%%zEkxz76,w Ąpբy JFO }&?+U;f*C>ﰭgӊ 甮Ӈa߰=>/48ƤblZ(xOBOw+ZZ N,c/zh|GI%RG-=^ʂt`hĠuqkL*GE}2\UĀPq b QUOBU t˚BEA'`Kz4dn ; G%*9;+aHm[h;l;m N?|7܆CʫJCtӽ6(Qc2X^%FQ6SVQSR(Fr@QJI;b=;SRH)^DP|M\!Wޟyޛzd#юP +@>lyŰ#QnzJJaʴŁ`>*u{xeʼ[MUr469 Aw ( X=dK (O6v'ngol^]XxS&{Sm %ƫ_|wN%_4Z[VV#Ү ]cQceSӧF9+!\ĨbRtfɂoQ>8v W^$c%^=X&u~90mӌƛ&pc &RȐZ#Gނ"Y" NRۈ-V_j#u㕺<6ymAr <5ZsGwgwaP2J1\yIudIobi]2 R P:}iRsZNRCPa<",D9H@ VukХomcQoPO4,a2HJk^%Hq`EOފ@o%*DVn{U)I5I(Ҝv'2!~>wJQG| --T۔k Tvܶ8ncFAsDJ|'М q\HnU4&ՁIh02mvHr#C~L=+{`*I^T'r6^Y!SB~vʳ eDA{`)i+-0EQ gn^Bշ0շ66V2-v [ ,HڽW\ SS&R/q86jpuphtdP^;dmkx`NJDmn)fL F# %]H%)ejZ%<;dkPP(IWev:fd硥{rҀzWna6wDGӷڤ ;Tc lD,v; >cڱ~3SO{цU44޽s[F)! bb+QWq~C3V᭺nQS2p2R x׌]Hw9QxC\14jv;b .lDp7=v8b'$lÙj^;ʲPxҦ0{Z%j ҄bάCl}L"FTF5[:ǫ!PO")x|ŦC[7*d?̼9 7 l49[zn:2aN, x&-~͎͊6*ثb͊6*ثb͊6*ثb͊?*6*v^*ثWfٱWf]vlUٱWf]6*ٰٱWf]v]1KS6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vlU٩6*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Svjb˦*ثb.LUt]vlUٱWf];6*ثb͊6*ثb͊6)vlPإٱKWf]LU٩51WfvjbL*]LUٱWf]v;*a®vQ͊vlUٱWeb]L*ثWf]vl ثb͊6*ثb͊];66;6*ثb8Wf]v]qWf]Wf]vlUٱWf]vlUٰ٩qWf]]]]v^*ث%ٱWf‡f]]6vjbLvjb͊6)vlUGvje]+vc/vVv^*UٱWf]vl aWeb͊6*ثb͊6*ثbx50Wf]vlUٱWf]v^*챊]1]];6vlUٱWf]vl ثWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUj*i]Ns#=r`'dK5>MA*-JT)&-8 *kU M '*{֝*ЧLUv-6Oߏ$, UI!}AF@CcE>AHMwE䡹ͷzIWt5ń[kV1n\Sr;O\p-$J W;ozW^@U=}q_UqV]Pኮe2L::cCi֩ % S}"P]TTܸMj/j1F@QI{%w*lq7uPTnklp6&% Cj= '/ DQO3m.;KفN@R~xIyN4qiC_cl>[zt2Bꄴ,kǨ};ň=zBd"M<%$]YiҦvLn2'=1RiZb–4RFƿdbWА zLS*@A ol)QGZx [ӊua۰ȥ;Nx=J?ċr6`v*q@syI63o>Z<x|ثb͊6*ثb͊6*ثb͊6*ثb͊,b+P${t3φ-9gv]G)uJuq@/82!N4)ؐ6r6H۰].PHh; a  *fA(m^,8N?Q66X-oi/p'R*ȴޫO놘X*FD$9|ZГN$ 5xmbqxSu2b-Rwe'"lɌC. .%09l<R2?d #Cu @}qWph?7c)YՁbE7,du>8xi<@0|6LXC5\p.*^ Ջ>=౫*FGL ۱(ƘǛ~_!"i.Xӽkf"1:Jl?^w@?G|hDmB0%ԣR}dU1f܎J:FMK X-i^|b)PEFe I9wSڤ))N2_PUX\ 8۶$7'!N 7ܫF-OO"Ep|myrV5=5)iYSX 5Z6`§LWF;=zuIZQ" ʜw\F+N*6Z_޽{d))1Fq:TfY(dXrf88Pv4wp B7?auj )y"i=wRD|v,kUߨ9'NT4ڄxOڪ/JӠ̬@vRǯKg ݏ60 h++DVfy z $N,'r)AS MVk^Ґ]yl*++e?>IJPbTm*$V++S^Ԟ۶2$M:4ʙ]~C8[ȡ44v x fύp4eB}EjqkF}qygvXDXzҧ2Fymhb8 ZǮ䦪h$G $}c$jXP֛5Izl =*GSm ,Ӗ.l":uR&č$@~xP ޘ-'$LV [ڙv,v *z♂+ 椚J88j)]鍰"Z@~2Wa̤S>M4 ` 6]k8Xz14վ2Cu ?{(w+5M扉=(iU j# BŠ:0•F(U&f2ء#;dj7pP]*ׁVٍI$zr-E~ ~1H 'fJsk qAdզ}^(~ZWjH=='&6ZjU+>P{cN:F"P5Mzw( KiГ߶F9wU9Q΍U+TNr` 6;UMF?79`6 W9X>&d ud+;vمBAUk6z<4zr3z]vlUٱWf]vlUٱWf]vlUٱWf]*6*R챊6*ثbL*UXXUٱWf8+bͅ˦*f]vlUٱWf]vlUٱWf]vlUٱWf]v^*ثSvjb]vlUٱWf]vlUٱWf]vlUٱWf*]銻6*ثb͊6*إٱCb͊6*ثb͊6*ثbLUtf*]SvjbLUٱWf®́]vl*إ ثb͊6*ثb͊6**]v^* v&rh.bvlUٱWf]vVvjb͊/vlUٱWf]6*ثb͊6*ثb͊];51Wf]vlUGvV*ثb͊6*UٱWe͊6*ثb͊6*R챑Cb]6(vl*n*ثb]/6;6*إXxف]bf.͊vlRU٩/ *ثWf]6*UٱWf]vl 죅]6*ثb͊6*ثWebxb͊*UٱWeb͊6*ثWeWe)vlRءXٱWf‡f]vlUٱWf]vl 죊+ 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊 K/Mȏ7pNvɝZ ÑvE(%%ѐ,hс4R)JRGiM4ǩ;N5nOZ~cJ0>Lm]O+`cbujtw߉KT*u QߕM V:.ۡo Z]+tSn S @W$Ubɳ (hb2۫B\ds^NN֗\cn6leQ̞ ,5 n>qGTa{ )VɧLW )Ҕq-NMAąiq@;6Ȕ_h{Ӆ\kMק5aF9pO~ʟd UƃV~fBΕ$E_ZR= &8)q2_rwa+捸3Wj8!ahһn{c̍WsV?kiN0Ҫpٖ"N=v8œAXZޕ8e:>"H?hdOH=(E߱g)B@r  +Tx>RP19Ei"UP||F+PC;imS,(=)h ɀj y(C8xɮ,QEiVZڽ7@SSh*HL }ֵ>;nz9w$hzʴRFdv#M})^(+Mw1ZmFk{ \IE rh-jlzMO*4cت0+3`yzIIT +>dr,W~?XSԀyֻj.'7 HfVЎ[;}7iwd5/ߥ>d`)hRR(ۗ>ɯ\ii lE6[w HJ׭NJӝ\jÕ7_ YkA⟬ ֵk퉩Đd(;eȤ5ACသ܃SZd*vjwmtFTn(Nt5NQ*Ҵk ClwķA;bj2 +lK\yG2R|38177d@)u Y ޽Halx`zS ʕ͸?=O/Mf9*HLǴ2̜p<߶緶d'j(jDl䞠o[IUʀ'zu1,^.@L >\n+G郛 ^1UV mTːHWj`oB@ N4->uP[&F9զ *ѓPUE.z|@Ï^3ȭ[܎?Pb+tn4d jU4wHQII"P?J=CAlSf3?Mr"RhEŁbzHkJ9 o#{" ERB0RiCG\"prF#Hr_N0SeCwy~Q$dU;ւa_ vё'1v=c# :ֽ0Ű΃4n'- "B(U#irRZU#in9Fǥ?XȞP;U\7n؋+1 CÕ;M:}ȁAN Au )J İI;+UOlk۔`@n bVG:ȭ(zXyVҧ]xb#i251;ں9zuF0t[np7Zcp3.јq3#O]Qg`,O64hIE$MJ(Jv"niE{~98F-֤:ˏrUjr^2PRxǗ=A=뷎VGIԂ zbZqc*+G;ePWd0V$qX-PH֔ 8,9Cx 7b:;yVU+74 npZVQ$0y K6ݩO8_2]6|պ:h`XmyI=V @vIא|*OmbJNcZdQԌ(* [P L錤Hl+0E/!YQw(PH^0_ЍP*2."PQ]MZcEa_:Qȕۨ}&S@j~ ^FH̋5Aj֕dZ&!ZN#]큘o 4H:a礤q<;X̜ߏ۷*kDB($ z`*.jW0T q2A jO|-yV2UFZаfJ㋢S)jd%Mj{ !.2P++޸\{SZpZߍ[犵OZV\QHo#ڭh<؃>UzdV?'ߡWWpqF| lvZ=E(vŪqV늵NguZZ⮑C \tZ0C zm*C|)J'`HJ|⭆IW }k #E'`#-\02[G*+tisZA|>/TOŠVdu'^_X̉ťQSCB: c%O`u5&¤bR\,죡_l9,y#5Mic$UӨ{fr\aZk_ܕm}!g <wzܑKh9|=E9bޱu(iܟU0 rP8Ef+Ƣ`xDwrzk WU?T2 Sȏ$bs5Mׯ\ K:RE7ڿ 0,jORZ^RX`A .d z`hbO" *2dUXNaCv"FfR s_2| 5Z \qV :-:r$J4WF T} ^.njȧ&e bqpA iq*TRMAA#%w1JZW`2 iá&dXҧm jz^莊̠V= ^ v'lssJd)&AXfXO<@+ J>ZRU~`Úһ S( RE!X7:(`Ĩ>ƔaϨ S7N돓Fi7k"aՄmOM؁fH)"XTԃVJ|X27'U#bO\`%3ҞJ3C&ý|s (TNJm-Ra! |t¯@uŧK!,cʨ>-6<~zƋpg|xboSヌ-z wBG76o]5H.WcM [Mͦ9q j21:b͊6*ثb͊6*ثb͊6*ثb;7dOsQB.>|1vv+H4;*ALIwgn<WcKa#%1eU>c%NOU\Py>(ͶJh#2ܼCEolxZ nԢ" $ؒ ڿ+#qN*OƔ1! o$eibm}ӹ'䪹l͗Up\qs+1 ҟmtVTP JV`r}T|z۸kݣqvҕSf>!E}dZɥ9P%*+(¿:NfHy5t)fۮ_Jd5pJo1^1Zv8Unb{`*Hjl1Ƃ 'GΘx*kFc`RU8my`A#CNkOq6(Ь);})MUz툥$Y#ӽOM }3r0>ld8p1MZǭXeN5B+S^i $|g'jBHMJ!,d29Cq&Y) e*PJprT66kshiN4[ixVsJةشu BS$y s"[S g$dHDBN5 I>9A|T+o (xyŷJH,<&vJ$2Bbv4帎ir +yn~KL )\= F;IV0#y(:{eX hJƙ4b^HZ2Ѳ ZSn>*U+.峍:4QQN͆@Wsp#bK$zn I?F{"Y7 ,6\ ScޣxIޚ{ɣb:ݿLȂKGaD_SHBu㏈`RrO Ĺ¹#Td'Y΢5-*ji(&UR;XMF(&mp##$SMF|U nrQ䓦rԚ3C]m |ɟUX@:b]' Y]QA[(Ow>c^)(=˺(O H j=7 _|CI-$ƀM;t&"ӥ6ѻ~Wne{}2V,~tls17#ROZڃDƨ-n1) `p֝ !pd Rs1xysF!I:E~ {@Z':V~X3uk:x'Jz` ~?`פ1ȗ8R,@=+ڞ Qȡa|:f.L2\x{ *¢vPȱoL8`l"UCTU+Jxw1;Bi7 4@xSþR3 -Ԓ*R"aCԝp#h A;RIj]*w W .k~5E;`Jݹ.Ek㖶U 4zXoןdthZQzFDT3*1by7zIɻmpyqjM= M$^OFFdOݪȮaLq= $\EFMRCHkڀrJҀF6Yei'.]z@(1xz%{b"aj9Ad4@" e.MWf5{U(@4jvQ¤mѪE>]q?ӗ(Vz%ԡ#tK+h7c^5ӡq|H1'^M(rd P{郅x1z7^@)zWqYP 뀇@ oP740Rld\x2ԕ^&vV=@iň+қ5e惍]$~RRzu4~9 ZCmV vSV_ `5>/Ɩ:/Q jgA"+rF>L ܊VnhC$, a{iI&1C*T4IWq #3iqFA|>,@P\4Sd嚡TxkcTW~__m=P>I':b"P UBG%Oؤri!B@^5f#Qk#de #q&7Xƈ nhv묍2UHȣe`Ejj|+Y*cHit֑HfjҀC9iљ]c5ܰohR()QkD4`*kW/Bj߽1WF; l-:T.Mkf؉{x{e!xm VFWbEjtڀa*"v1BC"Gzoq #cJBAn:gfnd|2\.6TSmSfbu HD&FJbiq'{]+SK>ʹ=?\&!iq.)$? @SJCo|JD ShԐh@)w,c{`xBҠAxc$b)) & yqPOSM<1B+OnrF!xW H!E +B;LʖPTQbm\1 @1!W_1^z|+(t xTN~;#ϫ2z%!Ain|/o}^BO@(mmS(4 炊n>T\X( !L-x y S IPqF'G tƺ:@(0uk1^1XvҸF$cȱ= ጛM@9GjwȘQ USRU~te@N<@ |''vAå/P*zTtGLNqTsI b_ۂ):Sh \@aGS_M:mN'Qc :YA0~1-Z3v4p6cDM})-P|1k;G6 Џ~!7jɐI w{Jo"IxQ a},""p CcMQ3#74xI{kp25H8 /w,VލYM(ԡ+-i/vg"u&a}d(C=ct"dQ𬳕 o:ԐH>904\x;Ѷc?##@Y%cTf 6(X@~8(o75n8p܎_IlrN(2.:{MW%)@ fuFrWv:a[*OqSdHߵqe#'†@d"y;?FF7pԡ<.Ɨ\C #‚EzĎ2#D+9b´OqDʜM=2,!V9_5o"ִ.(7keR%vOؼa\v|5HFf(}G5JƱ6-F;xY"+eՖ@q1h6߿ƛn.k{l ,=zQ!֔,HBzWљ5ƗMP|`$֠H46ZQ+vO嫒ji8էssT x?-PS|A<$3x}G0I&W@ŘCUPNs<#mJW0&86K"OZAl@"0K%ҕbU$ԁ0;Z֣GV$$ip!|T B/)4H?,1oC`m:ֻTjmʑSĕ8YwG"g-رHGĿvfamŞ8]7Tnl1Aqw0&,.쵱Xb͊6*ثb͊6*ثb͊?)}Sv^*Ux`Wf]vjbLRءٱWcqWf]vlUٱWf]vlUt]b]LU٩/vlUٱWf]vlU٩6*ثSvjb˦*ثb͊6*ثb.LU٩6*ثb͊6*ءxS50+Svjb͊6*ثSvlUٱWe͊6*ثb͊6*ثb͊6*ثSvjb͊51Wf*]LRaK+b͊6*U٩]UٱWeb́]v^vlUٛ;lLX;p+aWff]v^vlUٱWe ®]vj8ٱWf]v^*ثb͊6*ثWvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*إٱWeWf]ʦ*ثb]vlUٱWf]vlU٩*U٩51v^vlUٱWf];+$f]vlvlUٱWf]vlRUٰ!ٱKWvlPثb͊6*죊+v^*ثbLU٩6*ثWe UٱWf]vlUXUxٱWed쳊+] Ux`Wf]UXٱWf]vlUٱWf8UXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*)G\`&vB4 yMAbNrrlP}îӕ"V5Oh;|LV 鿹fx6$1$6=Ewk$( z*GL IPo^?Bv#u2_"z_Ւ2eN83*>27hkY UaU(pqNI!h6ܾ*2XE:WeHʈVO<:IYQANGPZ A9ޛ~a8E aš+/SpKV YSq_ҭd#.a$-ċR{H\}$nܔ9>ر >*=f4,:-vr9''PY ,+B)Ѹj=>`T-5[^;%³\ SP?V f3Rң\')˥ےPzVU(Q}!8#3j%Dou^`Wj~O[j$8ך4 3P|wmB#QBEM)ᢴZ6>##@h1KmN(Ɗ(' 7UXc⡈؊ uOSJ+[9 zxᲝԤPXH6$W{XaDZ 7J觖/(HNI1nL"7 eČ[|0,,JqI1 lX%be(*I=<)_ʚ㈳QםhN@F&Њ j䄓NUGAqzlFqǬ')SP7.,ZF8,>;d;'ב$ zl(kfiT<+ֻQ!xV)Wv?_[>k;,dN] ([u\r8S_n9`,U!(bYNc9T(ENMzeR wzvŶȢ&Pji \+ HHEGk굍7Qnp, {fX7*S6%ocfU mӿɧnq l5iLmd Bw5mf, wfK_c& 4wQzJM^rkr2P7vlUٱWf]qWeb͊6*ثb͊X*~Tٯp^?O^ÓϞ?Kۑj+@)'f=]K8` 'Db:zc<:vX$ Q> ؓj5wz}1guqT(Os5w 6=K%]dעMuɍ9-ӒF2Q2cJ[#.y[dӦ[ltnYN7Ɛ7 usK9m$nwOh6%&kҘ)GIWc2k:6낢j޾'\eZ"H#ZS$Z$]\{:B. O4FCriq!-x\-Fk+:rR1OJ~ <#]V$zWa0*qSizJ7Ș3v.iUFBf6 jv4Xժbv k RAj*zV¼Je=7\JϛDbwӶEM] / \dVoZӮg{0 }E 3ʴ\'Xd=Tl7F줶TG w=12918FKh@ KZtwFN Thb($5&[5 hɏ{[L-Ř[n3҇ 9{i%:JB{WsJTf9.WSQf ),O@ DcY#Uԩk+V?V!-b&`XIfa iGq}H,R#C qj`_WMJ=w |!,6 SA$#֝ dO6U@z`Ir@JȁG}LH"Jy=HBYj|x|$k투rV?o Xjt_| '_ ؎-@xcƂ}mW Sv4?5DŽxy,H:kc_RPZwk1~]ƻE5#x,q~Sjw~#d1Vxڸf)*!$A.E8^nOI0=ץ2ԣV7폂U }J5Q L{C(ېmr^X9܊vژ G#RV>%ˢ@ L>ӹlN7ǥJ7q#B  ^T\cjEՅ*+--я7 xtH`%1H~u$Uڙ`ɰ k%6c{hM@né! kh@ڛm>g:veKHMa팏\PAv:߱ƶr}<aNzVb?R4K-4Nx;OCHxo]i2h׌T L9c^_ ~f su`'•٩P^ t+ۍEe,Qȯ@G_d#Nխ?(W 6Xۻ 6sގGN8fI\̮˽TPgI >1j XXb͊6*ثb͊6*ثb)}SbcK+b͊6*b͊6*죊];++;6*ثWf*]6*ثb͊6*ثSvjb˦*ثb͊6*ثb͊6*ثSv]1Kb͊6*UXbf]L vjbLUٱWe͊6*ثbLU٩51Wf*ثSvlU٩6*]SvjbLUxb͊6*ثb͊6*ثb͊6)v]1K+Web͊/vlUٱWf]LU٩51Wfv`1WeL!v"4bgciͅ]vl Uxf8ثvj͊6*ثbUXb\U٫6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbf]vj\Uu]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6vV*ثaWff]vl)vlUٱWf]6(vlUٰ+aWf]vlUXS51Wf]\UٱWf]vjb]]6*ثbʦ*Uٰ,]͊ͅ6*ٱWf]vV;6*ثb͊6vlUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rM\SNɖ` A'r}Q9=6an?f9䙀tph|kUSq jqLb2# I@X)aW5#珁IS}Ng²7WU|Y Xj4k\AH38p]L|wQz9GSڞ}$Lsd qţӧ!:dEr㗇Ć}8*mRb]g~ iO?V HwL~-:͸iK3 Rq۫!? k҇lZ$eF w,RHNpZ#loI ;24ͦwEAIhO/ Ч-؛9|'j햻90AJTnhz|9o@I[LF4OUE]EwP1jV{(qZ[$(bқ?kƖM߶4DH8GSWhӄL^")vydЈ(6EYB1Mhk?toI;1t2(R%l0_VKzU]2i #*enMQ M9~tV@<*U@~%-FEZ v?^)}=X7Pz`5㑡S󨧇٪TDž !: @Eh*p޴ݨd"KD܊׮ *i ߻[ }UL@ m@:{WGڦWD6@8eHևF6HDҸh#,7;TxTVvT2So| bdj-|PTA7ƽw]ToܜN*Q;1޻$ PrOz`a1ؚ'B%v'CeŢ\W5Ԛ<+GcH)T~ E>4Z03);ۿ߾YX}:HBzzmFe-اh ֘ KujKՉ'+8"ZΞ=kh(M҃ɪy:'軛fri DeaQtsj' UW_ෂxC^2T U =uޙIM'59Abq3? P0SQ *Cch 돆ө<)[0 =Le4aL? +fƩWzW~=2`0 gZ{Pbw[?cwg5kXxl큙i CSsWVT:֝l Q4VDі'`v1-2qn5 HRj9pqb&(7A+}"@:{,qF6dqJրal*+M \Xd,G.{vKt$5=rBF[8ך^U?-ZsƟۗLK$?}At 8"r#=>Y \}W *o7\T@(hbt;b{GJmC`D4҅5' 0e.v)\4$cƃձ lMLRpZ)mvۇPzRw_$!(K!sav!'2= Qlr؀{ ;Sroa>xbvFD<'lLEZ}M#܇.@j[댡Հqޘ[D.6/5'29&r  P"dHZuS8#֡2Sniu|$:LpÚ ^D$SqҽniqLa-[=0)w5V59.B#9^.iؚ A!Mq֒7$"w<,4V:>NnD GhG~Z7WFJ.m_AOrSZ]lc;<FS,wiz~%Rjŏ")Fܲ?;A Om)"BWݰx >zCX ],^Z))IaLŻqWQOp U=>xO*o8q}MFQ%x|YxH:,O%eƼQyuϕ'T2)<6eV2ၟJ&JGQU҇lSd)HrȯӶ6Vja"ٝװ)ĉ 1PmXA8 ~wv jW5yu:;jySVq;ҌUNbamZ:snEE>>Ǔm}=v5M0<.OȤzMFQGΊݪbxb͊6*ثb͊6*ثb1W9xc/vjbLUxٱWf]vlUXb8bLUٱCWf]vlUٱWf]Sv^*ثb͊6*ثb͊51Wef*ثb͊/+ LU٩.͊51We͊6*ثSvjbLU٩.b͊6*ثb͊51Wf]vlUٱWf]vlUٱWf]vlUٱWf]Svjb˦*].S,bc+]6*ثb͊*U٩]SvjbvgA؉ɱ.ĎCaWf]va/ ]Xٰ+W 6*ٱCb͊51Wf*UG6vlvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱKb͊6*ثWvj\UxٱWf]vlUٱWf]vlUٱWf]vVvj͊6*ثaWff]vl)vlUٱWf]vl ءٱWf]vlUٱWeUxٱWebʦ*vV*챊]6*P]6*]vX®v^6(vV;6*v^* ثb͊(*ءٱWf]vlUٱWeUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbvn&Pz a=ݓ&a=l]L݀'f8i!*[l{xrW8`4ՊLX* ),k^wGR+\y,eF~NfJ3SȺPğ LX llj9]ZiT(mʹ2hq$_kqq[I=5ZqZ|Bn''VrGAF+YZ<|By:r8ƘW,юi`Qfi-G4ў@q1DhjzoLK 6\t\G?hwɪ:=Aޞ#j+HAKdEU ! ÏPp%uE2T5EG\xQľ-Q0+:)x+(}%ɗ炗Ev=ppC! $}cˆS,7prN~%F*񬉶T4\Eզ@2%ʍc3;u"co6*ثb͊6*ثb͊6*UG K/7+!H5$︦%Η # Sq ' M4fLvFw;Ӗd I5-X 223XƞVRṪm+ z*Nî*T\*z`iynݰS`F\<61;,wpv G9q]#郅&#](jbHӽDĵM3GIXjȩ`~Ledc 1)[FI۠,Y=:7s, JKRzae/Pҕܑw.<.oC͚v6F_> a?5NVD ;R,„YvTO3N-~xi1kNXEQ9~lgѕ\4]~.4`Id*P:8yڎ;㆕2V@MzdNVjNTh ӮGu:"p^j^_+LxEmF^UZegKKiɯE!A}fAA־2TM^jL+ p~XӓE|zeNcm~v5M8{ 0X&qCl8T\Ͼ K9isY5AR>&*/pL4INyopo^90r(S`k0RF|pS*AFMNE'>#U?Nd6 Q:? FVjd[٩51Wf]LRbf]6*ثb͊,bld6Mؓ`k.CaWfͅ]6*ثbf]vlUٱWff]R/vlP)vlUٰ!ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf—fLUٱWf];6*إ٫/vl ثb͊6*ثbͅ]6*UT]Uٰ+aWfeʦ*ثb͊6*Rثb́] 6*ثb́.]vlUXWf]LUxb͊+;6*ث ثWf]aWc,%T͊,bͅ]vj`Web͊6*aWf͊6*ثb͊*b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeUeL#S˓ ;x^N U t{ARAUjp<ק`p!V8%O\UT-1$:bI$;MNvX>8b̭,rmbNu3J"Z9һSZ#WMSG +|4X¸]`݇\ "  |Su4î4d-þ Ձ#sm˸; xC|uEUEt;<4gqL* xAVҸ1Xڜbo4<0% ?t' ݃ 4tPwPi;j՛ζ>r8h!)\ӆcZi}dRQGLAHqPֻ鮖׾*AD91jB_p> zef &;~G}XVq1pAjN#bn{~`/nƮFLR(6Vo%6xJ/:' Gq^ pᧃw\L^]ˁ=8ݳ(5XPW#HE<+Y7,%H!acфGژXz^ݪrA\%lRq4넔cZ"FaHI M,!O۶AL@e$q74O!iT+Mjh)u^`!:D'|YnhYkmSh9RwD6-E|1uQ+~ l\^4v{cZpcLޘQ[0`lFBT Gċ5A0uSJ)#|PBH s@p5!gAS\8ҏ);\<梓jFIIC9e1Н>& YYmƵ9emM_/T8A[hWXCÎ[dPoYA$`6cmS|5"⽺,AZԐ}7{4ն f\ 0, q4.Q;*\cr**{e#aQu}>%,L98KRiZߑb{43B6Z8۷V]vlUٱWf]vlUٱWf])}S/6*ثb]vlUَ*UGvlUCv^*ثbf]*ثb͊6*ثb.͊6*ءٱKbe v^*ثbͅ]vl ثWeSvjb]vlUٱWf]vlUٱWf]vlUt]vlUٱWf]vlUٱWf*ثb͊6*ثb͊6*ثb͊6*ثb͊6)vlUٱWeUcN`Wf]vlUٱWf]vU1Wf*bLUٱWf7Lflc'b$ZvlUxS ]vl UٱWf]vlUٱWf]vjf(vjWf(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]/6*PثWvl)vlUن*vlUٱWf]vl)v^E]vlUٱWf]vlUٱWf] 6*UٱWf]1C,b͊(͊6*ثbf] 6*ثb͊6*ثb.]vlUٰb͊(Webf]6* ثb0AxPPث*ثaWf]p+b͊6* +;6*ثb͊6*죊+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v9M ӲYZOWvYg]Z݆+a.iQbp8oLLFV(0!pkle];‡f#].ˮ]C8.®,bS[b\Yf1KT*|Um1cjSpUOQö:ziq`p\UMmᆚn#`)ȔX Ω|Fl:#e*Ќ͹\lU0E☈(E1o՗6kr$`iV%hdPwz,I(@wpգ捩-k  zb2r/O)P*JP^/@08J+hTbn[bH+bY*L9 nbfw†+ʚuy*{f.(#w. lS薘`3#b)צ[VZqtz Sÿ| Fi _@*xbwVUHVGU FmPa K&,l*pn(Ek ,|p%v~*]|O+cP[b3W]LhcL (1V:.8w1ݐۜiZkpF ATd_a?y%Ǩ!֚_Z69KWf]vlUٱWf]vlUٱWf]\?d`O˾Bq1Nιw$W6FD$˱0c->;ݑcmLۇpkpz!c-rG1.]`n qj;8᢬8bd=kL _ #0B(Q7 gt#'a߀< n9DS]|(7&o"ynq)/@cBql%$'0!(+SH^k$"F33 %LpZC v*_L T!ZJڔ](-JJ)$oqVA.=bbň[LZk Ҹ+c``E釺>UoόIfd Ç`(GR1pBZ mb % :tw%lx c$!BWE\ֹ Z $bp [d㲜@ߦ^MOlS{FS:T׶D mMZA npJBFIΊ!qKR ?G\I#iGར+laޙSEKd!  G}ݴgY2"hdjws~Q+vlUٱWf]vlUٱWf]v)}S1Wef]vX]vlUٱWf8WeUٱWf]vlU٩51CWf]vlUٱWf]]vlUٱCb͊, vlUxbͅ]vlP vlUٱWf]vlUٱWf]b͊6*ثbLUt]vlUٱWf]vlUٱWf]vlUٱWf]LUXb͊6*ثb͊6*إٱWf]LU٩/;6)v^vlUٱWf.͊vlUٱWf]vlRUٱWe?Lde92NĎEXbWf.ͅ]] ]6vj`Wf®͊6*ثb́͊6*ثb͊6*ثb͊6*ثb͊6*ثbͅ.f.\*͊6;6*—f]vl ءٱWf]vlUٱWeKb͊6*ثb͊6*ثbͅ]6*vX͊+vlUٱWf]vlRUٰ!ٱWf] ]vlUٱWf];/vlUٱWeb0xb͊(Webf]+vX]]va]ebŋbbͅ]vlUXٱWf]vQ‡f]vlUٱWf]vQWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcvn)B9c~)QaC,E2c l(Qu˒ zw-)q&0* 昡n1WfNv9T|R])ٸxˊvv=ZغaV0늵LzC KQJ88p%8p0E0BM*l.8FH6d/ tvoKz +hxmJVqk[&qTdbX bS If8[SlMIzr(TXPBءti\UJ=KA(֌vd N-!lk8+>JGLP7O] U*ߤc,7T1`MBӀ )D[Vi| U"$VG=*㊯Z╸8UǹXt­5v|0*U*w<R1V1XZkeUB^e`$q7!Z8^,i׶@q Xx=𾮂$Pqnآ GJakdBzaWQm (UMH#L%Al:djmȊmThn`8QS\ v@MOAf 4ʗp8ف1sC L[+iש8` eMm1KѨqb1E5܌U2ն:^M[JN(S-QAR8zt&\erPp565'mܬ\`ʛ+A*m|6hڧT-Cj2Rvj@c%GJdZbƤ*wQEJ`7 +NXm1Cr#MK& WG'@p"Yyj~9)e78jF*rGqS1{aM8 M-~Y/lYSlh+J}'s5v"n ON1N߶Ee6RN øU@qĞy3<6ըYۡOݒAWS.5[QN3pr% L+ M2%ȈE15,Df*l1pTڽ`r^"WqqL\Ik-O $pNl|E&(4-ةiQ[a':IlG f-c_$>L8 W[g(ˤT'~զ¬]$+vAfL66*ثb͊6*ثb͊?)}S1WeRUٱWf]v^*]qWebqWebfp+aWe͊vlUٱWf]Kb͊6(vlUٱWe.]vlUٰb͊.͊6*ثb͊6*ث銻6*]LU٩51WevlUٱWf]vlUٱWf]vlUٱWf]v]1Wf]vlU٩+v^*]eb]Sv^(vlUٱWf]AcKإ٩+vlUxS;51Wf.͊51Cb]0 &L`UٱWcWf]vjb]51Wf*b͊6*ثb͊*Wf*bLUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^)vV**vlUٱWf]R]6(vl)vlUٱWff]5qWeWf]vlUٱWeWv^*vUpbf],bf]LUٱWf]vlUٱKb͊vlUٱWf]*ٱWf*ثWf]vlUXW ]W6(vlUXb͊6*Weͅ]`dn(vV,]b]vlUٰbL UٱWf] +;6*ثb͊6*ث*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeMWf&1Wa5-#$nUj7Pi $QvZ (X!:R8xCZUPbE+\ov2KrҸ5qҮ2ژ v8 ]V®PsZ R1]L®=&Z.Z+8Mi6߾,^΀)5}権4R(튷%lRE+j}B c=*{fZI!lxes"dޘU]b]H\LL=v+b*098U oZF"mc/qTb$w؋88\O;ci*1@w'YNXU{1s\J6 wU%UqWbĝV*`VE=JӋ-@$aU^Ǯ(\ `UƆn=v(]SFBE6!`uĘ|*|US8;t \W1ZՅSQW$ 12A=Wު=+c|jwXlPL*G Ȫok-jޛW#.M؆ͭAiln@߈=8|ޏ.aZl6.fiݥnjs=g.#eٱWf]vlUٱWf]vlUٱWf]v t!de!HN΃-)xy@$xf}'Ɓ8Z7LB0)#"#Sl$UJmLq lMJu 9P- vI)7lxV1[5 !|3"kOSѝ=Ad2`~.Z k\"R"ižޘ‡œg8ׯ\XS5q;M7`Zu2' xo (.9w=\tf ظl VA1SBv2)r,SeI4 *S (-@Fgq.9\X[`'oEUixSp%#!# `Ң=:b%M*z iƆ6l|r=kL(!iQN`.lZ I7=eI4l\zSi1H Sq$A-bڥF(ʼnZqx6'b2MeJAbѱ=`T  ܞ + S6xTK@푻[hls' b\F(o`bV}le=;Whz{BI , `zdX)]JↈǭjBVWOT-pؼCaLJS፝r-r4҄DuRܤr45>4E}|eJr,iWnR#^lA^1 D(HkJ,צf`mTc۾0 @*(pEv끪qQX0!rVJP!R Vzwv8_w fDeKl D-e'#{r;3%53PIk*B˼kQ!,#sDb}=Ϩӹfhʨ=6n#ap<1@Pleb͊6*ثb͊6*ثb*p.͊6*ث*UGvV*Uَ*RءَvjaWe͊vlU٩];/6*ثCWf]/vlUٱWf®͊0xb͊6*ثb͊6*UٱWf]vlUٱWf]vlUٱWevlUXb͊6*ثb˦*UٱWf]vV*ثb͊/vlUT.];6*ثb͊6*!ဲv]1Kbf*إٱWf*Pث]Wf](Ɇn#.͊6)v]1Wf*ٱWf®́]vlUٰb͊6*8b͊6*ثbf]vV*ثSvjbLU٩i٩ӲCSvlUٱKb͊6*ثb͊6*ثbL*]6*ثbL*ٱWf;51Wf.͊6*ثb͊vlU٩*Wf]vl*ثb͊+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vU1Wf*ثSvjb͊6*ث`WeWc,ñn(vQ1CWf]vlUٰbL UٱWf] +;6*ثb͊6* *ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*|2:j>YDѷd د<[MMl2WjS,pȧ +R]'-.Y*1t8#,qN(v8–q ( ´#P&C8ʾGӅ"c'”ʕj7 F81'p84P6Lk#n;!R*Mp2<(> [i!aJ+!yzS:eسIX8HvY:cŘ2jrJ=qdᆠP,)=jbL⪠W(* H{wBEሱ>8X(\*qtH=qBa -m+EA ~XָJ ;H⪃ƣ\NN(Tх.ŐqV6V镔W $zT@W|UWU*)ኵVy*)\b5 GSL @+Z#x݊NB)\ 4]LY$+J㌘.~PeָcԞP≊8 b|)R| *j|XJ|+WtƐ F[( hw8Z*mLMIVצZH늶Eq5#\Rly@H1CALLa!ᐓv8YIQ"w'KX>*t'r5Yy>|:\UٱWf]vlUٱWf]vlUٱWf]vlUٱWeNU,/ORb\ZA+1L^ew ߋij8)ָ[T08*Vnإؽ銕8| і04(05>!mӶ1xy{ӶTGΟaiXp bv9 b1b\q|1@.SYH4(leŨ; ЌknŔ;ژ۱8VShv]Ɔ]NqE:͸.( 1` +p >[)Y'/]Ő^ ,)JUEi۔Hn=0 o6Apƻ8QMjzad`^T[\"ZuŤHwrRbآʜY%C| Jm 4c4Qᕼ+' զZr$I Wأj`I"8 x^NIX ;b8tg5LiӉqmF8c0z))ȟ*&:u8##]EL =]׾8A5R;ucW,kGk_Ui[1UVXF(Ra XE0u)Op!W[ W*q2(y\`xV ֝V0[Innjϒd_͚5zh{vVarq=ND.*V*ثb͊6*ثb͊6*ثb͊6*ثb͊ CFWdH̤C()SU5;dn-8';I,)aJOF.L l, 锕? ŕ;БژPGqee8h|GS;l)HXsBb$0oUذBckk2[ [|UpSөw\1N\F*޻`E,+kHb &eY1hc`L`x6E ,Nizup2IuA~aon 6!)Rjk NG^f9YpwǬBƌ➦0S1Wʧ iwS$ L:BGze$Q3WnW.玂1!HUk JpyW"JG^O\cH+lYGL^(A M=2_( 5jh9+>=X\ߜ]_-nS3ۗO=(Jg99"Wf]vlUٱWf]vlUٱWf]9x)v8b͊/vlUٱWf)vc(8XGvlPUٱWf6*ثb͊.ٰ%xb͊6*UٱWeWf]vlUٱWf]vlUٱWevlUٱWf]vlUٱWf]/;/vlUٱWf]vlUٱWf]vlUٱWf*ثb͊6*ثbf]vlU٩/vlPث]6(vlRثb;1KS51WevU1Wf*]]vl ءxٰSv&ˊ)ӲViٸV -;7 f;++N좇 ӳpiٸVi\NSp8;7iٸ NN*'vn' 5f´E;6;5+N;+N͊ӳoӳbإٱWf];6*RUx٫ٱCWf6(vjaWf]vlUٱWf]LUٱWf]vlU٫/vQ]/vlUXb]6*ثb͊6*UٱWf]LUT]٩51Cb͊6*]LUT.˦*aC`Wf]SvjaWf*L*]SvjbLU`cjcKb‡eS;51Wef.8Cb͊6vlUXٱWf]vlUٰ`Wf]pٱWfWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Wa5PGjX3xg.9 bp& M?ȶNqI8^Y9ǶZ|M]Ue—c⮦;)9d=eMS[h8!.uVC+HO+'W fUBO'v)¤[Ekp|Xr"ŒY pGQqhIk $қ{bqXo &Rwō,k܊Lorxq'$;ڧs₀ОݰRF)o+֜ Pcng´LK܂Kw=pf(k-X1 ΝG^vStbxcƸrInC|4.&zE^DaJ`p$cej8Ԋ`l R1vݎK|Y*bjf  6Xq(|p>3GvW^2W-$pS<]oڛxiآݩ x)D80} c D:aM/A 2kŲ*a{mVߖb~Zث9So`G$7•cIV_M;-Ȩ=4e4z iذaJCXœs@o!("dcCCIqh %ƚyL,>(6Sq)mӅ1o03M1m9wʛWl%H>8;bWZWY ,C煅-*s1bCf=%j>٩OனZlj n=NV\"1TmH49encmir^ȱE;V2E ,n]h+;y*}]z11cen Nyq=ծ(I9O+J#O2 )]6*ثb͊6*ثb͊6*qKꜼ p.Wf]vX.͊6)vQ]+ 6*b͊6*ث銻6v^*ثb͊6*UٱWeWf]vlUٱWf]vlRءxb͊6*ثb͊6)vlUt]vlUٱWf]vlRثbf]xٱWeSvjb͊51Kb͊6*]6*ثb͊6*ثb͊]vXC;/6vlUٱWf]Sv]0+SvlU٩6vlUٰ+SvjaWeqfTbb1K P۳pٽ1mٽ1۲!۳zCf+n Vݛm^mٽVݛmٽ۳z#ez8z8pڻ+ٽ ӳz'voGvoDqZvoGfZvoKfE;1vWq^f+Hf+ޞ4.SOG #[|Ė)kQvfn@WE&d.ysF,zT)6ıCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*cvmWܨ5# Y0/(lX䭓ICPY7ڣ*r1&pqE4@Ťj#b1BѶYCcqPqJD M t׀cM1CihAWlY38[]f O*  o^œeւƚ`GM%||Fb`65Lۯ|U wŋXIh᎕~mgY傚g!J76NLd=H .IFA#qȌErI>9 Ƒi iI6ҪJNZ_LLqM7LibzKrf[rLUcjM`E-+c YESSvE)*}4wj{dZlb+L ژ[ 酸+.#hvYXr#|Xp#n,F$4 C~oMdN)cE1b1eMG.Aj8!{i), CcE~hBHL|qkZ4؛]h 2HNN#+AwH!~^9Jm;+ShB?|WM?,8VpƫTָƴWl,D[&X,osn,)ȕ^YP6ŢU|r+YDQԒGL4(yg1g}~r#sDSjS{'Z\>1mvqb;do/nU]vlUٱWf]vlUٱWf]vlU]UٱWf]vX.]i‡cqWebp+Cb]vlUc/vV*UٱWf]vl)va/vlUٱWf]1Web͊]Cb͊6*ثbf͊]v]1Wef]vlUٱKb͊6*ثbLUxٱWf.͊+vX]LU٩/;6*إٱWf]6(vlUٰ+aWf.͊6vXCNRثbL PUx+]Wf]LU٩+v^vV)vjbf*إٰt]SvjbLU٩51Wf*ثb͊6vjaWf* UٱWf͊6*إٰ`Wf6Lm]٩6*U٩51Wf)vlPثf6ٸqWf㊻7UٸUEF+nLUٸF*F*87۲Vݛmٸ mmٸ 6F[ )f1[vnf6ޘݕbLchf6ޘݕmmٽ1ݛݕ mm~n6ސn mm^ݛ۳zCoHckn mm^+nޘWfWfWezxpvW Uٸbvnq㊻7UٸLUٱCb͊6*ثbLUXXXٱWf] 6*]vlUٱWf‡f]vV*ث`We*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeU ^\ZZm>Rim]5}ɮv;F(v9|p+W ]*c]* UoJbqK]Wq##և­P~H[dV ~ P va$Ƽָ:BBS&B8`9t ^9U$V51p ?\,W [Ӿ*Cg1KX ­e`WWZ'6)ӑ bz DD Mr*v8K<bc Rg*e5F]܏lPPW;0&\rB6㊵[z|Wez]#P*k=#8q^'*qTU)`V Nlbgx GL%i8"6e&ŬaSB+ၪPT>YZGjrV'"dTJBlI8c>8G¢灬m1me) Q nHN*+Zs&Ҙ5@#;4dš5;t6<ϵ:l mJ= Dd`ʉZ7 WI!r@&+\F*4 2q*քR͸$SdSlM&<0ҮQLtG}d Aow/ùd BO?0S Zb֖<)_oI 3KI0Ӡ>rBq]M3>l7?%kpځϷ900.7@KxON\_͖ 1 V!AәnR'+vlUٱWf]vlUٱWf]vlUٱWf]͊1Kvjbe͊/vlUٰ%G ]]]/vX͊6* UٱWf] 6*66*vlUٱWf]LU٩+v^)vlUٱCb͊6)v^*LRUxb]vlPإٱWf]vlUٱWf*PإٱWf]vjb]6)vlPثb˦*UٱWf.LP ]]b®8ٱWe x!xt].]6*ث;6vlUٰ+aWf]vVvl*.˦(vjaWf]vlUxb́]vlUٱWe*]+;.٫5qWf٩ٱvV6͊]1Wf] ]6*ثbf*®́]6;+51We\*͊(ˮ*]6vl UٱWevl*ͅ]vlUٱWf]LUٱWe]́]/ ]LU٩LUx.‡e51Webͅ]51Wf**ثb]ٱWf]LUXbf*UٱWeb͊6*͊6*U٩.Wf]vlUXDb]vlUٰbL UٱWf]aCK(vQ]vl 죊+ 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثk{ïQ(˅ueCq#n@"_v GY1mvX;/sˊv#l(v9CW|Uꞧ*Wczu]\ ũvPv;'*f1WcaWS֕]Lcj6jaV9 *KIlR*`\kSLUͰ6|sMCDp6D@/Hs`hr,* \*p4.8\R]kvfn[ʐieUۮ*_Ǡ]P=1V>@l 8McZ'(+,=RZMqT«Ke`WR_lUp\HW)[Ui]LblL*j=WZN*k 7,j\'Xm &5'hf(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]è]+I,{e(nva%0Q'!*1UbŬYIcŰ1+HȨO1CKQr)A+ ;oq?~)o(ޘ7J cd4FxSn4>زBwXq,H4e8R?<z%\PZ"q\rQp5N6!ͷ*7K ĠolDW*i؊b 0nBMc%# W+lo=qj6X3R|vepJ5#bǮ{ţmir:o": k%O5MrhȲTX#떠xi1h+׾EZTfA8nrL[\@Sx{ Q\ En71V&z|[*kQ^bq81Wbe64 Hor"_L0!afm*n;`R:X,Lh}vXcLҀǓl4q6 )̇:MqK+B"'6FȒW]gaz82o}17ŕ-56Mp44'#)PHCMc;&nRV,M:f.L!}d!bBF9R9b˓LҘLg/Ӊ7h ΟF=dYvx1KXcۦEZ;`:mRcLbwSBMkJJ1G\U17–QK0+GTާ,Q PӦDk2)\,%*uic<TM]].li1H/i,jI="TVQ/#TUK?ksKQz"”ݰ>.J97ǘɊˡgx/L!ao&fqQV@I16*ثb͊6*ثb͊6*ثb͊6*v8bc]6vX]]vV*죊(]ͅ]]vl*إٱWf]v^vlPثb͊.b͊6)vlPRUٱWev^(vlRثb͊6*ثbLUx51WevlUٱWf]vlUٰ+b͊6)vl(vl ثb˦*UٱWf]ebefL)vlUXRCWvjeadPPbeY;/"͊6*ثSv]1Wf*ثb®͊51Wf*]51WeSv^vU0+Svj`Wf*UٱWf]]L ]LU٩51Wf*ثSvlUٱWeSvjbLU٩6*UT®͊51Wf*ثSv^*U٩٩51Wf50!T®LU٩51Wf*ثSvU0`Wf]vl*u8؋*bdMS'cEw8; O@Ie-ʞav, EFN]vlU٩*WeS.ٱWf]LUٰS6*UٱCWeaKbe+ 1]6*ث*ثbf]LUXbf8Wf8Wf];(.͊vlUٱWf8Wf]vV*ءGvV*ثaWf]vlUٱWf]vc(͊6vQ]]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcvJ<}aV)23w]\M3Z9w\;=E?Za=icVb7$eG,{7p'Lln%ZmwH׾d7uڍ}*ӹo =p2[((nBS`k]:PrWc2J WvQ]v8IL)v1;I늻SMWcWqZǨv *rtÀvH6F-|P4jغQ= TtM/4=@eUG*K\wcv*VF" ?L˜SOlJQ⭀0#aFH% Gq8Uu)Q~P\G8B0榴h^ƞ* alUt=1WoPpX )np+b9bf*)v:"A/1WbN*0Q]p+PE;aUط' &^W)[ -MU>tL ָUI]8RpCaEh:U2 u~-3-mdI[]\9$i_vbIȰDM,UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]$ZKHGrKt2 nlc+X,f ]\*^'|Xe CK{EW`zS |*)ȁ-bjmY\P$u\Uؓ*|p` G|Qn4Ĥvʷ9WbK&_RW*;3CC]Qv8iKlr(qH eS8DjȰQ#(9SQӨ1X(}!k&c@41rB1qsfcewRs?YdR"+RTNz!I58JtD%S_QϷ,K14{}Lwg")> DEN {ȼkE xBDiZa$p8bNI\v,@8.GP|qnいMKNo, Uغ; qV q>D\ MMjwo \qh>Xcv.8PA0!aj^cz~)v&u> MǶ)v+Rh]%$ "撽6ŋZZ® qVjӮUj1te; RȒĩUv'*-'v\EܝP3qLզ>I|^3Vн4B0;Y"MNY9#JuH'8zLh3?1%֮ %M=OZm86 a6ӴN*(sZ36*UٱWf]vlUٱWf]vlUٱWf]vlUٱWg0%NX]]50+Wfو]v48vV*졅];6)vX]v^*ثSv^*ثb͊/b͊6*إt]6(vlUٱKb͊6*]b͊/vlUٱWf]v]1Wf*L*ٱKbf]51CS*be6vlRءٱWf4®́] ]vlR]]+WCKWcȥ1K]Sv]1Wf㊻.Svjb]6*ث銻51Wf]LU٩51Wfvjbʦ*t]S 50+SvU1WevV*]vlUٱWf]6(vjbL*4`C銻6ӳS50Db͊51Kbf]ٱC]L NL*͊6*bf.LRء٩S 6vU1Wf* ?cQc/לx`^>WU'#nS@njG>~SL JjV[dUhɎAJډ^ރ|K4f퓶V%Zbc޸UظS 0 6{MS+p0"ڧw.K@.eÊvSmJ8M[o늻/R {v"I],*]x˘V(XBH.T \q w0+bxHanr Jw\50K+)`qQl.&v&FI['4+Pw]- ߦ(hQxNX C6(R\UQ[bb Z9ec 5>x*-<)KXv;>)0(v$LYe|Uaփ-P8.V.@4)i≅NE&\.-S)Z..3R↱6lR1)3 Ǡ=qKD_eEpL@Rk-d=r.Pt-bfS xWR`8i A** k<똺x}.6.G5*AodH@/VK KZҴ@I%,9v ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg)}S0%ኻ1K+bf]6*죊]qCWcqWfͅ]LUxb͊.b͊6*]+bf.]6*1We͊6*]v]1Wf*ثb͊6*bʦ*b͊6*ث`Wf—f]6*UٰS51Wf*ثaK"LUٰXRf—f٩b—e+ 6*ٱWf*]\Wc)Ǩ, ء`bv8.)evQC(vlUٱWeb]銻51WeSvjbLU٩]LU٩];50+SvjbfSSӳS ӳS;50+bLYSbvV)f.͊.Xb˦vjbL ®L ®ʦ*L*bLUt]Svl ثS;*Utʦ)vjbLU٩*銻*SvQLh*qCN̝uarTbpʝ$>8;pqq;-׉M$E0m;Ȧ%?lk銻6*UxSvjbLUXb͊51Cb͊+vjb] 6(vlUٱWeaWeb͊+vlUٱWebf]XbeSvlUٱWeb͊6(vU1Web͊6*ثWvV*ثb͊6*ثbͅ]v^vl*v4WeaCb͊+6vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث]WLF` }/o;$QJ"塥BOlX*hrPUb' ׮ Bhi?< 󗗚媖b>%Qҝ3Ot!G|I_6=Hq,*Xtŋ{bD]]:Wc=pPV)$V]A v.jB+@OlUV7+H$!L!y ”Jk\QN TثJ׾PE~Xeۡ?vn@tw{9x}8;rc19%^%o`bѹjm$܊TvG\('g;baU7.| "J@Ei0d]I,t9\%`WcaWcثYvT▲ƴ]XT}8~-Ӯ*qT|D1KU:}VŔPN')@:CJ1KT6B mzbD)JĊ>ثxژUA:b\M1O1UrU{#jZcPzڧpH҇ijizL-TW9.\4Ҕ?Br3$w$ CP$$fsqa j\ nKv#8, K_S qq͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊;WI΃QOO,;GQgŒ츕@gcYkp%vQZزv<;bţ^q\UrqWa$% Z*8 UAJ/Pc5wRҿ +v`~8<)}BqC@{↲˪`9[|,^1p7b*(LPrv'kw0z&A@bE}b#бCኻ0A'zm)אHAN㩭j-V)Z\ hN)4;Uu58C1^bV(hmM녒Cʇ* V?AV1 VZP5ѥ$cH?dU"d͚r[2>f̆-18b7둢3%*c^X-XثCo]WcqWf؃C*pRqWci(gvZu qh튴NXPUkLRڪ4ryJUL>cMS}銺 Oъ̽10~c)innqWs'`U<0a/SZu u5 $퍒O 7JgM 0nrr$60L~,U<\1)[N(v`1K*bD*1T BV*+AM**=b L*лm' )Z|UOb9`UrP P3H t\1 U1`z'lUpX0mpA@Wb,QM%{**fSG1u9-ZK _ӗ,sirHE Ҵf5N0 F(8G~mʧѿk u/ @2nd Xn)__gF*n0JNq%k?{u_+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU{;Hm65eėgtOJ0Dރg9q;*sҹ!Nh##juɉw:GrH~S^@Vi◫nLf*;]۴p+x3oٽlcɻP2>zmC(7jdn$54jugG=@dqw1n쀥؛SCJn ].qWb®V#Sc˯lUjfj|T bOUOlUٚZF:xtɼ.Fo.^{b;*6&)v*"ߕv®8TLRq2j0!ظQ{ Zfw]PV#KY)iaKxr+&@;2OA@7Hv_ ۞ӱE^4rÄ`CT$NY H,]\Ԧ*̽qW\oFq-8AJC۟lRyKOUo4.ǫR,iLk,Gpc2ϭ: VqW L6ɼV ܥ*qHcF4܌ n$mbLW$ZZ3*Z&|6uq&)0?h8\h*F~)ZA+o1Vńt޵8-\ao]++ <Ԯ$ngyo/D#%EPx9F9 /27>2)ر%Is-'6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* Rx.njUteSvlUxt]8vQ](vV*ثC Uxb͊.b͊.٩51Wfv]1Wf**UٱWf]v^vl*َ(v^)vV*UT.˦*vV*U٫iٱZvlUxb͊6)vlUٱWf]vlUٱWe;*t]6*]Wf]vlU٩]]vlPإ٩t]xAبv^vj`*aKb͍UXb]Wf*]]*銻51K˦vjbL*L*0+.٩LU٩51Wf]6*UXSvjbLUٱ;51Wf]SvU1KSCWf®͊6*ثSvlU٩]aWeSv^vlUٰ+S;(͊50]N(;;  e`WN(+qR۳q];51[v_)Zam !% `&$,]2 ݛ6LVݛ ]6/vlUXbʦ(v]1KLU٩6*P죊6*ثaC6*죊51WeaWfvV;6*ثb]LUٱCWf]6*ثvlUGvV*ثb]vlUT];6)v7;6*ثbaWf8UGvVvV;6*ث`We*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*FG}S.볡̻'z o3/L9-l0TʙQ-zCDb zb!*PC$ )f%!qI m֧ O1 B+1 iwh͈d[ѝihżl`H(k6eMC§v< K(vaP(v*†+E=Wf)އuq~(銵Z8>qVxc\R VcP<:䙥RLKǨ Y컜UVk0Z-#'% ;B@_ Kn:US_ AN*cbw0\6oS4"a!}-Y)o PS'ёJ cC%_UWqǪ e*rov`z╅qx]1VZŊL트oSZ#Vm+Ng`^UboPhe9~ 16qVWo8mF\F97-AK KI K /`2i[Y[Byw'03 wM$ș{,##ԯP2adPR}]"e 5H.jcrHۓHdB\ׯw )m.I'ucW !{Q(vX4_vV}ue^.{siO?k*/QXOu=k3JVv\1^jpVYa)Jx-9M1{4 zA^ٗ6Awez_GDnؒ9+o@5fQ_=+5R$Ƴ/g3bQ۩eibGWTX1׮r.]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWe΁G# ~v ;Gvv ^›ֹ̀vi~A (4<~aH\94޽|2I) $JFb$G'CB0kR@6]pAb[˯{ ]ABT\矘USfP=cZ\/vnbƜi"?_(G˭sM| tqH+J8"ٻ\*+]TԌ ]V,QNb̛l{KS i<{b T9ou3x;(1]vf`qWfkb8oY`]\;G?lq4+µ"4{b/\ āAdfdAZ9:~U 3,d0PkO *Ki߮(`Bk(bc]v_Ux]IJc+5#"8ٗ=p"Ovšv8-6`Cxp69UE])%F+N9e̎|Fز v(ƕ^-8qWS,[_,Jb*7AW h'N Uh{PM[qy  | Ϳ,Ҹ&5)BwEV1iy NNI{Tv)js /4(jOtJG8SmYo=ĿVi"DӨv=yyZ@Oު֤(?ofAN龇 StfݦXb͊6*ثb͊6*ثb͊6*ثb͊6*ثbOr )v<`K銻51K]L vjaWcHƜUӊqWeb1CC*ثb]6)vjb]vlUٱKbLv^)vl*]vl bLU٩6*j —f(vjbf(v]1K.P.L ®́LR]LUXU٩]LUT]LU٩51Wf#vjb6˦)vlU٩LRLUxS51Wf*ͅ]S6vlUٰ+*A'b2,ݎ;51Wf*®LU٩6*bLU٩51Wf˦*]ٱWf(vjbʦ*]SvjbLU٩]ٱWf*]F*b͊6vjb͊51WeSvjbf(vjbLU٩*٩6*beKٰ+SvV(vl*٩.ٱWf]LUٱWf*UDaWf;+vl)vlm]ܞ(IAvX;SdxakdFrśph%șNJ3\Z01hQ-\Z7߼o-Y<{0hە=OL hbLz `(jF:r\F"ҧzTN8#zdJ?vre}Pz1*@m3WjHOmPyMNX_TR-dj :֘X;Z_׊.bfUaWbׅX KDcUmbqЯA3W Uv5t1Kצ*s^$l0[8)qJHUTb,k ؝|z1;q V]aCGaZ2yx .\\ғ"b,|1WSw 0]uZ(G(zbu*rש]\QP(q튴N4&*c]urR|U1U32'Wc[ǑZ~ hu|0XZR|qV =ONHa4i犸amW Mn"!曈=yS̳NE Wkf}R|⅋~Ӎ}}B,“ Pq']}9Olh (1MĽ| 7yơ$rUwrO4eG-$|ؒXHYc90ߥvOPk \. [ĪXM\)oll h6,JIǨ'.bxY;/v:*첸2*m1Wet]Fu1Eue1cMS3IVLSN>1_8S@N(lLMS텓F \XkCZ|UaBj{b˔Q |R(*)%qqWmƽ_%il6%Nd-ڻZ9T1UB(PP|cXk@Q):Xq8|[1廁=2/0YCTpthqNⱰjeF7Qy4{b v -,-ћ]=)LpCݣ=)na'bYs)vU1CSvU1Wf͊]]vb0+٩+vlUGvV;+vlUٱWeb͊+vlUٰ+b͊qKbeUXb\UXbf.͊+;6*ثb®͊+v7vQ͊(Cb͊6v7 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*2Od ;Gc>gHӋD0'l`v"ZFVY+zs_ڔ["[qDnT ;ԴO&O_ӈ*BG02qlT#՗]z‴TJ R6oGPZ6~ԣ{)Sz2h~(ʍDr*S3I#J *GJtcvIyx2&ѕbenTei7#LUאU  N*Z>-,U.@Ӿ6XO.(Ez Ppe;إ7L7}dRv”7=3UeTӊXYFb ‡ *:[8~"Š+ZUwW Pv9W}U( 8-(CAߠ.`FFv8ncou®0#(+\zִ#|U45GaJsCA>1R?cCPnp!u2]\k1znMZ/aL7 /Ӯ)JIxYp WQROz~95 M$!H<ŮGcT"׹FOF٬!֎>%l%;}b[+@'k"oG\$s+=lm?!91\NRcS4.A/]MAX7s@rıG@۰# pTu$G$"q'BV[[S<5G;q27f4zٹӎz]KLn $Oa޽l%ƃ8sU5#thؔ+!e%Aˠ \EGPpPw28+O<5HP)]ڣmk @t ?)=ǧehLDbe8ol>^4DY$d_mExL$ғNMZm ۱0&N LUٙ*\*[5]+PPblR8LUԯ[UǴvWNu2${bӮ8p0Q**;`a#,mI^e5N”۷2AژyHn:5\PŋUR !rN-m8pZ-ySJ@w—f7]v7*죊-O 6 PLŒhh@*01.ǩ:ՁZǒ=!ytWaPq's)պY;P8i-m[ag`@jXNb/ ZM`|Uآ=jqbdKx -_Ր(.;tP$fW"EI!@^D'0!5yk3 s5N$'8j|tͺH3d%EwikJxbԉɺY+d³[)kAOl3Sl#cHwC˰zd>Le0I=?g15LOr-Av<6*ثb͊6*ثb͊6*ثb͊6*ثb͊?03}Sv8 v()v]1We.U٩]c*iUG]b͊]1Wf.ͅ]](vlRثb]/vjbLU٩.‡fv]1Wf)vjbLUـ]LUٱWf*U٩6*ثSvjbLU٩]LUٱC`Wf®͊]vlUٱWf]Zv]qCbeaKbfJRثb͊6*ثb͊6*]LUٱWf]p+dbʸvn8ӲZvn8㊻7V;51WfӲiti٩Ӳ7RLU٩)T4i٩.L N# ]f+Nv]1Wf*˦vU0S)٩52L٩LU٩*R]LU٩51Wf*LU٩]LP]Svjb㊻51WfLR];6*f(vQ—ebrT`dvOh[]R2BN1 v/hw)W8FmDqݓ0ڀ|m|MOvq1]Iv;ߧ߅N˒D~񂎻튈r;3 NB>^=,\n}.UZ͎=IvG{2_\T%H^ٔP}SXptn N4N.#NIPiO@,Ew>BTf%g (*A4lXϱ4Tf&د- 6cF@LSpjS9b,n |su|B7QÙ4z7!^]\]Z1Wcw]$|UؠmTv/#@E)9r!v\11WcM)v40]F█",r(V*s9{SMiUSw 5|+c=2zb+7Z~IZ錖Uu \,!9*$Ot  U*sҝqKp+W[Rb\t]8*.qV{`VjMO *AOcp!pv QZYJn򤌫Qw8VB͆\g*LP.ث7oPc**E4Ȫjd_h v.Qd~=)V%M4H9R;RM/C]Rgf +G}%w)re\;5d bwy Fr5ھt`;o\5.Zkx}8cN8Ic6nIbJ:GaA]dY zalB6'rXH"?%Sp1XↃf dq>%ٻ/!fCF 3jqdF]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWaǔо^_> F= ?@Ei87/;vH kĂկj 20*L#vw.}ޟpc/.@n:lHÇ*)eڸ& Mi1; ! 8RWgiK۾%=d#) T1a& SVRK44CJI٫8=QzO {\9;DZdط.caNĞh+L!0 v&aWe*qövd;]E5vFQ↳o U*6a!rH7lVg@w g/^vX| u0EG-`i4lcRpÒ<03V(IT^tbٯєN%ƝqWh_mbhdXc$ixqȡ.ͷ|)vm]w;bƚ®*Ԯ,Tt]@by 'e9i< (i]eW,,0L@^lV@@8Y)H啖R ]Ԍܰ{3$@Zkqq\<OaPB6N9,,Ij~&=s#= ʒ2,o">m-!SOqؤa ]ދ' I)^[}ةLof G ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]]1Wf—eUxG;qWcN(v0WcNv76v^*aCWf]xt]b͊6*v*ثb.͊6(vlUxٰ+aWe50SvlUt.LP.LU٩/f]vb1Wf]51WevU1We͊+ ]LU٩6(vlUـ.LUٱWfLU٩.]51Wf*]S50!٩.ڻ+ +cjr vEŰ;F e;QNޞ+NM;7i^(fZvWӲ,Viٽ<+NfOfWfM;+iٽ ݒ+M =I,K"/e73.nHQp'b A&xevDu/̅Zr(3a ?Q{/ydGRޠsҔ,x#wt(aq9+/IeKN ӱ1#—eE]voOv5]R)E0Rӱ0R)ٸcHe2 "ݒ=/wʂ^<45 G8u>2mB;ll^nx b7>J6<1䭝9CN=7i1vOrĩ9n#vjbʦ;+*]LUDbLUXS;*U٩(UT]GvjaWe`Wf#;*U٩]L*U٩]]vQS;6*bLUٱWeSvjbʦ*bLU٩WeUG +vQ͊(Wf͊6*UXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*h b/] *6P\ǁQ^mV[Di"xq)[QJVOUlPGWzp@9KU1Q@G÷_o޾)@ R0ZG^@H>"oPCM cB>Dy ĝpޘ'nPVS桨q~-EE@Tp*ov4Gt[ &'Q{q=4S"'2to+lm1ԫ\P}1Wcz\*TH®IJkL hRUەk3/b("UWsJcXّA t(yb ; Xċ R=U={bm GLUxlKu4W wbUզ%4ӍzlҒw`BbU1Cy, EV\R*jbhE:xRD UjKVCb@8@-eZ9~JFg?`nCc^e!"b7bqJ҃>UKC1"|0!pV5AZNbyU)vʧ.nF ~$Prq޿,W?FƧld飌c1.h jv2^F@AiVahp|wo MANn"0B"X7*kӭkġYBg[ 5}A !=~RYڿW٪w_k#Ҹh5m72Z!uiX c8 5h2BkF3;ܜfT8Fks)Ϳ^m^7/0f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWa:u?15_Aqu?Avv tzg!16X\reN +%]lr/Ƶo>gH4a+ZQF~ yMKx$dni]>/md:[(\ѕ ׸Bz FDY,aEV*U|ȐU F6|Pb6FӽPrh)]ќ^ !z 7 3BJMījޟcdAy8E<Թ v"f#&c2{Q}=rF;|-+<{A6O[h+~ ?_\Ʉ([')TFTn|[>En"fQ퀦6ù9YoV<3lUx›UU=@svXlӉ+<=V_z; &=c ŒٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU 81K]vlUٰc/ 1]8v4ƜUӁ]v^(vjbeLU`b́. /vlUٰ+S 51We͊.SvlUt.͊/vjb˦*ثb͊6* ثSv]1KWeWfvjaWf*]ٱWevU1Wf*.LP]٩٩SKS51Wf6fFLYS9% Jo\i$SJxbaCSvj`KSvjbf(f+NLU٩]b b24k0%~*Ov_+f):voOSx;7i^+Nޞ+NE;7Ӳs7 (JސvW'eq]LP죊50SvU1WfvU1WeSvn8\pSvU1Weq+vWUTʦvjbLUXvU1Wf*bLUT]PbLU٩*Sv]1Wf㊻7U٩F*i]qWcpbͅ]vlUX٩+ 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbbΈz0Q P~ēcH*m Ǐ~8R+t­t>61>ت1lc(@ ;K\qPqW\c&yh銻 lL/\d#{(K/L,+|,aң~9[qV XXcYѮXkYGꪫ˩F-nFpy*j:b[dqqZ6ϲdY" )|#8% ecF?<9a%2!N?l6{(S38$890ZVBV?qH 2'xNZl<6lr=_&`܏LR>]q* 4N@5ߦ0QO%)Lb|<V$or0&[sqvx֮XM>/z}>T7JPҥP!^BǘL.lrU-rqnlՇ)MxLc>¹z-n )v*]@u]]LrH 2v8lU#A m!v-} 7; i5ڸo-v;_퀱!FHOb&ѕ ҧ mpzUTޔ [a/e/,UE^^5渫]S\ eb]߶*Tb튻/q]#\UٸPWev_p+7WY+j({Ke j8Sp8$حvOw+)|[uN2WS¡+L$nE)AZ@D;,\iȡݛ9t+pQP:fy /X~9W? jЂ:Sb]t!jzv w_?A-#lˇ`y]n!7l2b$Q.递) ㅳJ_0';m$jRNrlݧںz-h-ԧ0bk0[6Qw5~dD#.xȫS櫝^& #9.͊6*ثb͊6*ثb͊6*ثb͊6*ثb0ȶ>. UxٱWf*1C.pv&qWcN*i]]]LUٱWef]L ®L bͅ]t]S.Sv]1Wf]銻6vjaWevj`We51Wf)v]1Wf*bf*]SvjbLR]銻7 p٩51Wf*v]0٩51Wf)vU0"*&U؀>$MgL&⻗cbqWq ;LUٸLU٩*SvjbLUآ 1 ltcl 0%vjbf]]Wf6eS *U٩51Kbf]vlUXb͊]F)vjbf(vWU٨1WePbʠ]vn8LU٩51Wf.vQ\UEp\qWf*qWf㊻7U|p!T®ʦ*8SvlU٩7U٩51Wf㊻7U\qWf㊻7Uٸf]*p+vQ\P]|axE~ǜ.6+a֟Zxl%\ kpL|ENFڮݑs1Y1ٛJg;m7gϥ{ Mw5b"(=4 (;3vXEL:v( " -b:] vcL*in &a!C%’44 r|@Ҵ ۮ4|1c}:aM~حҧW5)1We+v1.0RoLҼMrM9a)lE*4\x$CP1 a}b"NY:=./Bvn߮`d =8 ԽuƘ;ž'`Iwrf Ja٩LUDbʦ*bLUT‡eSvn8eSvU1Wf(vQ(UT‡f*bʦ(vjbʦ*]*SvU1CSv_Uห \8DbcH aƜ* *죁] (͊vlUG+ 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb8K22龰1f4%2*Fÿ|a^$ R\KD-jT[`Zoڽdm++C2bH$vↁxv&PGAUہh@J'؎ҹRzÐWM~i[qgSЏ\H4""VקFc3 O \;qd&֛ 'hjnoj j;W1܃7VɈ5tIyjw]zv®(ؚU1Wc–CQ^=kzaK>I OLUwƁ]jO\ akj{Y%h*= #hxjc6S\aUy6W]3+ŁDFG5 򩊻E0*RWkXaVxb̪z~UqZ4\,VՍw銸Rp*ӕժ@eVOLDqW{e7#[1SnI)*I$Bg#v=\vÛqsA_ >0tvo @pcNZ[h)s@M[f7fJ+P|fbj~XaB W?V >"y`d`ylp$V0SHX-ݏ r%IYup8~`-wV>" 1,GU]MB]*:npI%_`-Òb(CA>8ykjpp:ք,Ju*Pcm|-J)ʟmW n'hIRh9tE&(0I͛e,`lZvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]KH+XbDK#!P}yc" gvڳ@:Yvq$42ȯĹoY i'g4JP?kS|#v:#)4r 7,kؚCN+~FJ/.U|2E#txjx Sߧlv=*3 4HDICS2c+;ra,eA,CBH\ba u[I*2034F.97e-;V !~%4,:Pfn/.볲S]s\CFQβ2!-DhrسSG Xؤ]~#*YAk4n7v=OLV\ zK!]Tl[jr A.ĥfQAF( .jv&H v<-bnF#f1%b:gDJJ/5"|NlG;k5 JMqSc)&"QA^|3e%HfAfj[33 nHGj7ip5eQs# E c]3mzƫ&ts |=´3 U3.K1g^TBWOl^~JyHm)cbCqZ\tEr(QcDއ0 +&wqЊjq=H~`t'^oK>d})<9b͊6*ثb͊6*ثb͊6*ثb͊6*ث>ENlRp]ٱWW.L usÊF*n*i]8 p]vjb]٩]50%t]v]1Wf*bf(v]1KSv]1WeSv]1WevlUtLR]vjb˦*qWf*bf;50S..٩50Svjb˦*`Wf*b˦6vjbf)vjbƻ8K~R v b1bi;/zZvbM$;43϶* ;FE;Lt]SvjaKSv=r*`v -njU`Wf.͊5*beSvl*UXS6(vl,;6+nvjbv^VVݕ6+nʦ+nLUT›vlR]vlU٩1]vjLP죊*ݚnʦfœb͊*VݛvV*ثbLUXٱKbٱWf*UٱWf]v^*] UtH":V`9tOPǷa/gϨ2q5kuNq@rvAvEx֔iOS]9l.G'_K!v,ۓ@Pm+.*a@;T3v* b1`E0^0iB@::D-SJඹd-q}ӿݒk/u4Wn`rJ H"it-<فUN^8\Yj.JW"B)qɿM$l^ܟ Y#@pi8io,f"%LY cUY%Z?H\ܲ2+'wÅyNŸ Ifᩒ!u[~  JڢB}j jJ6M*\ol20jïKZL6c$43"^5$Gο _<F@Uηf@9tFc"LIOM .VLHv4R]_.jR4]CiXvK&n3b`]mbCnIqT>9_'ȵٕ$.lwv kvjb㆓Nʦ4J6Hv gd Y;0-۱L vQ]LUT‡f*]LPb®͊+]qWeS;6(vVvlUXC]*UٱWeSvlUT˦*1W0XbS 8bavQ]]]vV(vlUٱWe`Weʦ**ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*U?DOj9zO;%Jc=ح)Rv\6- * <ȴpS)6 _nBbõҸ :bET  mB ccnmjڃ`1ܽF  9IAJM N?*5x] ZE0Tjɨ"PB_ l 4_E N[kBvWBhhĕ*  qRN Mwqylk!M-c_ҙ2ث|Ua5® Cv=c1Wjf]I-i)v8G%,*S]LVEw!k C,k#[ÿgYFŁc1(;#b l6_#ڽLj8:($ |vX뱮q5VYOqEG/UVS*8Vk7⭌zp*ӎgF*3].jS / cLa48 a ["ά:Slbdb 8D 86p}2Swt.X,J%QS"i!W$zǣ+;U!{(ng}6#H] QR,#-d;ր;]ͅܐc689_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]#VYdnhC_tuطvO@*>~t[;bH\ƚg{xZT q|;Zg! ?!b4,kϱd$^W pISPjC%nDmQ~V9Ve"48P]҃l9^'*wP4SݙwIy׭6)|3h[l~uq ^Uv7;0銺Z92~U|1VBmp e 7[A(F@b\iqf!6k,z~ڮeaclTLe*Y#:/ENa1WeRpe*pSvQ#;8v4Ɯ U]®LUxٱKWf]LU٩]51Wf*bevjb˦*]٩/.UٱWf.́]va]6+N͊]*]bv:.fō;51M;1 uiA8i!ٱCaKS51WeeSӰ%!^BNȠŬb@; Y[x]J \KOqn+L Iv\R{b& C  صӲ+Wf]*z ``;F6.t]LPbL)vj`Wf*8aWff8UXxvVfVf8i]\ii٫\)fHvmCTbfvlRث+cL]pv`p 1CӲHͅ.vU1K`b]L(ٱdbLU٩6*]LUٱWf].ٶNSf—f́.`K};ɐjGCikoxfRy,x e$R(&*ǚO֞ eɹ&DŅ>A_!nV<^{-V\PӇ/!۲0ɹ@0"Vo(`WcȦݏW(2F(۲Ek+Q>7W<ðV[\ۮ9 jDطhlv8.Wca[v8%p+Uzu.: ]s=FQ\X{XU'|pjNv^x\U8l*quJu銬=H?,R㏨­ev4UJ7Weu[W⮦R=Ze]ثʞ3nL`WSi+Fn9o+aFu2]ƣqD[aXƘwaJlc) bzD؍mCfDbC"-dhO7|YyڽGkk[)<*~*1DEac.LJGoE8Z۹98NIS՟1Z.P], kJM:-VDeHy*T|'~ۡ܌ܪpo o4.hf8\1v *O|6MlZBB]ٕ(JCܑ0oZ=T;Žeb1&48b]\P\q:0$mW,=`̊(h+qG6܂NRzbh ҸRw ƸR▤,9 dόjPȴ)JE$Ma VH DDԡ0 \R=7]PmZ8 KG7bB U>4\3,T;Yኻ2 k/p|Fq?~9cߐ?Cڝ"mbSoKc*Kc268RJ U[ RVMlǨŪEy}JwhW%lR;㢉|4iC:m'e贝:[[oU>٩e#fFnpG6=t 0٭rv3KOW TQZ@>FL[1O,{DŽ/f0ppxvo,{xBvo',{DŽ/f0ppxvZH+E4+gdDcK &l^!لK?Lr;!tQvLKT 6Kw٤9vsI$.ŘN z)޸RzH`;D9*lbzdC^:bzqU-wm%`"u@#t^#<  pjoSunkÅ )2%b۷VLPM Мx/Z)(Mkjʁ c|[ v€:w`*MH4r5c2̫ef-,nExzz{?^Z < KSv<|9[k@Pޙ 01`c&+%ؠc FDIM]{LEGO|t(;^!|-lS^#6v=FImؠ۱bbN2WvAD*픈d2vmvlUT®LUTʦ*b#vU1Webe+vl(vV*b# +;6*ٱWeS;6*b®];6*ثVZqWeUUa]qWeb®qWeb͊+;6*Pث*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU+MpOlf q} GGerS-WdOw鱯'0]Y!:T+-A+JbpEUE@=I%[;1Υ7OŰBxWj?g\i.*FIRnZRεN,iV9RZ q^8S֞8\v XCj@ P\O}o\ZE*>~ز3,7 oTvaZte4FeEpqDY/$sG$(QÊ:S;Sa]veREOoU  ˦)jHlU`*H?,UB>Gk'lUW$U&i$Wl){:!7Wjöaq"!乢R0"3,.]ϋbe x+ } _5̅?,ybQ#T|Uؠ]VEZv()[0c\U]LZW*ԌUzbZbڸr=F;lUqVR6lUbm*ቖlUhإa;FV0B܁O;>.ҼexMV=sSQ%4Q8sjKP@{tB֧1 'rK#%j\H,eE͈$ ]cjzj(r݆G.eɑC@@rnGmViH? A@I?j<:VoxqɅD@6 as6=+ [M# Pe EŶsw$z3hZ̔~vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcvv!ig>=Q\d[;:]t"64ht3+d4}z/SJopPSD$9۰G!9deEXBM#N? ևsֹ%ЖȔ \QF ` S0Kq\I͜oc8W+@ҪNq3QN.Y+nr\hƑVV~QkXWJ4R1kVwsPi2m홒"y֑KNy՚9nN`O'DK4]Qw2P [ҧA5nP]\s+~rtWzWy~0(OoeʅTh(:0W)OdCH(7sr,SpHvg!*ssWb+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]p39|%|Wf۲bw,Vݛ+n۳rm٫-Um٫۲[vlSn͊,bˮ(f)vX]. Vݗ\VݛeM5pW۲Weث[vlSn˩m٪q[v^+n͊۲[vlSnƙqdlmWfio)جq;Y`j*:b٫d`Wfad"KqbŒ \v,S bbWOٛM*6>"ZQ'`)mJS%n 0]@!S$5=-D۱  t`;6 lv.t8؅a-zbv/SP X۱+6itŗ.nJVݕ|m.s]Ƹ؛R@1F녧vG#2Ԋ`m&ݗ\ -٫۲-Um٫۲`Mx 0~vWxݛŽ'ez71^'c}\mxݔe'c}\mx 88mNKv0mmN\䘒O f]6*U٫5qWf*]Wvj\U٫5qWf*]Wvj\Uxb\U٫5qWf]W5qC.́]vlVݛlmmuݕ\VݛvlVݗ\Vݚ Vݒ_+"ĵ k9`x((ipƐcD_Dyύ{[["V."h/O?C1cS6B쮸U\ v.L.I+bHXuynCƿ4hQmhJZ|iV?H2\.&mJk| |+\9AjS|4ddFf$Suߗ\X|q큹WŚOkJn\abmSfiBchSoS hXIؐ Lm5剱C1 ULǎW*R 5qJ{@qeV@dZu%`½r$7V݈@GaE|u 09[/B&Q_5k\Osb*hp<~ p9'e5طꊎYٍh\:5!N"B &qy k_\4:xrvk?}D 97Oػ S6¶챁!u®Ep2ĤN7 \|RbU1WW(UXGvQqWeUDbʦ*Pb#vlUDaC]];+vQSvU1CbZ9WeWSp+p](Web8b8ٱWf]vlUGvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r#)ɵْ`+f1Q|QNR ۸e3.i$6dGQFP1 >8$HJL*;BGH's^$R5]M ub1:+*Ш˭Ks  x lQxCֽ+OJ F) *yV֛ZMvGCqжw\ 8M {ЏU*yfI PuHqUiL3ӨƐmAG B߿!ZW~ ^k嶓 B{mC͞ym~\_EC aA#S2]bZCt®UGO׊7v)Z8#*bQM+]PkbS2@-6ݒt$d$,9:bD( ɼ= ZHP˷c_1`-5(x^_[3E  1&kVUا |U|OlUŖ: WSA\*;v4 ]v.džoiZx{n'*e銺Q]Lg(UƳGn&w]Lejw]\ULRr-Wb>bPDAFZONKFU9.N')*Oum>[,]OSfޮ1b7Yv*i׵p["jA#0=v`+(k+:|n'taNr@]iF w>;>YZ+c߃*Ĕ$.ة>҇}+6Z߽qVJiOP4bP¿l n{ߏ_PրAMM?g$lOZvVwؚo[8bRzxgUy7¤z↩O̒W)(U_f(*tŕ\u2Ihx"mZ1:൶w-cCFH_m:hA.t;en$8YN$ dG7b?XQJ?vJ "vO|Ob;^%ӳ#;+ő2QKiv عA$bSs_/y% ؄\Q\ `!i?e~_& m~ (\dsKmOZ;Pつz|qkBBYOŨ|;UE#OlD-,v.ݼN)\ W& 0+tlj1ZZFXo ]$ Y+u1 U,tQpNJIFؤ!nH7^[MJŤ(r6q1}CNВ)s7fc,Cmi9i% lZs'J  tjdM҄.XdFE.̬W"Bջ4ǐ|RCWlukX:~!a(r'*IȖAlx; f9n1We]Őv5,ð,LYpv!E;51We]W;(uqqWW(nTQLU٩]F;*7*8LU٩WW51WW*LPjT]\lUXWeUÊcN*4UGv4f]]+vlUXٱWf]v7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcvL +v|Aa_ciAƟGS hۂ>&QJ\H Ѓ]U0]b*YZ`Қ@߰vt j22) Bj:P$* w xHI Ѐ R6oifXڠT\S# jlW3P;l=)QeD'S5e-h#~{b/I*ezRn"K|+ZMr%(1()4YӞMf*քu~u'32eVQU[n5u"ևDc+\'b9Su—cЏ*+Ѝ|PZUޝ1We,lFSێR®8呆p1M4qc 1cNĜD8e.)icjv.HBqAqSq`öʔ=\vnJ Sh =4D$^>vހS[)5#샘@z MLmS5űW]K@F)kFH"1V1bAZ8S_bk Sኸ1ccqRa'#1b8ZͿ-ž-Prw8N2Vj] $Iǐ4l0%+rP1Q16œbTNh`WZ W M۫!%9ѼdVQ5iu::}mKǑΓk j\Mm [\^i{cXs:ݠ˵n]co19vl_KT%~#Ոܟ8͘* Gj{boF5"+j\Ł ]K]B(Sa[Ǔ歩rxwP54xxb;T،F^q2z56&z:qV]2I#v';.\HV~y54Q$Zx.~ntG4ux/]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg͊];6)v^(vlUٱKWf]vlUٱWeUxb͊/vlUٱWef]6*UٱWe͊,b͊.Wf],aWf.]`iڭNضbAjp+B1dzab] v#fmJR;2ؗb4Dpێu-a|7()QZZAON>1OzP@i|)ؒYLsG"-)I##-U6n`=Oș8iAv :U5!~TcOCL/b3i{*xIZap~iܩmb 0ۦ-r&wIn*@뀚hɢ \wv[*A qJXz&H@;:7bv;W`x9RpN|UEPfaPn|װ`~h)mTљO?u}'\MYe|L/HxE Gq ؠrk|(^ʕ<)g|SM3d\Y78qKv9\ i )Ƹ ^ [LaJRG\۶*\L)'7>lCUKv bdӮDJy A?9^hҘPLw062,ة9v=@j ݈PDdE&X=hۯA=N> l<ðv}jc )q4x%N4bo"l=MMb챋'f8b3(#a؜"56 낙SXC"-+(vQ8(qCt\Uʮ*쪌*qCW+u3W +vUqCT͊X\vl*]vUqWf]pӁ[qWcN*n*PUXUXَ*UٰvlUUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcRi(LjӳJiHV%ЮKrma8a PzplIp0#N lNI<>XJF(ynAwڸ;,݈+1KX%y+. c szd<1#:T$)ZN'w\J_׋I#5H5W0*ТtˌC1W]jv;w=]P:ۇ i㍡Oj◖-CP w2ג"@'9~bs0778$,<^lGO`3X㷘Utv-S|UتpDbZP:VoOs+l*d9ױ[cYN>CC<ӈz\va99Em0J#ykDcWv,^Uج`튴qe«NnX=:WfQ] M[n]qK2lUƱ'*1vlUd1Wf4vm*vPv=IqWz*>\UYSAZ'[ۗ)%~SѿHL"1>]FNvZ,Br>XV33PWA-(D3JI.A,Lֽ1p@ #IOj\w'2!jvT:mS5,cH?~Gb%y`+^ڜ7"( $jjZWS|qB~6qBncwdQP{idqzP ڧaMjv̝v1h Z  T.4$e{|@%@IIfڇͅ m g j )k$ZשR#$`sƹʿ3Q4q~m/?ڲG>6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b9Aǹ:_Z=em?rfd4uAO.Vr@ۮH_(q(8RBN*nvl(v~9.LyܗWzrSBz wg8v Rc`XɉQ?(bƴNCޕewdP `GzbR ZM2*1xڡڛ4QZc8D ;#A#; )\)d*Tz rN5&;gGr£}>Tr?S5~4wS]!Jm`V®ŷ ]ƃō:E=!i 86-J7!e&57=1M,/:oBHxo]P0x*Bdya,`RtߧPk8fO5,Zխף-X)Clei͍ !i à9ȭԄ,1xCN]7.8-UJVxjD=qW@|U|v>wiIv5*ӏPp1+iW끁kX-WFwbHSӧ)TDž^C9k't'm1N qЪֽFv};HyE$uR<3y)s70F7փ!>:t#UuTv_7ؐ+c@TL8^]KqJF&lh`7 e-38k«LɌx&IH\&M, ֙2zb/8 lv4~ZсIZP]5qWfvlU٫]U٫.WvUqWe5qWf*]\UX٫\ ®́] .]٫]]\*]C6)vj].XKb\U٫W6*ثbQ5qWf(v]qKWvUqCb͊]vlPb]6*ثzeܸ~ϖλU;&}ġj{fs͔vZYT%ɑ~ZLui25 goO~{PNY9wǪfDQ@eɫ7KA ]۠\J7D5,{gIב]R~\y0TA #>&E97H%_)[Ap5(|?  1Ss(D 'ҪbLF) Loߋ:n8ʗcy`WS1jC,qdbcLZn~ST|+N8p:bzM* Y+\4c%$uh@zKeƙ%Ey&Kdxٲv,ce)Ȕ P2\PN`Gg];:"*75#w6 m7s_ٲdhqƋ6.T.f8[)Fس#P;S"[v;vW۳sx++n1E+¶xsWer]vW, ܱCb]*ܱWervnXb]+(vnXU\Wf(vQ8'vUqC*UGvlPn*ث+vl*ثXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*0%g298qdΙMA>ٮ!%qJ? rFA_ -dA<3Mx>;tƒ4 )C-cmMpM`@ljJx=hTL%W q׋6榠RR ȼ~ҡS JTˀƻST A7JRMxdmVZcʳ0#?$ ڹ`!Pjk|kE4I\]Ѧ G~@4?vv"UxP5(O Ei&u,Lw`F\iebkq(H"3]9 c1Wbv]MWb[ZqSpF)v9' I~Bj;bAݫZKl/J]TWl*k 8Pc|**]lUqa늵U*`^p+t(>*rR+—bLWO_UQʍp+3w\U1VqnlU(G*o-sث#lU;rc. 6&=hJVj$HJ{8r?ۑ1jN, r1ǫ.ȎZ3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~Wlo6,vh4oԴ!jFt9To֑H@U75?D qd@QjIaRv5Dp@2QҴTwo\@pM1^U?8…O47>nv=EaIV(kҧpZo\j`Koc;ӰM璑 udܑƄ&"MY@" TWUzxX4bhXi]nkG`+sFHrW-F^V0XP鉐%\ pJkɑ}%QDlB\K4֫u@E| ;S"l!~5Ƨ#cݫ:\ W/1id$R]:9xQ>[dۑn̓2B‡cq!THmK So#ߡ _wk剟GcVZCQ*NƝcEPƝǍ<1X~0䬤6ѺKnËv;)ܜA6OLo;lԷ12+"Mn:`+cD;,2Q kCP=n*ثb͊6*ثb͊6*ثb͊6*ثb͊?02}S6*챁]vlUٰb͊6*UٱKb]vjˮ*ٰһ.һ64ͅ]xWvl*.ˮ+N\U٫6*ʑ;,˱tEㅋm5qWe*쾸۲")%,Nًѧ?6{\ˢ@r #-FHIqO[{Y)$t1{+ leRsv+8P;#)MKH1 .'$G6TyY2l> aDEBnCsy/֓\ س"PI3 e#N.1qݓN+q&HW'կin Xޠj;~1ZR6Bz\*R{ Oȇ r[X-D,TIڃnmlxŠƔ% K2Ȇ;O9䴑Xsn[)TU7?,JZ6;mᄄk-` )SQhGjvHR{ԑڙmʔHoKv!`¼jqpv;m!IyfONؠ=@`C2ܧ vGӓ] _6W ToCwx҅M}ƧJh=LQq6Q6q7 DcMDž&9Z>ĚAlGarGnJjGrz U.3Q’Ƙ=i\1;yޘجMB8ݵJĂ+qLjR[yk$5e"sI% W_ trDy_ޢ`Ԓ̞!/ߜ2q-F*)lR*N*-cӮ*8-EqC@ hG-트#\U(zAZˏ ΤbL B…%ؚt.\L(qJNJc[*Sw{b`d`/_c%ka[N94ʙ&|Sk^5N\1'FD˝>_GnjN`f~:QkyX}Fmχ2neni>q@)֝wZ ȔIL?Euur w5p C\%/T*TJ`ihǿ+l:%R8⩦煰PUK|]Cw*j-yLGo]MAv8E6 $|BjRFD2ܖ'kڸopr* (Fn?A=GOZtʉMUˇ#n‚M|hL6]ߨN&yiC\qR5D7ƢdpWq礁ɳvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]EU٩]6*ثaWfxb͊6*)vl UٱWf]Wf]v^*ثWf]6*] UٱWeebWf!؜bbh1Wbc Yvl rCbe ,-pPWt6 J(4tK3_JU8ДLoN"*z@w>& 7GeCX& vi(@]s~m4NKej8=)2Z1y)zdNC)|agJYL48.\ZNzCMuuokWdzJD`#žRr]3u9*qe2yb%0efr q| تċ~]0nvX@z0.b`uނb$S_Pd[&q0][^njWE)'dLͧԑf4~N*d /GR ^?N^Or)pJ-0-{JGA\6?&O/SL'aiq)8XBu녮bqbW 6*ثbf.͊6*ثb͊6*ثb͊6*ثb͊6*bLU٩6*UٱWf]vlUٱWf]/vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vj\UٱWf]vj͊5qWf]vlUXWfzb 1sv% ݝ6*6 d^$݇+u.8y4;6u_s`r˄r'3A:~gֵ{srj`;>#i*2@sv,6\mT.r@!.y~mZ-4Ӓty_,eԯ)V=Vl-t(Ϧ9;us֞|HG1:Cp)ƄПv/u1z˃INt+T: VNN텬/G֤|dtYa(mUTb,+&bŕ\BD7qfblb*1WeL]LثyGp;+)vP8Uj`bCTzk!` Y X`0GF\~#"C5]?B 4YΗ3z!繦Wa0V5ͱI@ S~.rL.Œ aȔ):"RT vJo!4\'vWNՊ,yuk[&_pMuo+גjmr- %ӗC̈́OA@Z ="JPz!U&W=)f67oh?ȯJzq~?I2F7hƕ#Oڏ\Pr wWcZ*Dl b5;=iPf;?VjX Tj҄wRr漈ڞ# ~j{@<}"S1Ɛ~*xH?5?,LJGPK =ȍFCn mF[@j)dEjV(G&a,j>Zw??*kZ~=,["AzT\JICF^6J"8GX*z'a0<ԕ*w2[DkzF0Bh)^! J%AF^4C\ժ`Gc\"Jv|ѥ]V*Rkt4?Pr*m3h v5F2v,ALR]v,Z (aܥ5qRԩLU[8\F;*\Ew^V&wNŢM1 % i|躅ɼ!Za<,cÔ{Meb)@L w8]A)oi'8UmqtR0*r;bBL1؊Uو=<1VcaL bJb@-\@=PB]jw) Ȅƿ1 EHolinC~8wL(>UjH"< w u4땖%k7~'r(vF1xz}V*Sb{O-wӨy-jTRF&J֟g۶c1'=}~ 3T.A5i  0C_IQQ\n6P1KFb|={7cS#67e"{ERؒ=*:|S2-XաLR)¿ۊ[ {OqbH!EOBOŲ!} ׊?UMv?pܚ(a1~!eæyS[U*+[vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgEUxٱWf]vlUxb͊6*إcv^*ثWeSv^*ثbb͊,`We͊6*ثWf]/vjb˦*UٱHv!95-Xcرv:Pu1WeQ\Cx.xYۉ:6qT_a24##rV;ӦHK"/*s wI1S,K؞TSA:E.\!o~%D`C=X/*ehKm,+ڻT8ݢyn]O77\qtyr0޻+v2ŏ7fM; 둵v*Lm;#J 2v(ɺNR lV= qa۲G?<v[+O|k_qvPi퀅v$%kRG `.}Y'LԗeIG~#瀔nW [|rc׿L7;G IWx+|u=Nf=2@R;ٶ97_02.)ʦ(v^vl*ثb͊6*ثb͊6*ثb͊.SvjbLU٩51Wf*ثWf͊6vlUٱWf]vl UٱWf]vlUٰ+aWf]vjb͊6*ثb͊6*ثb͊6*ثbLU٩6*ثb͊6*ث]]XNw^m Uy.t텯zm^[,ݍh'%<|2XI:6333rjј}b18c*s$(`޹$۰Fl 1vZ#WW mKjw>ΐs9 'o N:,Hƥ+;d>cƟ̷KKh=0Ď_߲FAɀRo*i{{a5q6yZ37^}ch+)"b.ؤ*SZx1lRl \Ȁd dŘ\1ŒjRq6E.];' 7eRmqK ǡʼn UX q -MVVCt8VW"¢0Eͩkcr$6`$ޏwޝʿi9us 97̀ sjti$ӱisWa`2c W|d?Frwt~St߶%4MXSV5I5; ,h`KRX84v9 `-f*>Ҏl-Il PJbk"Tj(YqȠ"cZF Vjjxkv܊w;E \ 0]J_R>$W§sɱy dΨ)M6IQZ8:Bjjڽ\ޣ-{G RdRI 'q+qFn'}J8"(n#ؘK?%$;`PxoB) (~$SmZ׉G(f؂7dFʮ҄:5)JF%QTiO,24x1?d7OY%I#?$NvF"1'@+zRN#j;$+hGCOja@YP0eF)C-~*4#nD;DVs^Hm@uɞ.$7;{m&xSz 6W4[U "[j)˱Ol2r^!E6oibYhv4ҵ9]+r=2=ux+ kǸ2)9=G*+яFChwl\/:l|6 e9n%آaW`)큍4F#t256(ix*~`~EoC*\GqrW\):cC]8R'fp{"X9V!5-iQI(;6 \Yw7@j8u%]!Pzd"zb-(:B}FثY ]^ق9of+MW9ơS16 d# I40"j⭁5Su1_٨87)v)蕡ZvL94|]ͬΔ@*Fv*F$F *syMYV+z wTXK҇-,^פկJO޿+eODu+ٽbf6CJ/-jH?gܸ-o6[!`2>:80zu ΀!z{eg&E'NlNBE^CCSl RKCSqF'qAV~$\Z ZD )2ub$W;/B<=[qO 8Z4w8j'uaF2[pyJrR cdn j}f@QQ\ ; ǰa Jc6]MNFdػ BS8WX 7ΛNn0}!Xdw2ݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgOrvlUٱWf®́]1Wf]vX.͊]]va/;6)vlUٱWevlUcvlUxb́]*ثWf.˦*]/51Hvhql.ˋ^c,]Pv;UL`{R(FDFB۷bßH!f#e۟HSӠotI.)nٸۮX %@N1J(ǦYi^\D;VJ.\4d1 jJܹR).6R.y $ 6gqE;Xn€xv(ƻKԧG Z;, ʪ0wft®˫tƂ6v^Ɠ{aӲ!6v`+cZvQcZzָݎ75'cHAپk]ݍxUAb lN qcȽ?^W+G)|]0[m;1$"P sn81"f-1a+ߨ'卲k;`PPVJVp\5YA!~tYd=1HBֻȡk uއ|PJ5ZZn{{J7`kL9/GؑǗzJ$V5zv1&N (|~:`RU'NUoW|h OL+%zcKh@NAogjJ~8y+«Rc_k «*C)"` QM eT'v *JCLL\|@H熒iu&o l!Q9V4&qu0PAxB|3pt2.ǍaWb :Z4qPH#*{Hnt­tHjw8_q'䍰.v(R]FqłjVS]늵\ƾo7J®v>}U.w\rTc qo4N*g*cڛVSv*]\rE~XG+v6|*1q،R D]ҔA]]˄ Gce`3"_+{K$dXՍ>#@Ow$XVln(x @uFIi:#B4(Z +yaosOM-!T†ރ㢘% | !-+ZiC7Ss1AM>*lmW@ޔSN6=: ,!PAZ@ w?F,JRnJRM8s\PlK θоQS_|*PQwۡqPX9J֟WBb`z_ }T'/;%!oʃngQR?bD;zrcz֤«-'SБ?^WzO'}BiT)*T1,jZ1ƱC ֽȡ`% 9 PliǪ\X !Fݖ&*iC_:挀9ב$v߆4?^JN)B+SZru4ɺvK  n BA2ۍIÿU4"Xn;nU4ҵO),}UyQɠG%v#L删R45pMZ鉿vʉn"J׭;S@X4U!Gv6BM ]ĕ$} 6vZ(.A@iZoEJ7ߧ ?F^Ϳgf<'e<')u#ubj]S)v qRǻxC(bHYqp)8 ̎ح8|%Q"f؇JYljSGkFdK\c #؁s-oV#KTGi*_*z֔qKG}CG(hN|EN+iS006f8e*6'[q6ҧSv=JI0;6n.)H`6=@pTqKG[c?W-%'LY " oNCV,ErqpΑ) D8=6Hg͟6Oj3H*ޙsaZlʪOj *i,˶h4*8U1|=&ёK*TPqm'*o(@DMXoo>@=E6邢2aƟY?^#bA$voS%ԍ}E<#q!Ƅ7႔T2x\ *:t>nHTI8,#TQ_clF`q*~40FO@ GMˌ4rۨo44]I6*9c )Zj8픗 Ev558%eq(wcM--Pv` _V9}q,#"_x(Z04="dR@'U\~w\ +m* C, *A~zdfA EwjhO(qF0L .bjsYQIf"Lٰ1غ1ASWeJr޸oFǦh➗!Js:2Nv#v"bv[poȡT{Kd]*oZoZ8LU̵5@+$c(F+`坺 Uz0*Ӗh f 1H)Cz[E6p+xvbIU+M *nT;b6,C:`V:7$b0Mæ)R~a1z t b7λem^Ao,e'}_k7ҏTl۟`4!+mPSmXT埕~JUߴGm.N=k\D9 ˆ R"%Mv~ep1exk`ڧ~#z֘%YJ+ O, PuGRv{fz1pv;M@3TВ@ZVkfPSAH04|S{8 4j9d؏b A|aD~GbE;QN+BW?bQB='|W8]mjڝiO ! C\E ?,*a*+O 75+&U@oM׼N.n|ܵ96 ڎO:#צ -b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`]y^_^OAK5Sl%'p#?hn[.{obٜ vbPiI"SQJMJ$Ơ`W?A35tMH돍GU*]&IJTE)υ8:l%LąKnw+ ~xXT呪K <GGR7|{dm䎁FƄa&‹o26ҳݺRvj*=B-}=@'{e$} !2?E-CJ~YX+@I:#jj I5^T}^A[ ^mC]؝G}KFO٬l*+Z] )]F]nOWQU,|M26["HUoW[їqC튂ቀi\qhܫ`,HhuT1Ȁ€km]D1K\*X*@Vm5L U5fǦS-OQ;a ,KSf);WlQMLE=lf|*pr5\Z!` @XegfyqocMr=v|K iʴ>*zQ>/Ht̢C"^mͣjszb֟n{28w>^UEjQp?am,'ZuWR*vq|\6DBOJt.Rk 6BIr@;mk+NJW,ͷJ4q%8bht!鹯aj;ed3 2!#æ^[Wc-#R* "6cM$є^ĥPkzYQj|b=Cz0,-uPLL\@#&Y[":,ʇ`{N*{ӡ+q/ j=_, +Bv&e,xׇ4@4gwzoU:d'3b͊6*ثb͊6*ثb͊6*ثb͊6*Ȳ}S]vlUٱWf+aWf]/v^*ث PإٱWeLUt] Ux`Wf*ثKWf];,be͊50+xن*pNbpآ.1Q\HG+6CxRR2IS0*Aw$DXCK\%rB bdvA4" x[+Nf stBeJdb[O@:y.V2ƕ鄖ӱT-GNUS?O.v8Hxa@vQ7._ Zv_\4v<&H:p14PMp&[!Arc9=D#̸2GHpGeW.lQS ];#$vIu*w4Tsum<4aQә/ayPdK˒zn?+i*$1`߿͓h~Š&fMYn?m2J88 G{m œރjR)So GBG狍v-J mm*-{` $- .ʝ6Z-*,c3 Ɩ-4cZLmibm%0Z@nPM:4^9+Z50%DGDv(VSNGf¹֑O9ڒޝFbyʍ9lqeP`v(f(v6Pʮ(vQ8We6;(UXٱCWvVvj]\U٫\U٫*WvUqCbʮ*ثWf*]N(vUpb͊(eb͊6*UٱWf]qWf8Wf] ++ vlUٰ+vV*ثb͊6*ثb͊6*ثb͊6*ثb͊,b~JxWǾQ7я@vIm_ڹ]CƎwJ@ιM&6ua֤J0*ch VWa)%@ _z*^#b;'G!*OBݷxIe8˷AVV B= TT֞Ǿ%.qr#-YEM?Uivߦ,HnR-Hv/bvIª|;ƽF#xK;R4u SJ I_ @4_ LDPb"sĚ6&Sz9$.:O^.)£b 0i eeQ; [_g9$e$f<<+ `55k(v/؞RRHh?ZvxUc mɍv.Q]ƾ8,hxaV)k,wv8H "v0?k^ثDžc"=V)**b%Lirv=1WS[)Wq2ާoFy)L*F(jq鋲Cmr㏋UF\MF 7?wo:MȆ0W 6b9;:0"$~ŮIdc#vYҵ+[E$IlF&fQ*Z>IoVg K3DlIsi_UDWmpቚ;ȒC4=Lq`bikPWzf)qSj߿Ӂ|5&A۠5>u=,i4[ٺ ;ZŘ|,wzY"*树Sڿێ`fVqY0u%y1&PENp67-Nqu2NQo,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`2QR~.'b;=ZSqyfQJ`TzR"AEԓ[y%!o߉Šb+\\Ҽc*Zt5Ґeq(d ~Хh{ < [AD7&C\L]_cuA@ose=*ڃ U0;N?cC;$6(܊X+E@OE5=NGlOmE-8@@ASl;{Đg}d ;r}|3C9{#!7=y"*ǽ7ovJ2B4 ,*Ue9O0!o" V且RGTˈxW-ٜT}3$] 7-`j*|`T~/ʎor*:ĴcToB;|YrM CY8\x. rYRE<854{9 ֽ65nPqGR:b"ʢIf޽3]A^vt閶;-[jw—blUFBop1"֜~)zb~إEƘYŁ2%GPqcɮbgtD6èݰ(,L[^uɼZ1]PRQ]XS'Z/b(=G*ezb;|PV߁W،UQ|UyowL{aWWW A_N)k[)c 1X45V:B-C/Bxd登A+[C`i"d"-3>` v\8<=逳r!a@7{njo=p#kItd*hi!v<ŭz ={lU ,e>9Ǧac:GOKcR(7zL5#6`^H91!aepzD;saE{܉;c;d6bثb͊6*ثb͊6*ثb͊6*ثb͊?EUٱWf],`Wfͅ]L vjbeWf.͊/6*ث Ux]6*UٱWf]6)v^*ث銻6*UxٱWe6*Uؔl-.S뀶X Hv=q`]H1vhc=WeI SӰ45q|])hPP;ƠP~&6ptieĒ2[\BƊԐ2q7Ms!͞<|/;JZa#7= !x@7bK*;Džpv^ǮWwfiiٰO4pJڻ( 5 &$мʔ$|98Ǚpf4X󆕥wy\j'_:N镄j>($T2G˟8+W`w"mi..mcs=rZWH6E5?$~ J^9h}}/J4iΟ[AQdKVu' U~[ȎK8YPc͛hߜ7 䫑FĆ W|2GVte-u *>1 /49hzS,[ErXX:0e5}+)J+qk$4٘qqݷh?^xRk\_M&?*Ձ#,OUS%&AWF0qg;׭7Fp[ֹ:f%Ƙh Ċ%HJU`CTW,6(vXj`Zv4N*V#LX(v7 [ ]SQ[ ^. ctv:|)r>{M7$WՆ?k*\М; Y;- 6v)\]o)H?@67mctyWd#vrþ]OC)(=XvP970;b‡eUX+] +vjf(vV*UXb8C+vlUٱCWf8Wf\UXUXUXbf]];6*UٱWf]vQ͊+vV*ثbp*Pث`WeUXUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]=*Ә/U @vI o㘒.4p7#M+ZeD6[D*܆`ONYUcJv $-ʴ$SïfVF$P t Vܝ6B á8Ygڔ( ({u`Tuar%+\z|!BiaؑXi1хMkۏ6!-qg6R[^?N6' VEIĮ1qpݏƸ@Uևb|<>YA%*1w+l4*H * G<2`׉JRm>apr EHMᵧW1A_nثWD5?*q@&O B6qǹʹN Q>&c;+q4 ]@=╬qR*aV_Lק݀|cUت RkLUb#k,urkur,Oj`KkMaCPT U!~R38pU;1V鈑AOl Q\*@ 8nq PI`V+aZ╤HX7ߦ(lxrPbXԕenj)ۋ/G.f$A bqc|#ǏJ4'h}9e=wU򉯧q߯77_MFa~.3yWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc4a gV%PmFQ\rclƀ-GO1íZFB@5~$Q RPhmKx* h:8;ʕ I VUo$7&*v ^m2MvQ踘H' q)-;l 'tm k:1W(KRm%@4>'{䮘լti,9rރcNiNbFF=j:S9qZJ=ʯu@iMXQcrkL ]X)B*7lj}!d oZNӌPW#d21Jp!yuuljP[p|||JpS172qOJ9*y!$>,Ā7jEU+"Mq=$aCۯdK?%EjUPv=?f4aؑw)`ޡ"+_ IJT迓hw??)Uw4;TH UCU$og;ЕQBe@~ٹޣ^mA8īji rm/Z kL]+aWR7nqV qcN#9|iN n(N mؚSPqd(kJX' jWrI5Ŋ] |Y 7VWN(ZrW[[bao0ߦ*Ƨ|pƞ$nqWcHo)G*P5 u2$f[(78k%"^3MS4'^<,4>!f$<3ΉMdpBF?X2iç1sȓVvl+g ,PSי(Jթۉq$AOJV#Oi4 ۾VS-J|Vba_ #4HjE>* ۯLZۈxWB4ɦ[@nSINlK-VU*|}'$M@&pGF$")ޙ"h aS]ThZS6똖߷@|:1IG}=pfecf̂H;n+,j\]jLVe6TA?N\@?ڤ{{lLg"W\r;j d=K"P<-XQE2:&{=m# ^zwZ^EZ<6.jUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Osb͊.٩.́ͅ.]͊] 6*v^*ث˦*]]Wf]٩51We]WfWf]]1Wf*ث;~mؓVq|.c54.N;pF^*9i/.'%Zz(D(y,aAIqrb<þD-PbWzV{b11j!/2#@3qbSبjM_r] QM5۲ȯ›/2pوɲv9~zB참Bc,"\^I)v W6 3&&OVt맢~qkbn+pVM*[gr1( QPJ jRv5%ؒ~|_3 (ŦkLXkpd}&swgیZUA#e''yKIe:1mZ -p +B(w8$%Wq^w&L ¸eJ`[ciL$2%A.]Hb\Tn8Hv;50٩]L(vjbf*LRLU٩]SvlPثS51Wf®͊]S;51Wfv]1WeS 51Wf]SvjbLUٱWf*]bvjb͊+vlUٱWf.]vlUٱKbf]6*ء٩*i3A!#A$E'P*e|R/ Da(h3H":mV63XI>sZx柫wvrJ5l{!9m3.Iv([artΫ]jLGdο;.ftfHcC~ ~yR"$@Φ$A v ?\jG͂ܞ8-д=0G.a#$:y23ih܏۪l2RH[$w uKۮkpa|{# F.DB%V.~+1P I QRh>' bxFP'cd O:bʺԃQYN|c`'w1[= /V5&[KHѯι "бGnI]RǶ e,^.'TW9mMzbԅJJ-ƻ5h$J",,'cR@m)U*bGPZTPW'\s ǡ9;|u}:ʤӾ㯾F5= K6x- ,L@Ѱ(t#jdFp!x8FDp8n⮮Vk*-ZXjbg ӱʼnv8Pk6gY8dlhb4/"Ǡ +4Yc.w#.pa4)E..N'yZG'Ern(3rydo1rcvYS!snjlie؀̗f/]pGvQʦ(vQ]L6f*Uَ(vV*ءٰ*Uَ*Uَ(vU1WeUٱWf8Wf8bqWeaWf]v7vlUٱCb]vlUٱWeb͊+vlUٱWf®8Pث`WeUXUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]!T;f&Bh=, ŠP҆l.ţ" v*+,d J?-ā N@Xb  t;[भT<qҍJA~SG`⧦9xQVA[`*ҺNR@O{U`h##O% -r% 48U R v0-#B]Oޠo BF+N$&S8"X КփaZ8\ ˉـpCkBB o ȥw.MzzW+W$N˗_ oOՋ3Z39f0v$Ǩ_$'^l\/JܲMÙG;,SbT_v z~AjWƼ/aFބؓޚazƔPNx9A ă[*~#r@6Pdh+߯ZZ$rj7ߥ)lO* MxEa ]Qj] $`vrp8$ 4?Fp5LMB::.~8zL$E6ط)—b?Z,"xXUƈ7%={b|b;RE({b62Zq**( jҔŋJmlo)qW`F*kbJ Ui$5 ʭqKyDe*젴UZZqWc)튻.3wZ8& ddX%^XҖq bT dn'-$iM\zUcH=^zG5 oS1D oT?Ͷ G\R,BC-M,l>pbZ3UVDH~-QRzQk\ ÖJ~d6)]= ~8/~#|GZndɄo*˰<|U# q0$ƒǶ zEŴ,YB{@tFZ954)t,*{P;"u Oщ:YZ![~Um-ш% dr`?θ3J>[,R%T61j@By5S*1eԬ~+G?f\%@jT֕?l+4#?ljdG,늣ñ݆tsr(Po*O6]n?7Z;'Uh/9v Wf]vlUٱWf]vlUٱWf]vlUٱWf]v02}Sv^vlUٰbf]1We͊/vlU٩/6*Ucv^*v^*إٰ+v^*ٱWf]]v]1Cbf]vX]]vlUN@S6^]t]v۰Idl3I +㔐2$U,WƠUO^/˰FeGkQezE/VZƝ9vU'$KKP:ݺ঻v8 vLmɍ;7 + r_a"ݏX;xW Py P7Jr)d$J^B@'|i>H/ v <+lSᜒb~q׋oSEƬkI\iZ)oiPƃwN"qxe98^4~mꚤ$8wcTe`ٕ#Rs! ڐ6b\KJ4MZvxwٌ\/3K+KSZ;߯j'N1Վf!fτI.FL,~G͹aL+)4e&SCͦjÄeb3@@M79%F<<f=h;ʷ܌bKhSԔq_zEkRo~1b*z;XS?4Me],ޔ L]X* pJzLm&$ڔ1r;„< )o.Xwƙq!< |ELPm*vx r<ɔvKCىb.߫ =u=7b-Z 5&5~G.,8Fo v=[R̴[;q4j~jH՚&?kb2(EayM\e:T?]*iQ0)`p9&7:evM ])v$P6!ӱ jn7l. 6j!,w1 nͅ]WeS51Wf(vjaK`Wf] 6*ث`Cbͅ]6vl إٱCaWf]6*UGvjb́]]vQ]vjb͊6*ثb͊51Wf*ثbqWe UٱWf]vlUٱWf]LUَ]~\6t.ΛiPz x݃ hvr̽Qnn DBs&_{n#NȂ 훰;71%غF'$W%OٿP`dL($hSFӒL#? (:@O5=^BdBiS;qJRW&DӢ=_sLPrTV#k?/LbLMyP8VR$㾈QӿBccLyd[B!E6w8q6XƱ027^]p\wE,X [$µ+7@8 >dbaч"|e|>40rybw"r=1o(l|qxvծTpg?cSiU`?.;G_w/8vq-kIs.,^/}&(~N9n%ǿl(t^!6ٕ.a<7fCo5_[HfG$_3VUQ9-|^)y6I;gHk9 aa>!oXu%Jz[QoA*ޖE*x `K6ɼa8Dbe1E;V4qD8!Ƽcq,WcE.Z5@ZbKT=A@?+dwM=ŒNݶA<8PUQCҸHع!];dJ]|dqFhrwnv;v,+ LUXTʦvl(͊6(vl*UٱWeSvjb8(vU1Wf];6*ءXbʦ*UٱWeUXbf]]vlUXbf]LRPثaWf8vlPGvVvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]qHvt 8t7;$T Qҹ\ !ȐMcmBZw Tȩ{t,&UTU@s8],.8>ƧzdUK1tuHȪSl%CSOJ l ~ BT2 ]UJK-T?ڶCQ@`A4BXQ?묚U j~ 5GR)QO4(=)MU84jSCBeR(ߧBO6) O\i.q-)CZqV銻e^48PƄPE6ޝCW.j*h Zy i̇Z-74®ř*VꦘUU^aVs*xCx !.jaWbA4quY-8nzUR-V5j0]L;0+`fzqC}{b$^ F*br 8`cv늶rCZ6 n0V튴qd\TDEޘbʠJqOH0Uo*bSTe}iZc\JF'|8]O?H7N=:j:ޫ`sRdP[;),72^Wbބu 䲑tOVw;ȱ+nr˦(\ԃS me41J)`߭qO;j[ *F{tix)v?WG%u=5wd4Q!O?ȥz%(ާW8cFb(o.6*֦qO T U?E`t) YC(ԏ߉Y)~ |B׶r-ԝܻ"Jl[4!yoAߺ%ǚԐ AbW?ಿoj*++aWWgCBFǯPZŊ#駷feXӐқCmݸ7AQ_'%Ii]R0C*BiP6rJ7SL+CrRBkL=Lr((`Ǯp3'L񸫳b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbz󺏼dh1VT ќ>]fXNʣ 'Sہ8ZLc@hJ4NdTp'lR.=GZ0D)B5ۡŪ;uƭ+'J#7SZ͖ja @vj^؁iSdYo/E^ߵT=jhE9's7 Ph~G TA&Z.P@4B醩n8D+ҠvƔz~ZO׍ue}Q|rCl1'e*߉i(!VRG-|lÏcLꁨIj6o~Pߛ3JTc^#wlSAog:ІŎS`;o VæDϊZsr,8Ҕz%zN90ڇ6! z6(oSǥqH_>Gd Ud WwŖOM* SKMqK2P*x\mL.iXz& Njѹvz#RG﹯?d3=_€fh+^2wWٗcq C Q—elqWS0z*d&늂_ME7N a]+5ٓD0F(­bOL 8{LKfBH5*{ɼۯLP߫(vQMzaK#Wb8b."jTo\ v]:u( |{S:WHi*$+iˈtyQz|oFZRO㓂s":o-e/=(+OJhك t{ߒt#PW_2$0섫-ۥ)bqx&+PK:PH!֝2I{RSҢ{RG@{vboP)Ǹ#&mҙĜ55 ǃM$]\tԏ떠C.N覫E+Gצ0;) [QijRq=0%tZ+)R>}Unk""x>;N߳P6y)ڇc͉*7m]SpXH| ?ˍTn 6S1CQN䢡(zu:vW?grkNLѰRS<2A"'?<(VvHeς(myo"ޣ躻*]ٹWf]vlUٱWf]vlUٱWf]vlUٱWf]vEUٱWf]51KSv]0+S , ]LUٱWev]1Wf].bf]1C]50銻50+Sv]0+aKb˦*]v^* ثtQt9; ^01<;@<{;r h=3R8tQ B@qSJ1x Y uma V\ǎsOX\v59O9)KxJ]$QPS0% }";veI.Sv=*OGau{*!W-,iXYP&qH*ƀrc\Krw0 xXVdORbxS:u}+MPU%ZkONԬ`,<>R+34x{z}OT\Y\=>FV?ĸp`y#:6|Qlb^9T2_-JvW, G'ӥi#P-> ~C/X󊴔QڴeÆ8`FyoN`" Ooվgrr,+EcM#@*n&JD:lr y桧nݽy9\ǭUp55,Y02J~4ۇ@:mͪry #|<(m\,%r9ie=إboՆ%li(jP!]YkPj`,kjZQkjvbro*Ƴ;,X4)8]S D Z T>9f Yw!pe[|,iJ3HI#Z|,dMAp-?Sn^UNf #?<}*~Wf/Myd37Z|aVaBkMQw8CҼ$ePU痮!fz7PSh0=KSLs+V"9G|6iZ K7끘6m>:-r-n‡f]Ut].LUXٱWf(vlRثb͊51We;+6*];*ٱCb]/vP]51WeSvlRثbf®͊50+aWf͊6)vl*eS/ LU٩.XUٱWf̪ d$i,CqM8CMߦhu98tYRwc`I'%YO]KP`A"fGONz Ʃ1F>$'iv1S LZ9<+WtB)R068߬vӸ㄄14@f4!#<}m17Ew-M(ۑ6䄛JFhy*??X?q1?嶙7vمA9')vңf/>kRG3o&(n˦8zdiY$D+Gpq+Q!XuLbXҙe||BWPU'-4ȳbxJl"S 2,$6K*zPXW充-Ҿur:RqDkNؠx]l(*x`-b^R(g9rq\7C]r O[Ĉp3v92%]>CQ1ff[-yԙsnb20r14\J[Lctv!p2p6eK;6*bʦ(vQaWeaCb͊1®͊*b͊(eUT]qWf8Wf͊+ 6vVvlUGvV*ءٱWf]6*ثSvQ͊6)vQ]vc]8`CWeWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU bZl412=N T>.و\еT|yTor)Zw#BoL&w=A6JP,ӥ>7>8>jA|)V+)jWq7-ZB;o#D>7)W+Z )(jq`j8VhU΢AU#، 'J 5UDP &PߓU: IZP$TkJ:Pb.⻍kZnS*˸@mZ ㉅e.5ثy ' 謠1nd9lsgT^?Y.,r˜ Je7\)qŔj p-Ȕ8`PZ1\RWb­YZ8Z; KY W*"aW`yz⫆$X#o2I vRrBF*JxCy5]FO\UiӦhM<1U▎Џ`J8aei(Lm)⇘A4&5"*֝SKm_jW`{`v. ԙ(z&BkjU7yT nw~ow^O_5*4AP"Bkč_qB>F7"j=R "0%jiNWc4b i8Qb \@#Ve*ԩWzXꨢҠ.8ֻrnM{|%҄ɛ3zU*)x\UJm'GeqBeJ@=A{r8?F.ZA1A~lj7 ?ē9ܲ&>4l{qmMEA@n?2䐧RmJP_+e8WV.lԑܟ?8UX7N§q%^JIClDZ9*JN!_ꢆB~3p5L,Puv>s5ѹXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbFp+'Z}']-ZPT%mK$|@k@|;)A{Qx k.VG?ɠze:ƥW Uvd| 0bB |=)S+xjk^4,TGQUڽØ@6h6K$j@-&HSPjB9w.HAnz5TU ~ A{ U؃\I/"eOl$/ _q$[%k+ҲIifXvGVs["H۱rV0rH YT*6Tv4mf5kwn@59{r ΡgljlQOWΟ~a:աrioju`:4O&u88jR3W"ėXҝ@?ghCQ•42E$ݘZ ]ke%YLnrH XȂGj?l]ROw-d$W_}ӈ0UO]8jԅ`k:`+6u_=l9]Qhw3ۅ5R~fCȻ/$\]_6*ثb͊6*ثb͊6*ثb͊6*ثOr+b]vjbf*Pb͊6)v]1WebbL *ث+b˦*ث`We͊]vjbef®xٱC UxٱWf!،ź!ؒ.-v[ec6u߽r'gӲMe v-{G|'SrjqLǏM7߲7̀^Q[`"]APa5SIɁHv:B]E  90-lnh>Rdr!m|9)H@s&^5Ms" |;v-y"K ^%"jG*Yg;zKIӢ+a(SWZHiE9/}^ ㉧zޑ54vhjhSxz𺹨⿊F#BWEy_Tr<1h1ROY?##-R'ޙaKi+]WuyqOP1ὑE^=1gTd IsVkQZʑ)i? nn*J 0 'pi\Ue/%:k߿fi>$ݱ$tE'V^TiR 3 "z>EZ퉨+oxݾ3JAcjA-SǦ(ڃV lP;8"CWri >զ*f8)!gphۏ rMLUcBa/m!r0~gmuAJF6wb:ʵ0li_|A&:MwQI GњOv|cVM\BHu5!~yX4/$pM@ffQ*_ppnO͹n-oYfaJHldKC pza4@TbU16;F;Gcv. ϛK[-M-D;uŃ銻6;6*—f́]vjaKbf.́]U٩];6*—eS;66vlUٰ+bf—f͊6vlUC/vV*ثS ٱWf.͊aK`Wf*ثbf] 50+SvlUGvVvn@~`*ogXv59!SDl:~n^9xӷa oCEQuvpٸ|,CNDZ3f;pqHCH6Nt }BnN,5ŤX: Bj[9l?泆AK}J|Qz3/2"^_ncShs%Ԍَ*6 ܚ ZIo.Li@)f-&sFd)嶆ךKO?x2ry?w}9Z@Mws,NcaSȈU"ͅfG1Ul,KD`Z)6ر6.ꍺe=pKQҶ Gq=U0=bT'waMH4;Ž/HoN9$=E7d6j |G(G8XzZaDT$soMP;H5 .,KIY 4b "b@p, HȖa~$\ \g-7 RqCXp*bV1 ҸX&jwhXVš[c^5jҧdJ0)RM=]^r)e ZCpBj!R|PlJwŽv0_ p2vXaחG #}e}]n' 횘x.i6_-4]PFF`9A{-)3-;1H.0]/v6SvU1WeP죊;+vV;+vlUXbf®ʦ*]v7;6)vQG;6*b];50We6*ثٱWf]vQ]vlUٱWf](͊1®́8Uنvc]6*ثb͊6*ثb͊6*ثb͊6*ث[d*ڬ,nu3#v"WLs-Ɓq;vJҵ, (V5 Zo\UR( ܚb0^*@֛Yzzx֎Q 0T+CN!H&|$϶E @>qDΟhիQTr4b:i-;p34€ ;H޿?|! =Ní7bj#5)Z)z ClD*? ;ªb [s ZP:SCZnErhT[QS^%ʄR=<+bHO*kpGl(T8')jKʪ$y6ݩɑsǥ;‡cq5Fv/JŐ ߦZM0Un4r%WC%*=­]w.إn8[Fء͸lUL#æ*cK^clƵ;⫳1V4qV鏡aQzR®ł u8UŕV\{*nধ)[˶;TALv`%.~fa Oўӷ%ڀȻUC?*c~SjS|nEI9ї8%+^,PIRw+ӧx67ծ5•QR6x2Pzu]\P|8Z !> H{Rk¿fe{M_UѳSEwWV !ۓvՊUH ~cjqJ&=_g ZKNñ”AG]ǎbRZɅ\M iO;3֖u5,ZFlp 'jHi۠ts%Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]4wyxH+qa>NGV |p9^CG`QA_bԥb;bѡrCnH)d&86mO,LtÖzWb5ATst́}D, T "֦uK|IEH촢V$5:&pS)lj~Y\1”;w?͉UA@|32b hMkߎ>H5Fjh2Wo Bw=}_ղܔ* e\t/"ҝyEM58۔@5ojMh702TXu$ZYYA^@_7h)QJ|TB?Q 4fJbrHQ^_/\t5jJ%+VŢvZ QGlMJIZS~V(J*Va"Gz׽<q4BV:#o׾ NGe Tuv'bo!rrL~RUxd}qBWvza $zՈEW Cˑg+ ܲQ~4\kNkjij7B]߻Sƹ- &ꦟvv-cZ `Ih-$ؠ4>U)@+p1k4irwY*ŋ!2pRF,o&D.W ${SӂGqMr(hhF;|i 'W튵\YWi9RDt>9[/⮯tbhɊ$7ߏc`CLWXR[[j'NȒĕ a݇No$HR:prRkCA҅KăN}e2쭤Ww8vfQ4џ/,r7Fb,N۱2 "NkM ' i{1 }"*GJ0j.\(|2._ralV۷P㈐Hآ 9*$+y}nth*rQZ1bmw|#M`߮j>ϵTGUx]daH`]L*V z7Qg EOŅe?ᰎoJN>i[i[ cW E/ӦFaFOlg877ruZBfNv=0v$sN P_2NX- mC\T*j.^e*MLiiqJ01Sz8ez~o[f{⭘F9n)=qt5ȡ- ֽwjv /eF6ihJ#֍yq6FdyghJ C$zI@o43^a̭noG-=~cHWn\I_V Bo=@ޙ")F{3p#G"[x03vQ`PNDr,wv8ȋv a 냓Av+\PUٰb͊6*ث`Wf]vjͅ\ ®͊+]\(vV)vlUٱWf]6*ثaWf]vlUG ]/;*Uَvl)vlUٰ!ٰٰ!ٰ`Wf®͊6*Wf*]UU*ާd%ɄW;md=~gDm5$i۲+{k{fGap줊|;EBU{}.?vq;:*:vD$nNH5;$ZeE+qI{phv)^!񧏶_7_Z\zQ5?^?KMp&%v #ZqEߎ A!$ crmRX׮D0ah%"CBfMqW$}ޫ- 0"v\p[jv9`L{­WX+Jb%Ŭ!ʼn 2rF,),iv QHI,+ZO~Yq; =,Y 8]=P}0)-:lxL* @Ť=i 2m7C+Tm,=V)\430>"Ś:by"!xlTfs=2,$Č4ƕurap+\01Wr48. : rE^)fY6-D, W'3mڴGInN~83H9S(|M]sdU_|] ` Lkx!ٕH'ezbdvYInS4Pt;;:\8܏ᕖ;9֯%d<6qOcٚ읖0%qd d fRbe];+L(vU0bʦ(vU1Web͊ 6*죊6(vU1WeUX(vlUT];+vc+ (͊(͊6*vV*ثb͊6*PإGvV(vQ®͊p UٱWeb͊6*ثb͊6*ثb͊6*ثb͊~Y>noe u؊_(4pe/aR;2fk[l G2}6$uzYdV0ۯ,\HdmTyV+o'BT}=U~VVtRԨR65"x钥]ƻ~)ɂOiZ~\i_c ZMM<|0mDv ִ'c4UJ^`Ttp$-@'aS S0BM~:bX﷾M7GZwǾI`llH&־:6ku{Kx"a^9n>b~3bA2f J]4v.: V]:S Jm,ƴ2 "جf ]aV AAVx8}{ U@1ק*i'o Ud7銸bL qUԓq:U#Ǿ*YBva֪@qeR~!jhhKx╤-mj:RMw80ր4,~<4LPl_i#$0G-E4"PH;u.F,I+N>#▢@ kŸidĜ2|ik_lU^-dtQO1'FwNk#mQT]9 vSsSշ5o/j6=*Gm :\*bGJO +ҽ|qC.[M]t_y8UToJMtVAXVWj+uxlHj 1K2l߲|zo8F 0P:c%\pz7 *Ic]|G_̹|wL*Piֿ,q%v9dBLkМ޾Q;EO%GaQ^BlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`"\}DdOsihwbp9fNnjQ;*q v^`nĪUQI"幎u1a*:&6+Rz?HyXѫ6L&?PF cr l"!I PbNHBWP@-9 V$rE^y ϏQ fWj%10 +*:E|2ֈ m4.A H7IU>4m; Nd"[&,R‰V$l~L@A܍ *cAPB8xA&LޕcZc< \¦\SQ+:4aaEPhTdv'?F*ar?%$ Sq~9qJB$ |b Emg2P@O9ϛ2]< ׮li1=.^ ԫ{4{gA XzX C\ت]Y PCŹUp1Mb7b~) ]fV<,qQl+!H`VM+ `n# Z?@qWVaB(h0 ek YZ ^.M،P7;-bJ?.4(Q% z`8 mҌ ɦj3SMX\=Kviu!o*Vr{R08P_ pFG01Ŵ?1PV"%0]NLEycMQO A*n1ٔ|ށf@JnkGJֹ]7sGsݩZSӊ MfR5q$aPrA ,x=_9TRz]5̌bPJ=>!بZj1ؚm*pӌemث@G~T׾T]GĮ#m*vZ|,yAa|j@tQ_2BJJo5vPŷO遝*lONOǎuR:n( /-)v[iDAnɦ3X2ϧ˔v\J~=2v*I{dvZbpv WM-k^@l:/LDGWrS 'q'],%:~oM;I`PwSYB2G;>ٓpE+q-̞s]E"'ʟvX=;'iak6w uv"?7\J#9lBYϕԳ͵o{NR* R{-, C'USCNڲs=騗I8B*8/M%Wpzd:nua؎Nխ({6پx/-APH dKQ4#d;`AQ*vKZG| 1e;b$vT'd\i0*G4ҨLg,Zv+\);`: 'A9Is5Pke$$Fv5jdR bE`h٢jıvFA~vV*ثaWeWeaWf]vlvjbf‡ebf;/vU0bf].͊6*ثb͊6*ٱWf8Rث`Wf®́]ٱKaCb́] 6*ثb͊(ƌUb.qWcBZ>yNIPq58Cy{ObHsym5yx.;\c; i}C@[bPꚁxeANCt FB9Îkh1J ac\5HhgH򎘱QN!6梅o:t##t^;s+ Cɿr~қvQRMxm bbp…Ccyn-" \ dc\ 8y Zv-SR@F|vk-?, d>P{Yƴ ;o*pLpSaCY*튺.4')8(׾)}Ziae|Y4S`)Pq ;f"ٮ7lU bo NY@1E+ȃ %؁\R2\Vֻceg8Ux>xWe =v>#V8Ԕh$]@ ą`a[qZwŔCqQQɡ~w;„ |*[GF=;WcNCTw3JoAdPdTr "mE1b3&N¢c1C֟\(k,o?R nJ S?8!δóVG,`p&jv"پ :rWb|TR~Q^-~b8 &*[ ޽A=챠uև5Ut|~IwmIX+#u_qJ#Ux% ?✁RM<V2H$_?uaUw̿ Cl~+'6ҽFݎC(w1T~r*h࡯@KM]ΘPԎ⣧1DtUKlJοiָPCQ^+#=jv_ !*R$״ae%k37Y^smgO!>i]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbZiD']*А+g1n[*ȪzWLRku>B9q+Ӿ [LBIE 76ĂCT~^~.//z]Ƥ3; ]8Լ[TtiYlFIP aZ9wmTbUBlQ`Gl~_ĥ;ڹ:QD w"Wc_['.@+)I;_d+SQڧq&@ z1J>8ـ Zt8ԕn@0RKtB\ifTQ|*Tl1 Zdwtiȕ{6PSG!Mz, w x74cfBV$.jSr r7Gݕ(fZ#[#AuP\c̟LiBI=27FF7%iµ7SµI'I`OZӐGR>&-tA~2tޞ=jnxd)TBӘba϶Nګu.!\VZzD3s U\VͩVǗw"iƝE1):ec&+ُ*W@@;`6m؞w_&lkwCȒH>Y0]^-1B/:%إiTb r#q#h%q)Z,qKe\U$G@3Mf`>h>ܻeWG*lv˧*{0)zG]@ᔂN.t97ظM`97 r'ju^ p'A`>"F˜@FW_}P; ~,G {xƹn+tӫ~Ylk۾gRe1 JWJ7TӾ;v h"աht'7=wE8 ' il4 ji x6] Py]ٷ'oL#4 GGpO4'}H( :[x|lN>ġ $WqƜJҸ5Z:5JיAOO C~xnܲG"ѻ `[(2%m+%Tڡ@Gkh81<ն?/r伂1S!]B&5c59hM4҈@s`/͊6*ثb͊6*ثb͊6*ثb͊6*ثE]1Wf]*ثb͊,b]vlUنv^vlRUٱCv^*R*إٰ+C`K * 쳊51Wef.0xGv5(Ŕ]}Fㅗa+P20!T:LTwF7%*v d&t̺8 .FHO/؝~` JBiز"䅞%) ] 8i.vZf/qQ:>aj2qơw R?Ϳ49vTX;6vlU٩6*LR*UX`CaKbf͊50ٰ+SvlUٰ+aWf;66*ث`Wf]vlUT®L ‡f8‡f]ٱWf®͊6*]vU1Wf*Uٰ aǖlҒnt{3T]CI\ГoN¿N Ҵ9AۛLrqq;8{fOu`>Er5˛ věS8Ļ$dT;kDͩ\-SIV~9^ږpR ~'zҀ"0z-Wri YSrTVl,GzK}'/FߓPRk_= q袛d9yW^Mg~d ;ewfV}U[v 1c^KHbEnldvW׮Aww?QNYLO# [2w81'*1qKKqgLSNg 4Wkw"EI"#)y>,i#}A*LK\ dZbLc .& \G6Rb[bsT ލ&9'+ɓ^L bd4K MtZzmO XȚeg/sB>k#Uxվ0§sA|!ce8*Ƚ9tKUrE+O\ Woqi8 @C~<&_X#jvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWb^B~n'77dz!sC )p7Su@q{9E(:0{rS 8j]j5h\C20Uo-* Ui=A ,)+EU*! i5j}NN%ri˦~ss1ڴDl !AF+׷qt@ӯtʜyqiNc/%-F^T|7\h'3jMb M^73T~zm،oe͢^N)M !EAizYPZw 5AoP|)`Sr4>#82RARa h~L+=KTV(i ˏzq~׭Ddpw4Pq:#Q@ҡQUڴƊ :`dW<:bVTtǛLf(P}7a5HgDuj׶]4G V. {W; fc|C|cabCr-ggccZJ$\qA\!\0(شxR]j:b`:bԒzm -ˍ zⴷ)MF TWzclvkɦ[ƘҚҸZ8; bIhN䍱Vۮ r4#[r,M2_mݕr6V܌y:}fcP!-J=*@<([h)-w_yե1ɒ}qO&055?_z' ֓e(emiOP=r+ʼڇ[z  ߒ yhP>*׷q).Oyiҝ^m-kHB mι8iff8`ÏOĸZ()`4(bGBu8QC쏵Ntr4۶ EEi֔c?'wD8?&u`COZ;25v9W Ĕ8ei4wi%_g EOn٘ *J`kQ[N-yQF2kSumT`"e{Gf+.SҶHß1H/L\|6hWC[ )\Z g͞;]U2}|;Vj,hę%US'UYU;lu1&KdU16lYRቱ HnӍe X|UsziqL6q-S,9)S 8cm9'v^p$)Ҁt΃&CuȀP$r=r ,`rmq[uF+Q@;0GH 9+]݈ȣ]!7Ȅջ 87QIxX51vl)vlUٱWf®L*]x®L إXUٰ+bf6vlUٰو.́͊(K`Wf®́] 6vlUٱWf]vV*챊vV6*ءٰ+bͅ]qWe4h8A5>¨f7;vsmZ1ZxOϗͧg@7`6rNL:HD1vĴ$cgm8>-I/C#>:^AA;kǻR[s!>Xi=G&M/ĜOڕmm~jځGvv9dZceXimggoNMl7Ԥi5L3Vfؖ+8xe˛;α,4d.9KiqR"'"a,KC`bm.)\1&ءbm50ZZdL7AqO {ƣeGSA3P >/1, =Tධ=zwl|BGݱF6ZC]ejPzyb9Gm9&aca1dDaBV2AA]HLRTC*Aaa:<,#~mo` +p[ lvIRPV׶ȬgH95GG5=Y+5 wrfvdBm$$帡rXGfD&S6زXOTwI%A$9d;]Ӥ?2g2U㽁}?~){C!pۇd=l AdtHֱ"riu$DdO)BM'H@;ov&ִŝ;6!حOUpb r,@(Lճ2f-.vH^YrpAل)7x=Aؒze{Web͊.`v:uݎ 'f͊+;(P]LP]8aC*UٰSvQͅʦ*bʦ*]vV*U٩]LUٱWf]LPUٱWf]Wf]qWcN(v4͊6*(v^*ثb͊(]vlUٱWf]vlUٱWf]vlUٱWf]1WdMXRʦ{<~.ɍ#a1; AG>yDiMq< ?YdTX޾27(F4=m(Y! H4OӛmJdBqVڿI•7ԍd֝HCXNLi  Wƫq;bǰߐWfo㊻}-LHUc6+zd= *u遒acl\#JT`r(y>ޯ."b+*zmAs Pxz9Zhx5. ,rw $S+H$@5?lQjӋRIAnL{PX>f4ָ*k^sz~"SSK}"h vOB$ (+M\U<jWzw[t!ُj~S؏?N)TA H Z ?Ǝ, IOJulU{BE8r?˰JTҝ^إS,ZJ˚䧕@[l2a(*sUX5'[+j$t?UPU=>lW~E+bA4#AAB >}pB$jߩszVקHTOJ5ӯP__oZlaVƣۗ_`vv=_ˊ TJէ5?mgQaN5V*p&pێ{\ Bzӯ_ׅQ;=T*GWj|'~dMH97E3y2#|I%8 ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v+km_meɌ;=~08x@Z.@Vu"en܀$iyn pjr4%jHޣ|.> ^IAZue>)܋$P)O7P7޻ G-QMvƸ(oCR"} ғM#GB~&44??~85> #ޥp|RP}قvH$q41 Jcf;׉oDq/cQ$RQA#,Xiʈ;bq F̎9anP=2¾;S cΖ!h*ێ1vk.j  mA_ՍH*GPO ,\|UӸtEP6<`V*i׶E;ӯlHe;Vq(%, sOj[h~!Ms[fؕ B^v5놅sY].na-z v[Gٷj7@<$W`G-éJǪu\ӗL4{ռlWp2]k s97?ͽAN#n[ٺ(nJ M Kxqh S dܑΊkE<3v-T8Jo p\b I!LQ@,_zwőwJS+IQZƸ k>v8RE19TKD+\W`6l%Hxa@ʬwRv>1g,-jH zK cc5<\Gwe9%eyU- +_KQfY fz7bR}ԕV5ӝgZ}@Ax["v?)-G Cwe-Ļe˚X+Ԋ7`ߐDxi{Hhv+8h2- ԊR:7eq0S+\&,ʲ )n&td vݿQty F7)HVNCv-;G _r:1qXH=\(ɨЍWfZSA€*hq&t0b7\A &z+mMmTSf;$efQ~Y7*E ~6vb #ȊVE&wWi  xxXå4p/ة5 !S>$} xTǔh V)"ї /-I97h%70awqji{N!s81e%Wݺë+ތ$G4Z3hrB=TlR.v"{*sۉ7j=pW7d(Y=z [mz"ItQ҃<2 J=p*"\ Tc WK9dUf-6,NE 1K-:Uj:=pj5 V3V0Z :{)x8)jrM\V>=29~dh%1ZK.-fxpEM:;,"fYгUNu8lcWcJې [Ent+pBVHJ45Ώ#,C?"nme`ŗ HxkK}DNWC#˲MT`6Yrx `mv$U߭r%vxݰsDa*`CZbeS 51WfvlUT.]LPإٱWf] 6(vlUٰ+Wf*ثbLU٩6)vVvl Uٰ+b͊6(vjaKL*إٰ+aWfͅ]vU0+aWf*ͅ8`WačG\t?:K4/n!P|GlgU-ݜ[sU[D@cf㨙8881Y'd1Sؽ8v[%7'aV hLi7I#N 6>O+ͶhfqQӒ]@y ɀm;XcYNOj&(C*)Dc2N-]oZ4Ow-yX} c>%AfN8*OVs =@kkUf8F(D} 7/RD F,7Չʋh{źQr-&͊[0q%3;mCx51K`bRI12*nӦ-:LqeNƂ[ ]E6# xd dniy3|$20)]^)Rqf!Nስ,1\q`r,,J*+--qM7oqýt83 nb$^CKʎq,ڼ\/sLmDj0rn-}-pJd>H:)쁣cf?W1ZѲ@վv=>8LO@<יʿZaf`jW!=NuV'sq鍻Lsݗ(]vX].e+v]qen ]ٱWeb͊]*Gvl**]qWf]vV(vU1Webʦ(vlUٱWeP죊]L(vQ]b͊]6(vlUX*i®͊6*ثb͊6*죊+vlUٱWf]vlUٱWf]vlUٱWf]vX]?*ÓPnﳢEdJDK 0f^kÛ(7$[T#NԖa^%jZӈ0IێXY.GqZӮ=^!bJ bҫT቉}@]j v8y%.m 4cǑ;?A иF BWzwWmW~cZ8xe48<$ Glym)v"ƪ*YHL*)B*Rt#r%+[l.UV)a~݆:;t4=)_|-] HM<>p%io(ǂTn?XL+ $Ҕ9emԓn`ӍJɴ \)v 5j{aW~=<00 jLB遰+x—bi\qek*#oZ˦;‚%5Ҵ]P@h;S@6\q hcöhGt++Sa6F"ޤt)#),2UNT4s-I X} n=:V`e1b*Rqڃ#`v?'1IrU[}-mRV|YUNI zA^kB:T?b;?Kb;cLT Oµ?lIԏ8BG8ZS^OxڴSİ!!Xҿ } q=iڍAm&j li,X>`N)V^eCb}I嫷/%È+v'G@FY~~'Z -#W/0:=֟*ɮzTwO2/oCn;/YW* /5bWz BlNZeH-pcV  {rc2?4N`B ++ ֕ ԣ|'5¾BsTEgtؾ(ǡ'!vƼzf3vZ5Z: T'сGqTLɌƔ,wbO moDFVUc7 Onv$S DHhw_ǖPi|1BUƂѪ)@EBvxloLRRxĝ?DZH)NAʈwn~\{ҕP'vJ@*›x`T=T6B6lkќs-^tԺ ʍ֙ۥMSLMR#W֛Pʘ ѸW,@5딤9M@5;nDEA=weUInɢJ 5N"A_$L~Uև19T= _l'@=FX@榆xW"e8Q`n)Ӂ ^̀YJ2tcؑMlJ.ïZPqUJ֞.%ùLL"^rQAs#7+j}8HnFE?<[s]5؉#5Ezҟ.ӷQKBR?j=uϏ<7l2lÚXOrbl~b$R gA ޷A$(Fmw d. z MR{pغ-M02% WĦcczYZTm P;mF-=7ZPRЕU-. Li5'*3 ­O^6|]d|^r-2*lC9+KrJHnymNUFЗ04 C}b5~N[Jt JC~j:RJJ9EYi4V#a|d161H]c)܅?|q s4|+i?-\dE9}jk/`C`%'ols TcdI$)ahdAb-_ XB ~mGL DV`M6zqH ͘""T`Z5Yz`oeZ ?3 Rq,A_T(|SF*2+ПX`AsZվqMuKe? weڽk]hezV?irn2 "`xҿ!\eB0y)4mo[!>_VQқWl\'6xbN.LNȕB*X;A;*FB[ Om!qYiNn<]2٫qÛj6*ثb͊6*ثb͊6*ثb͊6*ثOrWf]1Wfvl ثb͊6*ثث v^(va]͊]0]/vlRv^;6)vl)vX]]S /vX͊\#LCdCNpI须SkQr]C%)8لNǑYtqL.oDc F S:]Lc-v-pv[X*q.6I%@IΑ/zj)C ˲~y_/5r0 MVРX c6[~Oe\?>Ir7-x1?B{?{yOm#1QJ~4}$9ziVoIP3O9sXQiW%:P2SRGia(mǠs-h_UQ S!2V=2VFNـAw贷'oclٛyI/E>[yp=3Y961`._BD:r9LLnӜ19eVY4\@6AQ{* JFBK/ 4^*f/.7Lk50+,1K)u3Wu3Wu2(-GMbo-c`aCġvGLEwol7| XW,h XVA1P׾s<i^үhԘ U R;|3#'2&=] e|Pꐮg#?j!{VDm:ꪠ Zn)pid,k}9鎣|NuzLm. D9aM3w4ȖA؄n0OaBc 6vQRbfRٱWeSvc]`Wf*ثbLUٱWf];66vU0`We;+vjaKSٱWeaWf́.LUTLUٰٰ+aWfͅ8ٱK; t.KsQGgUՌb&[}9+/)ie6HZ8R@q"1)<ݫ^Iyu%I; 0X 1Dtv2js-.HWlC"6S`tgMgu^;Wm]twqn@>oV[I.AњRslťR8h u*_|R74F_ZZkFYO`~?Gaŵ BmBU=]P3qzah'4<Ҁ|yb$u@4߮ߔval"YpO*mPl0!=r,Ho\Uv3*. b.b03zmh;e;[aG'ak%k6Gm^dLm&ER+X`fբrv?NQdcߦ%sܲԱ76_C:RDIaĪ(&,zLdV7s_)OPZdVH*G˜NԂ+1vŇ1X뀱1hs9-#]Fcj7"&Mqc5%EJ= 6{qGN2)xp'29?Q,n) 6Ēv0掻2ӵ.C\NK=J Z8j\Nw^^Eբ-,?e 갅=Tρz]r#JVXeu?]UQ^4ӾT9HH,´P+"1M Yc8'b֒m񊃶U86a86vQcfʖn[NsO+r* NQCr4>&;Oa2\e͊*SvV*ث.nˮ)em٫mu6ŕ.ثS;+vVvQCb]1‡eb͊+vV*]vQ];*SvU1C]vlUT]1'v48XUGvlPثb͊6*ث*UٱWf]vlUٱWf]vlUٱWf]vlUcvK< Cf=w2=gogk,};# 0)!v}^PY944IVBz(P:`Ս 8S{cvebwPG}nD0,܀-yzkA A`) v`NǾ@UwYINZ1KGZ ۭ0Mǐ*S9 _^`Bq>JLVX'ӥI]pj ;{VZnC [`?Zv)1]-OdJVڸ&"ʣA@iJ VE =~G~U##RbGUȏ,r/5;Db N\.̸RML*㋯]xVP2% 0+U—c­ToZh:\2|>8Um+R;bq]J U"5kZN.u+ SVNYʇ2v=`dCJT)CLuџMhN1244Imۯ[ Ɛ +CAAuBPQ{*'&wN_̵:W*njzӡƍ7h> i>?+RZ| .iѸWjqT@2M7*v \Si9AJҍ?qƵ_ WBI?Kj˶Gs}A\)Ud?ڸL Pˊ¤ֿKbԔR\BLa]c$vqGrl)TTC1Z1m_9#zz"K Œ @ E|zbQC8J@jƣYvk]b^5oqѺCC>X ė*/(z7\iV$|sEqo~-zԨMwS?ˈFEjX?̹0f{2Ҷ\n1 9vnS,=so,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v/e/˓rvz#FTyy$z}b:i՘Ɇ !庚.9AVMz5n [밧5Vbm}Il $%T4kRkS}SiHrV)0c#qVi_ՄDpF,H1 Pz\j#*w# m"2 $iR*J|ORWڛW#{*BwSZ}Q'TrE*cTֲ$~KGc->9>_Fen z iw*?߮ |YZԀk_g<5=AFf3fփUj")J;xGg%DT:$j5=@9˛"e(oZWVZS.2#uiɌ Pv}>%rD[DaG^Iڹl/$l[HhkJGWrys`GPDܽS\XՑHDB9mJ05eCĄIC(*hT9%ATJSZ%wpz?7n2 Ȁ@dO*TQi%õcn[ O`查Z/1-\ѿN $REA; xƄOw^&̵0&@8:?AMĩIO֛;Aqpxq?hB:%3xdmEOSzu?7tn*b=O%5b"}2aɆ'<a/?fs %h&g9v謬UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]OsbLUxb͊6*bLUX*Uٲ*UcvlUxS6vX͊/N͊] ]/vXf.ͅ]v^vcd'$>Tl:Y+^3W $R]4=PW"nI;VuݣEs;$睖8}c8][u˛Kk,pv:(qR]n}gvO.ژaqZlrL*cp`rRApR `[NQ$LAŜ+;:D4*pN -?'ŭbj@b)MmL΀1mUFa*0F&c+le%g|*rFܜ % 5leW*vыd'Jqhpm(~I-rNYccx0(wyTnmRe6׿m3m~wLn f7+5&oLmȿ'k/O\0ú&&I&J #\ ñ2qf tV+zÉ,;:~ha&ZC/ p2xE=~>N͓lvlUT]vV*ثWf]W5qK۳W۲m٫6.ˮ5p`CL*1Wf*1WeS;*UٱWebqCWeSvlUT͊6*죊(eaWfvVvlUXXͅ]qCb͊6*ثb͊6*UXb͊6*ثb͊6*ثb͊6*챊%SPa۩c\=ţ,^," ;pXҜ wRK")0Dl9WQz;fAlEYHޔ_JBCJ~8+9*B,dFUCUe5SNl*}HؑkJ -d*qlP`FQRZ0Ɨϋ|@C<1g6_゙4sTwlsۍx?ӰRDEGmA d,'ar; +BڸAUzRRـvCPv55" ֔¸ֿh>\֟@9 j|,zGlib[q>/>xHr,v뙎Cۨ.jhrAZ8 JP8 *KXVjZWcZqVhߎ*Nnp1o)o,#aJhMqU7bjj˿LS,Qy2ҹ*rp9MnFB@탌WNScN}^hWlx牨Ҿ.$pt -ʃv*Gu%!ۦv;FW$ov#vp k]~ ~}Ug3#UW||JݙZAs,YP> .kh<=yƕ7$l|@U ز$ **? >>G鍭Yh)vʒCBA W&I[@`ƴڟ;PhOJaR;Lk\h̿ N Cul9T+zLsKEvR'ïcDw,{]I&E bB1b\,9&<6FM#}BE IJ~;g8Ф5 H9|8Ԉo)5#9[)S\ձ)iؙ=LݎAL,c=1Ke(mXqaǍ1bnl]s485O\,m`KFL)~0 EMG|fc̴̬qd:+]N sWwt@Tԣizvk ᅴ"5L,#A䏨*I= @{Iq^5\V=Umj\F6U5?N=B1P4>8́QּS(*vٺN*?ʒҡш>y^@ `f z FSWN W|i(+^LDр&T()nLH^T~GlDC/<6 Rk 71z`P8r%o9NƾQLMb%jeJz&a+M]vjb*U٩]L*LRvjaWeS7 ]S ]T‡fvjbL*bLU٩51Wf]vU1Wf*]vlUٱWeS 51Wf;51Wf*bDr3k1n>p&|zOdfEd;ۮ!“de!`Հ%wO` 'g]ublc9; ո(Zu4ջHy̪ Tf='| }݊d!Ž|oo{GI:nI4jd32nŐpo}֭ /18纓t-TU 1)^S7j\y^]΄uf]~DE}%Dp2;604"xj⥱-v`w8`yZbbhe"t/~QHT>9VdL8⢃TĂ|-kw ֓e,U#xY[/Vs"v\wȦvBE"9\r<*Sx56<L"pZf?WSêu1$I}SaM$]hdlFd;s irAc ^/f6r%1Z& [ bƔ qKˮJم0$ц$ز%}+"p,9-t t{oEXDe)֟9nVGx馛Ane9G\rB+g#0˾Du嘙*[ "B@CwgOND9<$͗fm*oE lweEl#ھ:XZ2 #1j G9">j/#38X޻nsx^V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثN*s? r3c!`=N 04 gSK9œGm;(7 hh`}A҄OqGY65¸j*`t#$۩;$H81^}CR:Ӷ<$wG\EuFu[A(|;9 G0Yt P OIJ/ǧj|`y#P)JjdiHß*M'jw+ꂅhH%{5ѫY2@6Pd `;jЅac#Xӷ'e8w9mq6c ~\ hEI1&.*%Mi|SWKXS\h'}+J :b6mV_$Qv\ I㿏ݍ` _=0VlG)& ?}Zb'v+4:^QEδ{r!.NL҄d=o9gA˒*O˺oԡ1xs?/! ymQVjrjblf\HCkd;p#p5'nCx5wH 7`@o0 ~Ȩ>9 SyK*t>oBu`HJ]GWC^$Rx| im'1GJ]ˀ`KKVZӧ\YHrHhv&lkq;uvmhTU@5;D!.Sӱ]yKZlF'\r_q{t4 )/)ONٮ8煃`p!֜4O2Ӹ KrHrޞ> T9 R%vPH rnǘG#nRAOžwM{_ZDZ { P>|LB'P;S~=kv/"z_̸,{mE#W7'?zd`>kjOb ٿlѪ]._Eiz{qNyV:J Bk_9 jNG33;tVV*ثb͊6*ثb͊6*ثb͊6*ثb&,T6vb0+]SvjbLU٩]S.챊6* vVvX—fv]1WevXڻ഻7m]]vjbvX\RݟTfoV.Ma T/O)LvU2oԻ酪fds!2\uygnJA)',;L2vLy1X}<0qse7wqEI$>λm4c"g#hrer%w:{ÿ30?K}X<`3[@y/3 ۰'?L}pZjoerqtgod*Uq@!.cI+uxE=r&-6G(ڄteqr 9{ml7FY~]A;Sa:XO„Y`7 ۋ8 i؜/)G^pJLѾOTV=sFrxRwiwoO. ^:e3PSس M$`Kc'f[-[QjVN1WeE%f0\P q-Ik ၍( !4d^n13y+Acn/yqRV(aƥC2fy{{rɺnqaL E{rIe$U\ ޝy n`=sU#*C-i %j`I0b%Jcy`,i;`Pbp2viZs\̱(xђ|"f*rWqt .+ vl8Z8m˪oŸ'ZEqwl6&Nm oĸ pvŲ+atS-rp'fu4ƘJ6qRaڸsviZL&#þH2c60ES"'"0H\qAk4\ p\#o aAs λdIkHnBOz-^54Uܴ$z8Gd5 ]5OL؝knLJ"֭)mbK"m|?ڳgBZ3<8g1,kL6{- *.xfsvjaKS;51Wf*bF*i]F*U٩+vlUG;6*R]\ ]umف66ܰ-5qWf)vj\PUٱWeUXUX®]6*beb͊6**a]8PUٱWebf]vlUٱWf]vlUG+ 6*ثb͊6*ثb͊6*ثbQSC"DtZvLe @kWjRubङ|?S {d*'4*kJljv% E:` :zRh)BR= =JCDPQ{SVǦ(zkLj`v޻i1>hT r=(l^X]M2JH]6*>T[8Pkƕ6UiC@ʵe}5`,? QP٠^!JwLfuh'j{xҟH#+JZZWV/N3i@G{bUb~6*#U{IH5I AARV$h߫ CeA; Z/ ֠go\PE1UT|r1ײ4TS(z ֘TM^/DzW`Jۨ+Uڂ ^["v,W`VZr *#1WW3|Cl ]$\iZ:5!{8QQVrBZs\0ZS0#ha?@2MpKmcv%lsMUnf ZF lAJ Al٬&%-MJ+^r63(5BI1. w,IA<ToC6Wi=bLWd;ƴFPw "8IbUS”XQ^4X΄QO?&R;w5x ^UP;o[oOk0 -5؊?I!0uS Io6>$EF˥{CUZ֠}Wo8T%]=~AR6yK=o0[zj|(Rxۏ0(W%! 7nl 6 [r5*GLV#`iO|m\Aj?bPij_l*B9;O^'GTP:}X"3}c-@К}߲FTf*R{c؇&'_%Z ”߱"r)~)UqԒ+C^v08]?d;aUF ޣrb [zo"XB+<kox =qPԎ_5V#$Nb݇On-bwԫ !*H(_!d ']SN1Tfv:s+ NNf<3+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcvv_OcO5Щ¤]WqL)AF9&+=*)S90쇘R渶Šr90߹25[ӯ`/ENᢚ O䥺)F˓H64?yl*cڟNALkk?7ѷ@kS*R8OVr SqA7eC*jIQ_-cX$ Eh &W41jUqZcZPGmP)4+Y^R(v94EX*@ùWPNv0^Ԛ$~Q+(u9lZvFQuѤ`c6hI$Wn)I@nYCJ S)pHolbic 2L>{Z:ԓ˯0IeGW1Sg昍R:zc% 5W'n"ly,*RXO"k 2>JCq8҉锯iǯFf QOIqې„ ПE-C,w+k!Ɓcʕ@"@#^JAľ8$3 ȋ ]ʵYH⠅;bTmR;{acKYx+CM=,2鱦+FoӣVs<\ x]ֽ:wȑLAE }R>׏^aGRWI ⹕)r_ A?k8Ka$*CR`&=("JvcT ]#NRメV"=E"8+-uƚ yiw SSJ qqizbъWjmhGQz\<7A$ro΋H([cN."MIBe-T|Q7 qlh~:}E&n%_qP=-,査,`7;qj=@6b:ı>OBA#-,=V}ǫret'`}hod qDke8DS,eJUw~MBv>#dZfJOy~ǏUbiG_e4YVr VٰRec3q;JnsTwT}  CFrEQ"m;fjv1-IT wie)#%dzg,PT<+7\pca;oDtNƿڃqR%?ݾlc8*dn֩^8 \ZA lYM:ۿ_˘)XU5 6L8ևz93è<*:o㉩nJ?cGo۵/SB~=+O+(N7{d"B"9-J9Q_v'+C rԊ)7xPRA&;\$G?EP?diM\ 7Np3rXb͊6*ثb͊6*ثb͊6*ثb͊?6,T;50%ٱWf*bʦ*b͊]L ث Uٰ+*U٩8ڻa26v;66Qb1b,bbH2MeXUxSv]1Wfcg ۰LS ec`{S#NA!mPv^J9e:l؝C#.NXV82a.㎻beN':23/>ז s,6Lc5c2aƯ4e QM}O8 i9Cħc0gG:v̒ZQ@hj+K@7an67v rܿJ`ۏHr1b_q)ny{bc|FiH@wb;>1eVa; (xƃa6PN;kE2ȴe9:;TӎdTf'ql%E\!T֘!QPK l%N" I'+'w)b WlY7cVĘ⫀-\[50vXٱCvQUA)v]qCŋtƓqőZZquK 'q$8SMqcqbV0Jb0Al0&JrMԐb#qʍwPy ͹2ҵGQC 3&'ϺX '94b-ӑ;7:i#kzmbcȠ3jx -KPphia03-2-۱")gZd̕4큰rv)J# 2k!|S$S$]Sv4*i\U#nT]\8P8S(Pbʦ)vjbebLU٩50+S *bʦv]1Wf*bLU٩]һ+vlVݚS;*һ50R]UٱCa]E(~js: n`++nM"&Zq9A.,݆(b]ɱseرC:WGgI :>P}3IvD72.q ]WA'-sdr%`Sviw5r/FeC_,~Oi5kfviTJ%25-rs=Z9s? @KPHI HJ`"ICPKS>sN|wj{=Xs=xa4͐m ڻ`dbJi8v!#WAحcH$R}V"X3ԤA,MI;@vR2]$;-v@ʞgrvNPnG b@88wlgPs_C?Sӊ-,I*<~vsMV6Ȭcr _GE\rFw;Soٿ‹SVh1&;ıހ(o^?,3E Gc^FPTxQZq^\M:sUYAU"3F!)eVQ]녠 ;+|RW3f+ *Zv=ZkZlE}oƳڧ_Aנ?A\GzbDE(j>.?崁 :q&?,|>o6,&mMք޿W_4Cu?=>U[`!q֛$(?6o9u$6Mڲ0HIK"Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Wg[sDz.E=GN+!27₀n+ߏ|i򦔪ɺlLS}?,apk_XHUI0,ZnzƲ`#ccWꖄ+W۝$5=} Rz@v5SȖ!^ @\ M<)Ly QOciߘ 5oEA~x (vU=2*{}_o/=-yV6,3R"xO_jSnES:aW2 uɶ;E )M)ScŬM6+U#cɨR:dP˱ŢJ8;6h[qݤnAx{d$Z*^ IDyW`GQ0rg)ػ=[X'O\' 7'.9-ZjK]vb>mL@kIUR 5?@ˈ<~/4K$qVq45&˜_QI;m; q,An"r)~,\\IMW%xm^>* њpӑuI1YX,+܏lj=[e W:w<_j\[6S)$]μ֌nSt ZPl.6u> ̨LH0|ŭXJ,J(uoG1,+ЁV}`.+OW`i&cfVn5=)%fRN,2+m28 Xn6]S*?Rwsgсt=Nv#G^7C0#l{3J_m 9nHyV|;;#BEzd e$D!h*vEZu,{`wA M ZyՍ07dWı=ʋԌhZdR"RbL^&qKxqdcdUpĉ«4Ku,`Av]1WW,%qCRV\a;FDv& 3;(m.QUR⊸ZNvc *JP/9X*dMA9^RY) b%[ܣFI?pi"&KG>﵌C E?LLopSŷ'-n&WyTԷpS?dL/S8L\-zo-v }4mLjztRr-o6d ?| [&8 [Ң`e.Ő;0x?>fGCҙߤ9J)Z2}%ϐ5VEB@|t$ʔtѷȹP+[b]a]Dؓ@ XU8Մda*+ֵ\Khm@iң;(*oUE0bcJKbcJ+:T—fLUT]LU٩*٩50Wf]vlUٱWeb͊51WeSvlUٰ+LUٱWeb͊6*측[r6lwdHӖE{&C#j3%&ӭ;.4݇1 ݔڸTfW9WĦ?0˃fh0P/v6ÏvCvRmv W `k.\}eެ?^YʁA6B5)LБ9~>N/?/ZQ.YUz8< .8c&ᥢ mXX1Z`7n(Aj61z*O>'v2u;0nP ͘ȋ‰|hDvx[X⭌E ;)TKʝh0I d\xǩYTރG,]:d$8= q,jJ|T:ΕNaw mP2-:L5kwUmEEk8_4i2S%x8Ur9a\5],{ǒ$1| а'%f1nAZ:aEg,Bk{ tVcnpjq5(8x+\$U,ģoՓZnY-EĜ4lLKH钷.%a|6 1CcqBDV'uɄp9 *or#;I0+Tlj;`Zkزm\/@;1ce+ r\ɨĠÿ6? 䞂/bz`mv9^c!trD",: s/De,n7sŃwataR|ڇzN ]LSNLʝ#FE;(6FƑF(v6]51C]UXSvl*Uٰ+]W5qWf]۳bf'vUpW5q[vUqWfvUqWeWvjʮ*];(ƜUG;(] 6*PثS6vlUٱWf]]vlUٱWf]vlUٱWf]vlUٱWeU9Ю7hs z$t w(#w?9Vcz,1@ 4;.2'+ Z|b1Pb$;Z=?h- OcmHcR0ww0Ct+=RY ~µw$amڝ+m,-Ҕ?>Oد$'و=>PUP/z2F޿;9S# 5?ۉb0ک@4:t|eץjhkc#CEڣ$q)…!d ɏogu H}˅*ѹTuAc\4=rBjj:x>`K T(?eb5R~cӖJ;Wsȭ6zTTvrX9t#`kٿ*,nv?iO9J]J$#j|)h.B'SY Z֪jQ`BG(k]π-9dRZu=J)`P6+,205=\BN0RWHū= ONr A~b`8Bߧo-Aqԍ?V*Ԁ'}үIq?h*qbJp$5~P@I܊xx9.h7$``ko򱒀T\~O8R#,}q2]#V6ߨo@vr+ޛe®e<M]oeʒUbSaQƿi 5f;EG/F%A;ƹ%@_| 5a;JPCw~dz?h?c's2h2lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeUֿ*%ZK9h}NΕb.їI.:]ۏZX)47CoႬܲvoYW fqE5=`js؋AiWk- CS|y5k%XO} u t)c, hilgvbEqVf^&@.HMX8KbTUi {cǾSSdG&DUm7Āb64.>& pw9e[jӍq7[`j;eiCx Xݸ33 Jۯ/ ژp&%~$s\Na7nfZ7"]>X# r'llToZ@߰ʔptZP7аj.AXPUZ]LEDR~jSj![/IIU;; lUQQ[kjc3O\tRK)ZZקlAc ´ G4daJ)Z~pҙEkOkLlBWWBHwx}L] )&;L_HҰ!oQ.­`q#s;c Gj bҊR2F)lmOZi#ETwȡMzc*)#z-%ajស.r$Lj~Y6jdye_M5_5 [e{AY4'pi+V`;֘i\615cՎJCFBPu9I;|vbXW,$j7%e2H6=~qT/r]ks}e1-!*s'x Wq!90f](=Z(2@8;ԍʤ9zA4!mEvƨ@R4:A˥VPS<7ħpT9Ejz+1Jw!>8ݮ`9Pr}O-Yz \o)R]qބl1bԱ?;ƽPWCV lkGNMklz!V`_gVVǧ v*$XmJֻWo=w#mLyr;Oo4雑]35n(!=:ॵ8@=6\ ~3|۸4ۮ%(`9~8Ɖw1Ҏ*~V<܀ Tz),T͊.b]vc.]Zvlc9O  f zNDتr&Mdq6 NŖh%FوboL!Q`&n##Į;UDUjWs4:|FɇC$˦* v8bbWr^>8Cbt |2.O .&tlt-s\?NRPtڹvR;Xִ1v9EN5vJ^fSφv[iDQӑ#o8U]޲ɱPI~?6D)-:h E}7@! RIR@jW}$8noi-t}ĵ̄NDPFh6B׻d@k;+=:r";L|dGS^ըWLci6<S\ 5VPJb+B*R^12سEGQN}q"Cw0p@%.S׀Z9\dHjm :V"`y0$"PŚJRcؙɱ-Q[ĎTfをIiO8^ \W`XR׌I,-Q~/r^tkp-u9\ƤbxrnsZV|A͹;}T0SfQ]yLvo5:mc, 5(d~!aFhy$ !O/}nh;oLe"Ty8*7ng&BjƵ}3vN!Ąguwq,TʋH5.%EE;u g`ye?CLMe3"8&S18x:Å p*u3W\$?kg7qSˈ{,#apWJ osLU'`D`kvё|TrN<9<2djOo1'[!>;g;'#w:+,w}a#DrQk[t,ɔmQԎD5Y&D-PTE1N8W%d#֏j2Dk_0! ݲ$"7idR?_Cl?x¾zuݴKCJ4$FCbEqM}iIxBj@03LZ2@*I8'CC \G6LB8byy9^sqℇS&?pd؍@X$C ze61%`~YcNزh M(\0P?C5ɑɚ.6*CG"f7u1x;- `(?T9eL*I'i(s`%\͋F!OJ+K1N bQV&rqMT#d6PcGZӑWr /^ 7A`JbV !AZOjZS(w]0ZI۾%Pq}ֽ0/s]czMWIrF0AB;m,QB?W)ç`B$_TK}8(`ߥ~x XLX-H!M 5?帾k c>[yƔ9D˽7oS>  MJW L(ƙv5*RUql*0Wb>i.(ӋX͂V"qJ*; ,o]E4;l:3wGZ5Am:^ slqMn짐ڄ2ڇ7} ` X.!)PVLWz==_Kbo Pő+rNs v؏놐 bMAbUAi۞ҁ?yCXvšZdU'Mvd+<@#N(t8 @4v'`z_gE!ш.\UTےˊ (܃GzO|afBeSKU,([$eNƀ;o\*A$ُ'~]}]Z)*Vùߗ/Ʋ2]u+bTj)5#~8FiSN6hL4{w\%46GZWSԂwiP_,*LJ&TPP I@)č5ĖQBwaI\A;~ vڔp*ЂPP)ޠff y%X.iPw j7lˁW;z/Td5`h~đ)j5_0%tnȼ@Yq.L5pO%IT]H+Ēu65hH`+a+:wI~U*P PI?sní?B")9A=n3DYTLJ ܵұ.|ͻjfg2OPa~.3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bιk'--@x h}n\=nΉhJȺiy~>dtBLin@~w%*h~&\ܔ ;eTvSe+ TkMw\R'fBzTlQ R#E=CC -I2DEā27)G`>QRpI%J$ A"ֵxS|Hꈚ٫wx=AWƲ*Oבiz1һ|_7x҂8\P9f`x4=n|>3r4eN,(4la+uֿ\!d5rPP)]9^Hi䋒, kЁFI<]9?Bç"mtizHCw؂z퍑* ;pH+NDQ>,lP|@x%?"UچkΫ_? xA~ `j._Ѷ(ՕJ( ;xa(ꦲQYA^ԧ|Ȭ ( Q۱ycr(tR PJ~~8^B?*{-Hҿ<;pvG߳鲯*MM~B"OP Bo㈴=Zcshj3*HO#z Nu+XE egv@Rt@I$Txl Nx?4chqt' ۭs^k[BY#I34p1G){sdBdiH)R#߶+N>EOK:tTMq7v &0ևE+ {zJӶsmDN<䵫A N7jOniӮϗfHi967Qh?߿\e*7&|R5%Ӵ[9uvҹP’a6H{V#2+J{0q:۫bA"k e”Or aT|_YiNO2_#jmWI fEHvV%5,$ɤO1񩨨sJwBZXcz5 ~N1ק^YE(QFZ?.Jlv#+;䍌hZ?g^" +W6;;ʭN;WБZ㇛iIGAڇ.7VJJP_0A8efRޜMN8P fqV#uxu 7BO"PБ׾UF^AI'n#IRv6r`ާ/ Ly'4(j5bժ{d5J_6ιHĝ*FۺxuZ=)BO?;־8YǹL;* 3^0S%$^B\ Y5 4P8s\a΍ަ+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgE03}S銻66 M;66vlvj`Ӳ,&F;dLD&ز[LD, d 8] آ dT(iv(0+`K]2*Qp%ؠȥi޾~0|0sfO\ن*챊] #zlr-go J2F xn+ t<șA'+6'7>9\ݖZbNH0.uqW+;BBգ=HˤrgPX ,|{cŲb+S}3oJݻIL9h+!Trd;) N [@L@wĒoK]׾5|SQ8+^T( ?XZQ * - m:W,;n$zԭ*=peL$XQL)/ U15툲z䬏ǮhxJ%A50%uqqKRqCd5yɢ\,.剝 \cز rAz !ȳxěWcqWe.`s4ɀVh+vFBFq­\$6%btT?!G'չؠD{r5$QFeDn84,OaXh(;[\4fesb. %#t-KQ]Ro"Dqsd>:yE/d£I_PW.g*_FJI |2 )+(=i8ȎN$ VI k ۾d_vsϥj+{u#3BGa.|d\ bN06b.*({,݉ZOy4wW1avH0sự嫂gm&.mi%q7ՖjTZW.#w_z7|LSX7ג2ڜc_}Tֱ"EDQEUlpwh]bIjҵIMOmY,8h52RPWQc*sJ_N1v02O8l`IL4,B[~LDn:\<\#Q 'jdW.KחHn#IR5t'\q[x›9/ԺޔϢDw+]NQnB2i#W\8hu̐mDض˩›j=; 5#H_Ǚ\v qv 04Q}p"\Y^o&M' <2P{ӶI8c"ߦE.Q\KdY;I;u^6DfgwbɱȷǩZww:Fݑ?DDE~c6Zhn㉜1"K '#lr6ʝN KheNʮA& ɆFƑ(]‡f͊]L*PvV*ثaWe 죊+vjb]vQ]vlUXWf] +6*UXٱWcpٱK(vl vlUٱCb͊1]]vlUٱWeb]vlUٱWf]vlUٱWf]vlUc*rUk~#ӕMM¿>UiMn9;/ȶSRhza&"H,CRR%ţZ Tڠ?V ݓDG2@n VlVUu~,)ˡ2;%iMZRyTn<*̤ކ'8pJިn%h \ ^O'XO(B^ae'ďR (wpqDx<{N_`?Wۅ< n+?ϾnF3UO ¢Q4N<\Vվ0 =z|_˄+5z+f%Rµ؎KXٸRlR ~;?d>?@x=;dU'JVv?rB:dXhy֔59ՃSq؟?j Qolр6] sO[..n;(QUȮ!fjҜH?WŒ1(;ח.> KvhK UVO~cCP?XUV@MO8m>…HK+Ŀk +wRw̜Bm83ORsfDn(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeU*Y㐁@hsv}WrHi֛7C zaͱ7Mw`%2>|Z8? ImѾ0)BHi]elK`U-N ')W@ }1!g]_*CV+>l_n#+u0dZ/-Qn,B$Y$qDUaXz{drbIMف++ob:oZ~n r߭kx7 O":S Ak#@#'q'Rwo:{18Md;gYy7Nsm!  Z0D$ISڛs HnؔMkLɈpޣw`+Qnv>*⦣pYm?x.;?V Ljr ;}9j(i߯ LI|%SaO<`:'zFۯ=̕&b7JMM '{0~ ?Gp:rОtWA\)M;1*Ga|0\UE\1~(Q_pXboA0oV m6Q0SdM=3+Of)vte9Yr};WcgUlb QQL& «N )ޘ8 =0!FgGq:c$ qcj ,帑@Z(;:mwV@IfY,Pnv΃.!H뚜;{(UIf=>#^ uuB%Gʋ ;0V{Jf1הdo^sF}dCcIf!/e'DoLȥs]ʴZ7j+~Xrm쀫zF.3%΀S@n%t\),~,a52#(ib9:}@O|d6MW%Xu5H!*) >5ƆhEGFUE=AXJٯrg$P۩U!vq@סûURWrك_AS1*y|+k) X D_s؃$0]DJ((~Dڠ&q7nV> =S qe/Zv9 m$BHXAR{D)~D+@߶,A5Gk]Q]2+ڙ2{ڢ,솅j)RyLA^=|?V*z&|R'h'zS{ oNf$SG yV?ےrǒ C[T@s' ; 9#`z~񘝑ҒgPIWf]vlUٱWf]vlUٱWf]vlUٱWf]vFF)N]qM;5pZiٲ6YӲB.*dmA mv ˵:IA;]qa\F0aű2|1ܨjEPqMO|&S(ўbRATW\`UWW\UZ_HVŽ:bg1d>,V5a$16;Qe+mă" :lV -)*[CyaMp%LKG 1EEDD}LX(ć8)꒞>աanϺ/e^L8 GF8\[x|?򎧯6t*,Y2;w#8L/.C#?`{G"Ii}Iu4^> ;wڷ/=/.KG>>͖GA)ntuDG?xx/q݉)4Z To޸X륍I6zǦL`Qhuw5_ܟJ {?~kuQv2yo<Ņ-x]I%(~9%jw݀k0~:F,œ<ț ABK%Nۦ[tLVqޤR u@F^N'g7 ; E0b2 ð-| !sc80RS0屧##n`ؓkv"Xᶗe80];/1;%WeNk1v`.$Sx凉x]LIs[eivjDžٱvjck1p+ vV G iv4mx]W^cHki-x]#^eqׅ\pZ50)|pӳqhehcd#u8%*ݮG[Iت)~4hNrI$aK9; K|Sa6\@Y]JDP )۲7?6E۰R (7qbeAnZ8mܷҒKWCDC؜|!ƀN;FbC>bR+T.ۊ1& ֕uTfdC7/)NyU lO^56q{wzjNGanK}6AيVmZo @j}r=0V$o{ +)oW9\: m~xψKx o)zeb#$HFq..Ahy7;O!yS5yóϑqDJڤaYQwȉo!G?"{98]Z!DmAK^%{as֙ؠv7A4Fńh58 {w;'`Lbrdk]8֎{'u'&>(=b! ;͑N Km.ʮ*죅]8ٱ;6H`倰.dk.ƑbiPiXb# 6(vlRثَ*UٱWeUٱWf]6*b]vV*]vQ]6*죊6*ثWf]pXb8`Wf]vlUG 6*ثb͊6*죊+vlUٱWf]vlUٱWf]vlUcvjr̽=Ba%RdiLēчb!c` $Wj`Hv>&hj(z`* d_*zWW,#۵AXIE*o![쪣$!aeI2OC]'| %Zm튣g֕mp% pTLhPBCB:~5 ɁJ <7 vj$W8~կ 7o@ 4"& `T *ԡe9.UH\CaHmVt$|B*CmR|p*߅ Z tq ZwB2^Vs/\/sqEMF.e:FTfaCZV+ȫsD0NK Y[}Uhcj1EV:Jmpd )CϹL ro3_$X4*eJW5'oS@"XE0ȁ𱠩{f9sJicZ*SPZ- vu=G_mϾ4C7;N?SmB;5aB1$tO`XΛSp-@%_1ZE;<kd&QóY@RR#W$Us0 $o_oS"Rҿ-NJ) &9 nWL2F+AJQ d߷CxfO;6m.h’SHb7 -;Rc!8T(osJ \#tKӹ[ X;"N_,~ۦF])ryOTf+ӷlN nLhd_U$M6=:=GK|A+چ9K * bTx]*TZWu`t2ʺ5N~@f2Qk&(Jy0Sۙ +Q>/ˏN̡⁷"Duqh!QM@(g n{!Yvr_T ,R(JH-H5-\2ANt*^_,JXMGJRRQe@^GޛaGn)_ڥ|:ˌ~.Y6!ڵ"ߘv=׍F_/'3tҏ;^̕No tpԆ<uQ{rE([\pDb, vcOAp@&xW c/@ӡp W$wXJa+C]Lm@# t#0;myt!AW\z'F돹rZB Tܸ -EEvq Zu>?cɈV0]8AhG {!p 4m/O6_Jٍ#(wƲңi;&ԣt5v+q5HQ+2;LDҹ<)CٗqQQ5⡛Nj1oJog&9ze$ z+daNO78ƏuȘ{%[,'}.V=~~H"%UUIj"}-n<$ŒV/(SᔪCn?kIݟ~VglQPֿO)d1k?ljҵ :e,T\٤<cU}U546> mnHcU{a Z))olx@ rMu$fN;pA"w·cmkĐP|i'jzU 6<;XWcT'caKb͊6*ثb͊6*ثb͊6*ثb͊?>SnE>cB.1c`|..c0[!bfŐv<.N. c*챊0%]]آ v8.n>c\nĆ®^}!ؾ[4]  \܎~)oV9aEL׮9l,^SQv9XP]D*ivO|#H.2sGj ytUV^w|F\qq<\g#7miW˵i~+3ީ 1$ijIUQ.p>QR+G0[ʼn8B݆8&t$H|Q5Ff>Ҽ74*"|0-V̀(~LMRC"Uzl6A|/eq!Vm53r_݅<$emh >.>B!CSQc^] <|Qa10n$k}`{=ǺHi]'][$?#t$٢S_ql*eo E4J4EzbCL Z\@ŝeqxʼnXL2L-צ-z %MȒX `)R` (>YGNf)W1⮮7]\p%LIusqA--P"&7BړAH+ƕ4Zj^1J|ϧ(m`OX.G 'n Q?%I![vDbާmֳڴğz̈@CX-4*l.TXK=;kF>Xi>@1DƸ̍+P1BN$md;`h m "ֳq5J&VZGEVkY"8~s9"pߔxFZ ֱu*_ '6XsH%&RCC :@# BgG/ZrFgU%+Vpzd;GW;"\IYGwb-v3v)M+NQ0;1TdYJ.qcF!070Z+ _'e`mŁ%j &66&4z6cl]\xp8.f& $bmrBHf6Kq^f+a\xo xZvW60)OG pćcITȺFsT[Ly(HU*mN;ɽ@4/'n=85+Z6evlNH_)۰tQNT;8&OJe*h3ϫ4Ƣ癁ff$o]$*;;Ļ%DZLXn0r11zW#7\CB0&$x 1 H 7B'"7\ Z).í=h %78ej0߾ |sX2z.\oÐ{/9 ΐnbLSþKifNvF. 12系,D&v:O 6@LR J7f:dĩD}d N mlj]aXWVK/ CKCJBr TbvªԠvQzA.JыT+QA+aeOzc)]W<:㢞nGoB$!k$~*1^rdʟ5ȩR{z@B?;B=&!WD|fH[@6Ytyԇ_cmR\(sb;z׾v!*q*b Z3.qV.iAcZ8$t=* RWᅲNGqʛ!#CU27awdoOx^v(jM<9f9.M 8*L(<Mwڵ\T# (>FB$ O!N,,)Qˋ$ԑRk Pm_b@^@-+@CWBhCCF%( &6}dҤo?̹dZJC^v4*)m5aZ {n4ؓ_lstn)\+ZJӭFe4?vX}{ 9SO(QUf@h*oMR?:ZqY21R}5JcԻ/&(S)*Ps̿X HVӐ]/Gv?ayqD8)+ #O/PVz9E7U ӡ_RŐz N\~^%N[0zUVRHHFm@k}8R6, To~MSU%F`UV:kޛ9՗Mv,cM8Mt5m N•X|4iSJ@w$^ՙV$а'zPQ6ڞx6~NO[,(5 jp  6oYABH׸X̪~q^F@tXzdhbzbsFJOQ=eVEVa}p#F*XxtɄt FA1B}~3EXF[7_6y ob><.hpHf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU6jjn?\vvvvPJE+ym͊WoN,ASZS(c + } w;,@2VےH„jzTԍ^X` z/P1IeKBRHW}@0; V5)ȑbaԦۃ_DѵNEFQP|w (iCxhZcbUŤj,*RV%ab~4 _%-tX ~lMi !)qGB h=B(Mvö*AZ! -(kYKZRbc_Mɯs9PրB1tˣ\BƠ`b*rパR,@dgR~ȟD>)fR%u+2_َ8UH$ЊO ` ȭ5 Fj~/̴S@C+SB>ݷd>k+֞qLI7hy*m8AXcOȈeXݺVT܏G Z|Js\rrm^)=BYX[:|zWrHWht7Cnt2e^M'yBRg7άrzp8Rثb͊6*ثb͊6*ثb͊6*ثbP\Ʒ:TdmLj[1c`TpLiLYSp2cv8 peee1Hv< v<Y;0%xኻv;]0+r%.Ǔ!.\g.¹N^L0]1W`9}Lrqa֔>g(;LOZK5V..y (p7^T 0%ɫNkV4ƙ+n>YJ#RQ\:+IgvW^1?bM?HnZ}I-{eqBt|uG#2Sm_ MӧKLfIܫ`z.}ڤe E7>/4T}8-2QWPmP`{3wśTRVDK%3#ZlLJV/ݐ"8hHjjHAT` m} HWCA_l qd .vGaehu날;-eBQ d7 --k~-@(Kjm"%HImQ:'ѰUY9|'beӌE3U^֘U)S\Ra'~X rPP `/\.z ` [_Jtƅ'*q4 w4vQS 0*@_C+<~ЦM7@=qRSD0\=a6!IUÒk%*(酅bii/([DC-sJi^R'IdIQQ㏓Oh[;[1#lǽqk%dTVEWnOoG_M yaL+k\rq K T89/6W%eV\;~;1$cC/qd]jwg Hdx2J}M1c}vH2@IZT/L;57eWb$W&ŠLv kSh.jpR/EQ:N18ߋkS4y>s'%>#2}o^Zt(9#y7;jE v9 ^K<˽|sЭ@e["،.*plb&ih7ZJs|2%Rl>Gx~`f!QayEql߶:F{fyfe>4!b?&]c1B.%W_c\iE`Cu̘3tI\BKAN2 K8nSdiVP׾KĶ>mP"nqc,[Zz3mzS2bz3@NJ/`l)0W 9~Y;HGɨbBzq}_ŭSԬ:8-Vzn7; ;NH/\)ݭȽq:(U{Rw%h`T;R/QV ])ZqqVZb-{ajS4`aet?KXkZ`{}vaJ0wLhh{ֵBҢX +^a^ |w8&i.P?chY&y01>=~XP$x8ʠ!ק8,:lXpE(7.PTMONثldz/Rw5Ĥ$_VH*=FgӍ,A>8US4}N,7!QOɱU$i׉PIN?\&HwQYiXAq Ss-\Zt(~%{O[tOR(t#kJckmhH;TQL\pA+PI1(Y!X\7EbX4sj!A1";iqĪ$ohŠSTx9h]ru-7RIޝ|v.E-l ryuR(?|;>{bj8 )dFb&(p7k(_j6r*ƥ+,v4: ŵ$2$Tp{|zFUێǦH J&Y//x‡bȎEdw湝K+|A_ cVĝ2q G.됿(OYJo^Gqy$&q k8wΠl̃&[)Xpd[`kX٣b⸴3C)cNJ*AF49e-B:k ^Qm I':ogmorϱjdq,/O >Nء=>W.&*vao MSװQ;з3`vƿgјp kѐOSx6*MB69-$ xGz}}.hzMs8vJQ}xin E_@qZ$l kԕţ}0Fp*EGM7/ظ޹g6- MCB^}/Ʊ9)OhH[ "˚(=&忇w6>UsݯB%(@ڔGE"|ʍ##Gz#:ߨ8Wů3"k_?gMvH(_`w!8%ᔟ&tutI7Nǯʟ)*7nJ}b!>'~$V@ I)~]q&`%⣹?ƿ0 =/ z2%(؞X8Q7=Q7}NQZӽwb dwV$p-Ԍ8YiſɯLlUZ; #Krʜ֠ocb ~Ȁ&2_s#:6 .]閁աMCC&2`qlԌ?ALW+4khEolL#ǯn)y)1B*OO`G_4'q):Hj( >,.V5"1MjBxp>Ls=Obӥ dlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg\÷iOq@Tx\ |qKp+`dp..́], vX. Rx!p2v;]1K]W"b; |̓]r닱4;1K`w8Maʀv[J#SL!/0,q7`)d:ٛ.ő}1@nwv9rv+ Ivt=4rA>_qǞsglGV%>$aRMl2ln@>-"<=~ۂ+|bdK$q~/&`:.[Lr3G m6;I-zШ<*>J2M YJ`0F~cɟgVnjv$tEfmހՀ?]R|*~\@z WYr 3?x~%&+,|KE'4[5#$v(x76!; r)lW}I#1 B8ZTd҈D@Ȗ2i.GȆLie,(DMy Tc`d\F  W%68GY$fa|=lZ=:;`[mQxlҳm$EvdlS^7"M,# }Eh`D|s0Y9JȟXN\xz8g.4ebi_QhI{Zҝ\VZs!/g焗D.dn?ִG%o:0gtIH#K׃lO2XH?߉3!.H5潿^an+=89u1o,'2(8L `\ac dJ9S W`QRQkIţJ)I"f)4(0S" 5(lN ⢕5Fi((U#s3/l*qa B0<Bd h+}e zM;>dVR+QJgKoׯ7}i;xKwz֖&y(\/?Jo\i'gZČO=Ij W/DU%lRMe[wv8ꝰcSs )J\cL;܊b2HY-݃cAv" ,q$qX"\-lA؋mh.(D),dNǣ!b"ȇc[l,cIcNdžl .AEbn2Aqv$[&|2Ń dHK+alv<6E1ڌ]A!:Q.d"S bb*_?|.zM1Q^VSB1g2;dNltr;$6 Tn(N2踲v v-&Yg(:[(v#/a%~~$9s{ѻ ;u=0+)a v&+TJ0;.˶J-nvIqmV2@t~xì&[OEwh#OQxnr /+\~(>ʬ9䇘kF1)qY7ZbmE%w-',`Y/ľUGuUI퐗&y$* jk-z%GbvKؗ%&8>) K'N8 f]&P|Z">#\R2n$^ _yu̾ >ZڒB9N\3"\رo4Rn//lh xVFA/8qؼZExO)' j OSj" K3|s2["QM)qbHSӈDIq?[cXvpVL!.5023tYٕh?<orA6)>w"x`e*P`-EEH>#`K؞q,, ZhwlE(<320SfҖu(YI#8ͤ ˧`p\ |D/|K&\RV!SvLC"iȺ)Ď(T2N4~dyiv%BWĞ0oihZo.I DM9nw0ٔq-j|KUbeG2HY*DB#^=3GwbGݬQY.M˲ zܵk\=0v9se 0X*죅] ;,bĻk.j.dɂn$˓F*aݔF[**۳SeS +vlPR]6*UT]S+vV*ثWeUXaC+aKCKCb͊6)vjb]vlvaLPmDbœWeaWeb͊6*ثb͊6*ثb͊,bǖoBAO=^'}.VuGfv@-7c 3H?I FXTNCCA* m HqS٪wE-`/0I$]zdi-P}7 Z:؞ /+ m'Nɦ낡hhI^=2Xbzx :jxr*⧒ Gp-(W{tLLc^$_Vҍ`gd*@;)^ԃ9G"«#]vȕQJG8 sPSB^Eb7;XB]ڵ*aZǙT-)P}^*!v큍@OL]-wj€m]b-45Ԛ6%q烙PUև:o"z ;_T*Ī aj,09VCCC޹LRI\pRVQMqKDbI|RkMŐQ+6-s.J;=]9 [ @4=4|\) Ⱥ:Zwm (? N_M+y h.2IOi7.Ҥq1Ez/bjh{؏_op%YҪoOqWyEN#)?hW(*Ú.bN+%(;[M0/6}LxGF7eZsu)ۚ, y2 A\y0-;ű,qQalBA<{mC4O0 (\Zd5-G{/mppX119Ԩt#48"븯SuUybl H~`גMlӭw s\zJ)\tkJZ/_RӥpHV`VVz?I\u#qrvlY%?j)r$cKw"1 MjAS I$ [Sr/ PDZ'Q]H5fE]uA5FF w_Wf]vlUٱWf]vlUٱWf]vlUٱWf]TNbc.be. Ut]bev^6*p+]c.v*"Nw[«eE哰)k8Uห261HŜCFZp݆\DBTyI; jn\;*q$]u2Hv eB@rvhk+8PPLқ7'O:ֹƭ"I+hz{^LjX٧~b";L NdkC1b_.Ɓ:}pƑa}R@\ 'Wy)^πhmyn3J& n،DҴ)N_%yF*M x׌+TWԞ?KMRP#3"E!?S\u:,7}"Poqᅳ`fD'|TB”ːPCQbhEy4o}" [O\3OSE% FJX[l:1Q͵;D er2UF ;O*>s.+v% EM| lV2whMxLcпd%*jɗa%ڞ-׊NzcXIi`(?d ?/?oN]#Pz+Pijm C;QR?O\@Y|?4kWr(&{s@CWr3 |L1--հB) /MD(7e*NFJ00jKQ?yN4eq)wtZ2R)4P3$Zޜ3y;m=)J3"O)J>o?/ԚWUQNAVLen2Uam&Jd$iS%j2,mESQ@iv;tMPbqbj9+`bѲ[8_ B,||q*~A%շ%99ev\T|jNO7rtGAH ^ 䤚y;1-$;vso2EJ՘֕#'YO%Np3xdd Wqʧb2#{1K`z-Ta tʋC"ؿ#"7b\l j!as 9@:-^m)Uϒqˊ?TRZYYpMQ,×NY^~.>Og:B RΘ4%TP |~̀.<5AS&Ǘ8;.Ax|_ԃQ,`΃;i"E;uצU AIyϜ-5]gHaw" L>dĻɣcEZ|3O)Q\PtI!j UW7{ َ B_b4e<7Nq&0wp_NU-b ̘ֈ>u֞9!s7N0B\o03v0Y;-W`xw-r.ý W%N,岕c@siP-ISS.y_}_ZTuO^j`p&{Ȭ$pjpnYWer ;eN=IFv?5SLvu  #eؔY)tÏC@;!OV9(`s͊(Ļ+;+6(vVvlPUن%ج}r-e*1\Ah2`亘ǖ[cW ]+]*1[vU1WeSvQU1We51WebLUXbLUٱWeb͊+1]+vlUX