QExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:32:40 &.(6HH Adobe_CMAdobed            [" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?F3~$[ C?t}>pM)o-cOn{G [ 奢$HfE}cF$kv;AOo%G,8K#Sew;G.K[]̩ b&$I'J`Ϣ.i㢓(+gDZ < G x,vl7tdr`ƫ ?Voh$IFU?iCeMy?%cȒGri=8sMu襛gh51'~lfUmVO ^ߚ0,-}Rf dJ1[Bѷl}>英hV@A ?2?Qh~׶4_c=}C _Ru]75f24,{vX%WL3jtT=6Myl^{7WIAe.%=}Hu(wP`<@;5+ )j!'OXjc=$qտI奕^GMeչF˒m8{s[kI{:{֝c+#c]NQWSsLvgnϦ 8M9ď%VZ.#qI[U$U8Gm-R`"}) lB}:u`?{EJvIBxG?5&1(ոNu4}Khﵟ͛]"4|]OAy?T濛 Ѹ~~Eֹs@2~T:Utk{N%* g[?c?kYps< 7u;ME*-auju\涶wmTM޵D}F| YK`]kmvDmkM_֋V] 7} wXAqw۹ a+ ԝvЮuZ9Q iH۷o(^ڠ֏_'# rj47aeCҒ6>۳I?_=E3ohn(mn{ olYC-'O?Qqmg[umcewUAaw=ɭߣ{6lXאA&R:6F\ ˛檪N}N\=A}+|mn}oǻo^n9?evZ {=ݾVwXzv5EŻl{k73?};x,hXH*ў1:|Qߣ+s=!?,1˯{-ov:?rUEw0>[lT}J?)rr ,Lz3b 7teۜܗUnyt73ߢ31k V{}b.\96\=4:ue1&2$n^Kst!O.?Kj5=[7#Y֚64C{Ҭc.c/kHvӸ5l;gU1T,t1{E ! bZ $<(Y,w"'n1)Y݁C) =Kk:]sHo&6u}ߗQ}nc阘;OQۈ嶺*bc~iƼ;HAObPvn]_c~~?9#K.[}%էg9^Z NE[YoRm0o\)H6%<"#[8=ҵf:Veè8?6.۶UoX8WݗP,\ ]kEhΩs^lvo3uZm_a oyX_H𮭻\W~˅p+mKm/w[]?Rlpi-ǚuh8C]˛}DB 6vկ0ΗF̗.IK7[ꪜ9RwK 'c;;ӭwm=CJg&]&>8p{7\ѷ߻g3mKD5[6&kcTރsI5]YwG%鬉|%9%)rNccO dqgQֲO"INk>{igkpl]Xz/K !o.6ʚwWd3ODN@P&S"eHq$GN ,2܋K ps4?E?H a? .%C-2 "i!b GakL>d{tsxάM5_J8w~@?gc &{DIs;O'"@ab7Umu6XFX9i]U2v9udb{Pzxoe H7γ"1ŖO h׺C6?qވ_Sŝ^w=۵V?U~ r0}DZHr+qpc`cKďmVjXъ 2|GK̦zp@ahq׹ʹicR?)ͫ>KOek]YڶH!Iܒot|Kq"_*r-5!S?UlkoV3|DZ #cU݅?D퉙qPZA vD,:~>eӲ ,+389Yku<e1hͭNw+?k8dL<Ĥa~ Rn _߳mrdb~>O.NPfkͯhao3 om ?u.cYPs!5պ;  G箏Npq?ՔE&A* ^^isKl;A5}S~tUuhs=umV6?epo?P/HO IQF_g Լcǹ6?;k;cY^0b?k9Nk\cdT˃ۢ :֭YUu\UvEϬm6D>[s{-oW2:#ֱZkzϰ}?~uPmn0YQ0~lIC迳>'}]?K~ڒ |?nGJTG*@96,)8:mR?0+Ju%kHR@)=5:юڭqYLO9ԖogtW{Y//w-PWw?7=ޠ5v86;ٽgՏHݐ%[/c;Pr,qUA^2/s`u?̊Kԅ]=:8@57aC#t~wl+b,rMҺZti ;m=`[s*X68 v4%ӻ$~z~yNb:xb Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU workbase_foto-20 nullboundsObjcRct1Top longLeftlongBtomlongRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM /[ Adobe_CMAdobed            [" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?F3~$[ C?t}>pM)o-cOn{G [ 奢$HfE}cF$kv;AOo%G,8K#Sew;G.K[]̩ b&$I'J`Ϣ.i㢓(+gDZ < G x,vl7tdr`ƫ ?Voh$IFU?iCeMy?%cȒGri=8sMu襛gh51'~lfUmVO ^ߚ0,-}Rf dJ1[Bѷl}>英hV@A ?2?Qh~׶4_c=}C _Ru]75f24,{vX%WL3jtT=6Myl^{7WIAe.%=}Hu(wP`<@;5+ )j!'OXjc=$qտI奕^GMeչF˒m8{s[kI{:{֝c+#c]NQWSsLvgnϦ 8M9ď%VZ.#qI[U$U8Gm-R`"}) lB}:u`?{EJvIBxG?5&1(ոNu4}Khﵟ͛]"4|]OAy?T濛 Ѹ~~Eֹs@2~T:Utk{N%* g[?c?kYps< 7u;ME*-auju\涶wmTM޵D}F| YK`]kmvDmkM_֋V] 7} wXAqw۹ a+ ԝvЮuZ9Q iH۷o(^ڠ֏_'# rj47aeCҒ6>۳I?_=E3ohn(mn{ olYC-'O?Qqmg[umcewUAaw=ɭߣ{6lXאA&R:6F\ ˛檪N}N\=A}+|mn}oǻo^n9?evZ {=ݾVwXzv5EŻl{k73?};x,hXH*ў1:|Qߣ+s=!?,1˯{-ov:?rUEw0>[lT}J?)rr ,Lz3b 7teۜܗUnyt73ߢ31k V{}b.\96\=4:ue1&2$n^Kst!O.?Kj5=[7#Y֚64C{Ҭc.c/kHvӸ5l;gU1T,t1{E ! bZ $<(Y,w"'n1)Y݁C) =Kk:]sHo&6u}ߗQ}nc阘;OQۈ嶺*bc~iƼ;HAObPvn]_c~~?9#K.[}%էg9^Z NE[YoRm0o\)H6%<"#[8=ҵf:Veè8?6.۶UoX8WݗP,\ ]kEhΩs^lvo3uZm_a oyX_H𮭻\W~˅p+mKm/w[]?Rlpi-ǚuh8C]˛}DB 6vկ0ΗF̗.IK7[ꪜ9RwK 'c;;ӭwm=CJg&]&>8p{7\ѷ߻g3mKD5[6&kcTރsI5]YwG%鬉|%9%)rNccO dqgQֲO"INk>{igkpl]Xz/K !o.6ʚwWd3ODN@P&S"eHq$GN ,2܋K ps4?E?H a? .%C-2 "i!b GakL>d{tsxάM5_J8w~@?gc &{DIs;O'"@ab7Umu6XFX9i]U2v9udb{Pzxoe H7γ"1ŖO h׺C6?qވ_Sŝ^w=۵V?U~ r0}DZHr+qpc`cKďmVjXъ 2|GK̦zp@ahq׹ʹicR?)ͫ>KOek]YڶH!Iܒot|Kq"_*r-5!S?UlkoV3|DZ #cU݅?D퉙qPZA vD,:~>eӲ ,+389Yku<e1hͭNw+?k8dL<Ĥa~ Rn _߳mrdb~>O.NPfkͯhao3 om ?u.cYPs!5պ;  G箏Npq?ՔE&A* ^^isKl;A5}S~tUuhs=umV6?epo?P/HO IQF_g Լcǹ6?;k;cY^0b?k9Nk\cdT˃ۢ :֭YUu\UvEϬm6D>[s{-oW2:#ֱZkzϰ}?~uPmn0YQ0~lIC迳>'}]?K~ڒ |?nGJTG*@96,)8:mR?0+Ju%kHR@)=5:юڭqYLO9ԖogtW{Y//w-PWw?7=ޠ5v86;ٽgՏHݐ%[/c;Pr,qUA^2/s`u?̊Kԅ]=:8@57aC#t~wl+b,rMҺZti ;m=`[s*X68 v4%ӻ$~z~yNb:xb 8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$..Բj&ֱ` Udx>Op}U$\qoKQo-_Uܫ)Jl$K/Qo%[*qܫ)Jl$K+Qo%[*GGUWRJI$WqoKQo-OտU甏֎r<+*I,=Gm qoZcGV?sܫ)Jl$K/Qo%[*տU甿v6ERI%[- Ot_w/տU甿v6ERI%[- Li*COUWRJI$gqoKQo-?տU甿OVWRJI$gqoKQo-?տU甿OVWRJI$gqoKQo-3ܫ)Ξr<+*I,=Gm qoZܫ)Ξr<+*I,=Gm qoZܫ)Ξr<+*I,=Gm qoZܫ)Ξr<+*I,=Gm qoZܫ)=W]yKWl?dU)$YzſA/=Gm OUWR=[]yKWl?dU)$YzſA/=Gm OVWR=[]yKWl?dU)$YzſA/=Gm OVWR=[]yKWl?dU)$YzſA/=Gm OVWSΞr<+*I,=Gm qoZ_ܫ)Ξr<+*I,=Gm qoZ_ܫ)Ξr<+*I,=Gm qoZ_ܫ)Ξr<+*I,=Gm qoZܫ)OVWRJI$oqoKQo-/տU甿OVWRJI$oqoKQo-/տU甿OVWRJI$oqoKQo-տUܫ)Jl$K7Qo%[*_ܫ)Jl$K;Qo%[*oտU甿v6ERI%[- Guuow?*_һa"I$- ~?m:ʻtow/]TIf?m`=[]yKtow/]TIf?m`=[]yM:ʻȪRI$`_zſAiΞr<:zʻȪRI$`_zſAh][]yO:ʻȪRI$`_zſAhήr<=[]yKWl?dU)$YzſA/=Gm OVWSΞr<+*I,=Gm qoZ?ܫ)ήr<+*I,=Gm qoZ?ܫ)Ξr<+*I,=Gm qoZ?ܫ)ήr<+*I,=Gm qoZ?ܫ)Ξr<+*I,=Gm qoZ_ܫ)WVWRJI$wqoKQo-տU甿WVWRJI$wqoKQo-տU甿WVWRJI$wqoKQo-տU甿WVWRJI$wqoKQo-տUܫ)Jl$K?Qo%[*տU甿v6ERI%[- Cuuow?*_һa"I$- ~?m:ʻuuow/]TIg~?m`][]yKtow/]TIg~?m`][]yQ][yKWl?dU)$YzſA/=Gm ?WVwR][]yKWl?dU)$YzſA/=Gm ?WVWR][yKWl?dU)$YzſA/=Gm ?WVWR][yKWl?dU)$YzſA/=Gm ?WVwR][yKWl?dU)$YzſA/=Gm ?WVwR][yKWl?dU)$YzſA/=Gm ?WVwR][]yKWl?dU)$YzſA/=Gm ?WVwR][yKWl?dU)$YzſA/=Gm ?WVwR][yKWl?dU)$YzſA/=Gm ?WVwR][yKWl?dU)$YzſA/=Gm ?WVwSήr<+!I$- ~?m:ʻ*_һa"I,=Gm qoZ?ܫ)ήr<+)I$- ~?m:ʻ*_һa"I,=Gm qoZ?ܫ)ήr<+)I$- ~?m:ʻ*_һa"I,=Gm qoZ?ܫ)ήr<+)I$- ~?m:ʻ*_һa"I,=Gm qoZ?ܫ)ήr<+)I$- ~?m:ʻ*_һa"I,=Gm qoZ?ܫ)ήr<+)I$- ~?m:ʻ*_һa"I,=Gm qoZ?ܫ)OVWRIf?m`][]yM:ʻȥ$K;Qo%[~owYgnrm8+)I$- ~?m﬽Pڛ*Yw/]JI2u[- Ot_w7*_һa"I,=Gm qoZ_ܫ)Ξr<+)I$- ~?m:zʻ*_һa"I,=Gm qoZ_ܫ)Ξr<+)I$- ~?m:zʻ*_һa"I,=Gm qoZ_ܫ)Ξr<+)I$- ~?m:zʻ*_һa"I,=Gm qoZ_ܫ)Ξr<+)I$- ~?m:zʻ*_һa"I,=Gm qoZ_ܫ)OVWRIf~?m`=W]yO::ʻȥ$K/Qo%[*_ܫ)JlRI$`_zſAjΎr<::ʻȥ$K/Qo%[*_ܫ)JlRI$`_zſAjΎr<::ʻȥ$K/Qo%[*_ܫ)JlRI$`_zſAjΎr<W[yKWl?dRI%[- Wtu_w/U甿v6E)$Y_zſA/=Gm GUWSΎr<+)I$- ~?m::ʻtu_o/]JI$WqoKQo-_U&g<+)I$- ~?mWNyɷ⬷QQk)I&(erzſA/=Gm ܋)r-8\l?nE%I8[Qo%[S8zȷpug*a"W+[- X:ȳPRk)2H;mrzſA/=Gm CYqN:PRk):J☽+- ~?m?qR{s]MScTM+- ~?mڎ8+)mP7YW[- o;=6Rk)IeF\qoKQo/CfnQjNK2n%,w޼Qo%[;98\l?dU=jK7!{&\qoKQo.ogS_һa"7md\qoKQo.k;5qJȧa%܋x荾+- ~?mc3qFȧI%.OĮ+Qo%[hz{?*?qJȦJ%8%qzſA/=Gm ׺{?)^8\l?dM7U)qzſA/=Gm CYqM܋?)W5MmO+- ~?m"_ȳs]TIWϊ`_zſAuȳr,8\l?dU'IyKy\qoKQo.`?"ElN8[Qo%[N~/o7_&һa"%Sj<+)I$- ~?mѷS#MSo/]4IH~?m`wn?ҭ<S[yKWl?dC$Ic~?m`S[yKsuOo/]JI$/qoKQo-?U甿7TVRIb?m`S[qKsuOo/]JI$/qoKQo-?U?TVRIb?m`S[yKsuOo/]JI$/qoKQo-?U甿7TVRIb?m`S[qKsuOo/]JI$/qoKQo-?M7TVRIb?m`SqKsOo/]JI$/qoKQo-?U甿7TVRIb?m`S[yL~_o/]JI$7qoKQo-U?UVRId~?m`W[yKtu_o/]JI$GqoKQo-U甿?UVRId~?m`W[yM9ʷȥ$K'Qo%[*U甿v6DҒI%[- _s_o?*_һa"I,=Gm qo[?UVT7TVRIb?m`S[yKsuOo/]JI$/qoKQo-?M甿7TVRIb~?m`?Yʷ*_һa"I,_=Gm qo[_ܫ)7TVRIc~?m`S[yO9ʷȥ$KQo%[*_ܫ)JlRI$`_zſAmnr<9ʷȥ$KQo%[*_ܫ)JlRI$`_zſAmnr89ʷȥ$KQo%[*_ܫ)JlRI$`_zſAmnr8S[yKWl?dRI%[- ksuOo#ܫ)JlRI$`_zſAmS[qH}g*_һa"I,_=Gm qo[_ܫ)S[yKWl?dRI%[- gsuOoKsuOo/]JI$'qoKQo-?Mܫ)JlRI$`_zſAmnr<9ʷȥ$KQo%[CONyɴh:PtMRJIEV+- ~?m?g75v6DY'"C6[- c73)~L_һa"])ʷޗmQo%[~Lv6EpI,Co1ʷ>- ~?mCLulv6Ep,wA~m#_zſA/=Gm !W/ʘG+v6Ep*K?#]rW~?m`ҿRK'+/l{ο(N깃_q^_[- ԇQH1Y?|l?dO$깇3+˿`_zſAzyY#+ҿJȮIpꙄIQ}`_zſAzQ_ղ_l{(ͿczſA/=Gm _0ކzgk>]\Lٙq7*>=Gm qo]989Wv6Ep;I,}~Auq~?m`]~Rk+Igד􊗨=Gm qo]8={?=v6Ep7TŎ)Ŏ+- ~?m~׳POg+a"i*Sw`_zſAvR?Ellw[=Gm qo]r,8?=ll$w[=Gm qo]_ȳ]< }-\qoKQo.P8zPOg+a" *x?Qo%[aR]\ }KsW[- =vȳr,8|l?dWa$=Gm qo]yCYqKPRk+:H[?`_zſAu߷{?)~"Wv6Ep'IyKq\qoKQo.PR])@|R|W#[- ܋?)r,8|l?dW tw~?m`og/CYqJȮ >)n>+- ~?m?"_ȳ]\)A|R|W%[- E߷ȳ]\)A|R|W%[- ?Eȳ]\ A|Sn>+- ~?m~"Gug+a"|W#[- ;YqKPRk':Hϊ[`_zſAuHr,8|l?dWt7~?m`^"_{?)_5$ -rzſA/=Gm @POg+a"?m`?ou@]\ }Ky\wqoKQo.ur,8{?=ll$-\wqoKQo.uSWv6Ep6RU6x~?m`nuRk+;ĥ;qzſA/=Gm AsqOw?=lmz)Gx~?m 8>oid>Ne.qeO'Zhdr |9da3y i?ī5Z \bI$fI/(VũUY}QWGʫ_Q!TIe%$TI&$I)I$td%)$I.SJxIJI$#bRI$5NtI4&'M2I'2JRI$<$$$I L$$II'IJI$E%)$NSI)I$bN$$IƩtIE(NRI$$%)$NS$IJI$I$RI$I$I2tI I$I TI$S')RI$II%)$LJRI$$IJI$I$RI$I%)$I$IJI$I$)I$ddI$H$IBE$JRI$IRI$I$I$I$$I$I)I$I$IJI$I$RI$$JRI$S'LI$I$$I'I%)$HI$I$I%)$I(LJOʉIKNsƉ&))tI&HҒ$~TgA%)$锂S*) &N)%)2tiJa"RRI% 2iI)$铤RIJI$)iIK$$JiJRR$$ܚRRI:dҗ )dJRI<$? 3 JJY$)&LHJRR'R)I$R4'IM)Q,tJSʄ(d RFRe$Ч)L(O BJ;%(M @Q%,Be(M `* ))hM P)%"RSHN{!yoSGKꘫgwYeٌ+TBW I$6i$(VũUY}QSGʫ_Q!TIeAZJI$ pJRI$I$I%SIRI$n )I$iRD%JRI$ %JRI$N$IHj$$Iܧ%0IJI$RI$S)RI$$RIJI$JS%)$K2p $IIJRI$&))I$Rt)I$I$JRI$I$I$I$$I$I)I$R$RI% S$IJI$LI)I$t'))I$IH$I$I)I$I$I'I$RI$I$IRI$N))I$dD$I$I"I$I$$I$I)I$I$%)$I:d)I$dIJI$I$I$I%)$NI$$I&I$I$I%)$I$IJI$I$RI$&I%)$I tI$$$I$RI%)$I$))I$II&I$RI$I:JRI$d$$INJRI$$IJI$I$)I$I$KTI$I$$I$HRI$I'I*I$$I)I$I$JRI$I$I$I$$I$I)I$I$I'I$)I$tI%)$I$IJI$I:dIIjUyII*[xU*+'LE$A I$$I)I$I$JRI$tIJI$I$RI$I$I$I)$I$AJI$I$RI$RI$$JRI$I$TI$I$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$'L%)$IM mIJI$VةԮ7TC( LI 'LN4N8I*L")& JbI$ otb1R aD' !Q*EDTˆR )PrPrDhCAL JՊ)G$;L w+5HtCV*͚*甐Sүx*I:SsbSTN!F<ۢQ*NPw))uDjeM&*)dT)(JbTI\%&NS$ӦNNJ\'LdI%.I&M ' RQ))t2u#AKLhEKL2cr%)$Q*%HAJNIb2HRI$:d%I$I:d铤IRI$IJI$$I)I$I$JRI$$JRI$"I$I $II$I:dIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$TJRI$TNKHG;L$It$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I I$$I%I&)9LI%)$IJI$I$JRI$Bt$)$K$I$I $IQRI$I$JRI$NH$IHI$d)I$IAJI$HI$I$ RI$I$RRI$H$I$I$I:b1EJI$N: RI$I%)$I"I)I$dpI$:dI:A2tIXi,:) \ޭ9U[P ABQTRKĥ r)(J))bGeS M)d'')@ y@pk Bx2mL ZU$j!8S Ju6KIN֓Q0S88E*ibOޢP|Tc7̓>jm={8QqBr!꒙j%6QRqP'ELۧ)5LtQ<\%%()$ %4 *$(H(NJm$%%,xH2T'JRBД)BP)JJRSJ9Jer})% P)[ )ILa(RLtP.M%1J2LRRД'OO$(S.M@JRCJSyP))% P"nKr%- BxN)(JRPR)JJc B&S.JT%)IKBP<)%*rJc 'JʄJRRД'LBRRВt O=SJ2NJ)RRR'L yPT:JRTNrA!:JZBe$vAK&$(%, R]t[TĒR*_lc D #BI%iI$(VūUY]QSGʫ_Q!TIf$IZJI$I$$I$I%)$L)$$I':JRI$ JRI$I)I$ItRI$Н $IIRI$> $I'МĤ$I%A"I'I2tI D'IJI$JRI$L%)$I$IJI$$2JRI$I% )I$p$JRI$E:bI$I$I:tJRI$II2xJ$J)$$I$II%)$I:IRI$I%)$O)I%)$N`%)$HNJRI$dRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$L$RI$'LBJRI$I$I$IRI$'I%)$LI$$I$JRI$tRI$LI$t)I$I$JRI$I&IJI$NJRI$$I)I$I'LI$I$$I$$I$$RI$I$$I$IJI$I$RI$I$I$I$$I$I I$I$JI$I$I$I%)$I:dBI$$IRI$I$I$I$$I$RH$Iڮ0*lVI!I$I*[w EJN:I$BI$$JRI$I$I$$RI$I$I$I%)$I$IJI$I$RI$I$I$铄TI:I$TI$I$$I$I)I$I$JRI$I$I$t)I$tI%)$I:d%)$J'LRBI$I$$IM lIJI$+lEK2Pr9L $:d$2t8RL$R(*X:)SjH %EE@ ))FF QGh%L2bU̟κ٪yVlW) U֝Q*%9LRC&0\T JfD ) R*%3 `Q*EE$ d1LtNStE7 $I dI%.I&Q*EDӦ ("BJ]8L(TIKLE2J]:d%EHIDAKI'LI$I$$I&N$:I$2I)I$IIJI$N$I$I%)$LI"I&**EE%)$I$AJI$$I!I$I$JRI$I$I$A$I$I%)$I$IJI$I$RI$'I%)$II1%)$V4ND H$R LILI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$A$RI$I$I$d)I$IJI$$Ib1AJI$&NHRI$$)RI$I$I' I)I$dI%)$N`$)$NE8IJI$$IRI$t))I$dI%)$I$AJI$I$RI$AJI$)xLI'I$RI$I$I(H$*RI$1N$I'L$II$I$I)$LRI: RI$b1IJI$I$JRI$PY\I$1I$(VũUY}QWGʫ_Q!TIeJTI$JJRI$t$$I:I)I$hH))I$R$JRI$a)HIJI$RIJI$ )I$pRRI$IJI$dRI$JRJRI$(MrI&IJI$I:dI$!$I$I%)$I$IJI$JI$I$I$$I'LI$I$$IIJI$'$%)$NRIJI$L$I2t))I$I&I%)$I:IJJRI$d1IJI$I$RI$I%)$I:IRI$I%)$I$IJI$I$RI$I$I$LI'H I a%)$I$IJI$I$RI$I$I2t$$I$tI$LI$I$$I$tI2tIJI$I$RI$'LI$2I)I$II$I$$I$I)I$pLI$I$$I&NJRI$:I$$I$I-RI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$I!I$I$IRI$I$I'I2tI$I%)$L$RI$)$I'jZm$&NwQo*EK'LE$A I$$I)I$I$JRI$tRI$I$I$I%)$I$IJI$I$RI$I$I$2tTI$$TI$I$$I$I)I$I$JRI$I$I$I$$I'L%)$I8L$$IJI I$I$JI$ؠԔIY[bJPC( ) %`0NH(IK&)) S RɓӄI)1N bT P*`S2 0RR3?_)B~#R4$;*Ps%SB\*$+UJ몊RRC0!Dr *HPhS R*(NTHR)If8)$ӦNE#J\'LI$RI$ɓN'LSDt: eDӦ Jr.I%T%.A$EI1AKI'LI$I$$I&N$I$2I)I$E2tRI$$JRI$b2JRI$1N%)$Q))I$I$HRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$II)I\bVL)AT))I$tRI$ $I$E$I$I%)$I$IJI$I$RI$I$I$I$$I$I)I$I$JRI$1N)$LI$$I&)E*I$BI҄I$I)$L$RI$I$I:p8EJI$I%I$RI$I$I)$I$IJI$I$*RI$I$I$I$$I$A)$I$EJI$)$ RI$1N$I'L$I)I$tI%)$LE I'LSIJI$N$RI%b)ZX1rrZph8S.j LI$:>i08LI)bFDɔ˜P A%0qWjS S%  Ap'Dna NTg('ĩr1A(b"6[Tce&!ܨ;Dة >*bDǂ=z Q\⒛ ӄk*BC'nI G#Tt"yE!S GL(7( ‰Q:%DAKL"BtН:diIJI$RI$ )I$9LRI%,IKDI%,tI2RI:I0.RI$$$I4%*'JRI%,tJS'LR4$LIJxI%.I%I% )I&I$LI)$I"4)IL%,I%] )I$tӄI$)Ot$TҤIHh$$I')t:dR&?71U|g! I+LlI%(VūUY]QSGʫ_Q!TIf$IZJI$N$$I8JS$$I҄Z$I&N%)$I$IJI$'RI$Вt)I$tpI$t%)$KGI(JNI&$%)$KS$$II$I %4))I$II)I$I%)$$I$dI$JRRI$ $I$I$$I$I)I$A2tRI$I4$II$I2t$$II$I0N'IJI$LA%)$NSI&I:dI$&IJI$I$I$IRI$$IJI$I$I$I%)$I$IJI$I$BI$ ' %I$dI%)$I$IJI$I$RI$$$I% $I&I:I)I$d$I$I$$I$I)I$ItRI$$%)$LI$$I$I)I$I$%)$LI$$I$I)I$I$JRI$I$I$IZI:I$I$I$$I$I!I$I$IRI$tBI$$IRI$I$I$I$$I$I)I$tI%)$I$IJI$I$RI$)$I)5[bm$)$NWrQd铨H!I$dI%)$I$IJI$N$I:I$I$I$$I$I)I$I$JRI$I$I$&NI$2tI$I%)$I$IJI$I$RI$I$I$I%)$I:d)I$Id%)$N$BI$'LTI$ĐIX[jR$RB(%EHI $K%$&NH' tI$' ڦI!Q*ED0ALIP!HJC))]RPKS9ʽHTK;rث9$T(ԫMʁN*%$2P aED% ਔĩ BrQK TBLS)rRR' I$I$IJN:e1IKL1NTJJ]:d銉R*%%.NS'%.d$(TRR$LS')R$dI I$$SIJI$L2I]$N:dI$$$II$I1L2JRI$E$%)$LS')RI$'H$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ʊRI%m&&H$R LܦILI$$JRI$I$I$I)I$A$IJI$I$RI$I$I$I%)$I$IJI$I$RI$)&))I$IAJI$$I!I$I$$IL$I$I)I$I$JRI$I$I$'IJI$HI$I$IJI$H&NI$I"$I$I)I$dI$PJRI$:d)I$I$JRI$8I I$I"I&N: RI$dRI$$E%)$LI$$IRI$IJI$V>6C*+UVP aHPD(e8I$IX|BpTqJXD S )Bp";GSaLpa8U?gܧ_SgEmJ\j_>ߴrJ ĕ?eܧ_`N1:$V7;Gܗ+Gܒq: K9)3"RN%N$ IR_wȥ [2Wn}/;R_wȭ7;Gܗ;Gܒu%K)3"2SgElXߴr_rJ ԕ/eܧ_`N1Wn}/;R_wȭWn}/;R_wȭ7+Gܗ;Gܒu%K9)3 2SgEl% #K#I\AQ_wȥ [ BWn}/;R_w-,W/W%qJ2SgE/ܧIcҿ}ɿi_>*_aN1×rc? e:~ҿ}+7RT×rc? }/;Ibһ}i_>*_aN1×rc? fRXߴr_rJ ԕ/ܧ_`N1WnTrc?)}/;JV/;Gܗ;Gܒq: K9)3 N%N$ ISWw% [s) #K#I\AOeܧ_`N1 Rj_>kt (T212 KZOgaUom,ܹD.PNJHI:JS)DRК S)E)IKBe$ uQKJo7ձQ>7ձU|%Њ"3ȤJI$(VũUY}QSGʫ_Q!TIf&I8VI)JRL JRI$D% )I$A$KI)S$II9H%PI% I)I$A$hIJI$uO=RRI$yL$$II%)$I:bJRI$II)I$dIJI$$$I$I$$I$I)I$II&I:I)I$d$%)$O $JRI$$I$LI'I$RI$I$I$I$$IJd$$INIRI$$RI$'LI'L$I2IIJI$L$I2tRI$'I%)$LI$$I$I)I$IIJI$)% $$I$I)I$IIJI$$I$II$I%)$I$IJI$JH$$I$tI2I$I$A$I$I%)$I$IJI$L2JRI$I$I$2I)I$t$$I$I)I$I$JRI$I$I$I$I$I$HRI$I$TI$2I)I$I$HRI$tRI$$IRI$I$I$I$$I$I%I$t'IJI$I$RI$I$I$IJI$[gnRHRd锟¨U𩿔T铦L2RI$I$I$I$$I$I)I$tI $I$HI$I$JRI$I$I$I$$I' $IL%)$I$I*I$I$RI$I$I$I%)$I$IJI$N:JRI$I$I)%)I!I$II*I$SbRI%fq*QR"&IJ  AFRd铄铤'I<' QR%ID0TAR!bBP*aH( TFnBtQ]OXpHG$D) QPp3 XGbYeoVP>tV3^ ?0?w$I)\:ťJY-OY?;YZ֬q:ͩvs $I)IðzNx[Sm3kgg]f3HڸMsCԤI$G_Պ}[&rF{W1*ocfsؙU_Q,wg]?[ =|]\W=$I%$ޚVPhv5w./gpLlc{~hf#ưYmۨk]ݿ$I)H$ Nu?3!ضDǸzc}e63]ֻOp_S$)$I)kjcKؓK;#-ߑ&t6Aڗ;#-ߑ$I%<~7*I$IOkiu`Ou.n]l˭ͤq5?}sU3im >c+},oI$Julǧ?5l]XUt#~8s?kO]܌vk_I$S·$-uKͺ.mW:#FNh˿gZA8I$IO# Mu,zg]*m#׿T}i8yt.VuNk/a`wI$RxnN-aۃ[@Kkoc?3z]UxuF[7koJdϭg^v/wkI$SѤI$I)I$I$JRI$I$I$ ~s~o$(3G~E QO;=wPWuN KӤJ\' IBN )%)2tFSJY$铄oLl@7O?R*_lY("7$JI%(VũUY}QSGʫ_Q!TIeR%I$I)I$tI8))I$yҘI':Z JJRI$$wLRI$2IJJRI$2@I)I$\I)I$s %OnRRI$$I$NJRI$H%I)I$I$RRI$%)$$I$RI%)$I$$$II2JRI$2tRI$I$$IN%)$I"\$I$I)I$I$HRI$I$TI$I$$I$I)I$A$$IN%)$I$IJI$)I$I$IJI$KIJI$$$I2tIJI$L2JRI$I$I'I$RI$$JRI$tJRI$2A2JRI$I$I'LI)I$JJ2%)$HI$I"t%)$I$IJI$N:JRI$$I)I$I$JRI$I$I$E$I$I%)$I$IJI$I$RI$I2JRI$2tRI$$JRI$tIJI$$I-RI$I$I$I$$I$I!I$I$IRI$tRI$$JRI$I$I$I$$I'I2IRI$tRI$I$I:dIJI$I$JRI$u\$'zU'LE2t!I$I$JRI$I$I$IRI$I$I$I)$I$AJI$I$RI$I$I$铢$I'L$$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$I$JRI$I$I$I$$I)VĔI[\bJSQJHNS$t:pD):d:`H' TQ)1S)B@R)Aک065%#:!=!=` S8Ipjd:+\*I Y՛g[4>j} u}DTRBA8S)S1ILR pLJJf( TRH&'LTd8L2IRI$D(R *A2d2JPN:eTJJ\' HӦN% 'LDQJ$L:d$dRI$RI$I$I2t)t'I$RI$'LI$IRI$IJI$$H)I$II&I$RI$N%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ʊ9IJI$vLh=)AUw))I$tRI$$JRI$$IJI$L2JRI$$RI$HI$RI$I2I$$II$I$I%)$LS'QA I$I$RI$I$I$I%)$L$RI$I$I$I)$I8L RI$:`$LI$$I$H)I$I$JRI$I%(I$I$JRI$E:dI$I)$L$RI$'I)$H$HI$d$I'LI)$I$AJI$$IJI$)$$I' )I$JYԭtRrr^h)KX2SKDI:IӦN!D70ǚJ`T7y)0 IH Q\cDF1#RHBO܍f ’2PJ"סD#DhU~N1#BzJK\**@BXІHBqSr3II1;zǂ+Dp㢁*EA!F(0%Aй)/ȺG.~DfmWp8 ryTI$: $I$JRI$I$I$I$$I$I)KLyTDۿnEn `$f\1pƵX}>ʾu-$I%4q>`P 7]@,̮^lZ6m![v!Lu_X%1$I%5,.{n߽0`h6~1:w':f5`KT}m:hu"I$JeӾtڬm3oCZ6--;K_G}쵅;bA@돣)ؔiI$]OcJșhc:/@ F?X.cA%:GҭSF/uL-4k=$I)Ծ`gRX`G bCwVQ~CZwcN}mY5bc3%sC>ĒI$ޮց JOλ%e>4!trL2)q#ys`G~I$JvrKv< zLsλA?r˷ut"lt{tݩؒI$tؽ!~>x3:?*u2Z5ÈhUn{^4hw$I);/ӿ??ev9h7ٻ"_,nUtcV\Cߤ7I$IH>aV;͞ ;GUөn=LwVna KEn?A(Um9cY~>$I)X-s^naGG9 ^85乾w7'&PF=oI$IIjˬ{CysP0Yc s&Lf䱥Ĉ?;K:&\|wi-!hq$I%"S:{mxP?_[7umxTo}-Xb^슅cqkRI$RdI$I%)$l5I'I$S$.^={mA$I$$I-ڏ_@|K;=wQWG~EQ5N$)JpI:JRQJR$QRIK$I?o[3ձU|eM()$JI%(VũUY}QSGʫ_Q!TIf$%i*I$I:nRRI$:I$$I$:I$R!%)$JSL&RI$2pJRI$I$$I)% )I$@HR4$I;BE8IJI$LI%)$I(I$%)$HNI&I<&IJI$'I$I2tI$I%)$I2I$$I$$I$I$I"I$$I$I%I$I$JRI$I$I$I$$I'LJRI$I'IJI$$I)I$I% $$I$I)I$RI$$I$I)I$I$JRI$I$I$$)I$d$I$:dI$I%)$N:I)I$dNI&I:dI 2tI$$$I'I%)$LIRI$$%)$LI$$I$I)I$t$I$IRI$')RI$I$I$I%)$I$IJI$$tI2I$$I'I4$$I$I-RI$I$I$I$$I$I!I$I$IRI$I$I$I$$I$I%I$I$JRI$I$I'I$JI$I$I$I%)$I$IJI$[TjĒLVTT2u $I$I)I$I$JRI$I'IJI$I$RI$I$I$I%)$I$IJI$I$RI$NI$$JI$I$I$H$I$I!I$I$JRI$I$TI$I$$II$I$$I'I$RI$lPDbJRI$R5S\oB(S')Rr'N($'IK$d8L%()b€ a%1*L5 `TTcE6ڡ=NBN#4HUܯ>#**V,WrH)3oG>j;(S!#TQo(!9LRS)SjSj)t)p`&**GURN:iLI$I)I$eTJJ]H( 'R'QLBt%)I2uTtTJ %):d%EHTI$NtLI$0E%)$QH$JRI$IBI$'LT2tI$I$$$I&NJRI$D)*RI$$)$I$$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JLQRg))I$“IފXE ;d$I:d)I$dI%)$NI$$I$dI:dIJI$I%)$I$IJI$I$RI$KRI$'LI$:dI2I$I$RI$I$IJI$ $E*I$I$BI$I$I$$)RI$NI&NdI$I%)$I$IJI$I8LI$I$$IIJI$I$AJI$I"*RI$I$I'H$I RI$LS))I$A:d)I$I)$$I$I)I$IA%)$V)Z>B) 9VYrrB k"$Ҟ{$I(I8LR)0S(OS aA$/ci  %1 'qۡwLO~!6xN.AzJmTVRӪZ J ()dPg^#TfPΈP܊4@Bps]cS_t\XjKe@PW_<" ;?"I$I$I$RI$I$I$I%)$I$IMNKqaa?;)óXƆ9ſS嶒I$Jy>Qm{K{n6dI$S?dcd:ǴeC-W2z8} 7kI$I%8grp[KIqvW"˰"mckAcdnMtI$I$gJȣK7۹AymY芲\mdjkq$I$.YC˩cƹke/?K[}^b:#k}M]I$I). 5kcvn'YUu-$w֤I$e4-1.n i6Y炙.$I$5tQ i_}?]2I$I$cV~mik4t5۶,RޫuSfH1- ݿkI$SaS[0~ _b1ɐv{kY$I$\{j}-kii#Gĺf=<^KkZI$I)d[^۝,?W22.%.jif$I$/YcmYKN~ߣ\W:rX͓t?S{I$I)I&\:RȠ QEgw}ߩI$ɇ3ߐj46ƴ-_2<dK?;I2e䆵g=, f˲n+Y:UߤwI$S:f Hl-ZJE=G6J-4UCZ\Z{`ϧbz3Hy!P**}/?߽?s]-ȩ9:}$I)e]}FubΛјvsI?3m+]3dYuyps'c_E_A3G~EQK;=wQWN$tNI$ҞRR$N&NI$OԷsg.b?ee)6$IZXI$(VũUY}QSGʫ_Q!TIeH%I$I$S$$I% $RRI$!%)$I9*)JRI$J% RI$:bRIJI$E2tI$)I$E$))I$b02JRI$IBPI$II IpI$2RI$I$$I$4$$I$I)I$IIJI$I"JRI$I$I&I$RI$I$I$I%)$I$IJI$I$JRI$I$I$I$$I'LJRI$A$RI$I$I:dIJI$RI$I$I$I$)$I$I*I$L$I$I%)$I$IJI$I2tI$I%)$Lt)I$I$JRI$IIJI$$I)I$I$%)$LyIJI$I%)$LI$$I$$I IRI$:hNI$:dI$I%)$I$IJI$I$RI$I$I$$$II"I&I$ZI$I%)$I$I I$I$RI$I$I$I$)$I$IJI$I$JI$JRI$:d)I$I$JRI$I$I$I$$I$I)I$vu9VI!INUܫV*'L2dBI$I$I$I%)$I:d)I$I$JRI$I$I$I$$I$I)I$I$JRI$tRI$NTI$I$$I$I!I$I$IRI$I$I$I$$I$I)I$tI%)$L2I)I$I$I$9Dg))I$JNq"D(E"H0N8Q A%)1N$I)d' AD' )Iu<S (T P*aH( Tڠ6$Bz# ^JWEcKO*;'UaQ'ROU]ʵbRAlQ?}*r3 J%$%hR L()ʉILA0R b1EK $(I,QO ))I$$2J] :bS򘤥ԓ'MJRtLSIK铨9)HtuTAJ ' %D(I$0NS I$)$$J)$RI I$I$RI$')J$I$JRI$dRI$RI$2t"$I$dI$I$)$L2tI$$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$9QRg))I$BggdK$R LܦILI$ RI$$JRI$$IJI$')&IJI$N:JRI$I$I$I$$I$I)I$I$JRI$dI1LA I$$I)I$I$JRI$I$$IBE$JI$I$I$I$)$I:IIH'L$I$IJI$I%)$I$$$IN%)$I$$I&N%)$I$I)I$I$%)$Lt)I$pH$I&I$RI$'I%)$L$RI$RI$铦IJI$  )I$JУϥhcE!g*W[NA-e"R $I%d:tJY1RQ TRS!!F*a LhF'@J#TQI w y'U3R%@(“|<(8Dj5?Uu*B4PyC*oDFn*D8@OD0 \W]#7[-ҿ]/ܯq4I%I$I$I$n'WflqȜCm[~/F0B?e?wǽJCI$;VGCW+1c@ $9Wgk~U~Mg[T`8YFcc _sE3k?k@haGrC=.<PjYN0Ӌ_9mƮ+xw{>[cӺ&6;ۗHZ?IE;6nw/]λqk^ݯ ~g+/ĴG,]G#VDt?ߣT>BwiVy^>ܦ#aǃ柷iq%4E s}W>ڱ7Mޣ>cn^nK0z'i.IbK!y}.klh ,unk.Z^8X}_[%#wglj.~NC~׺2lݏ3zjU]})\,ais3߽%W_@|K"jȥ;(F&N^$O)I)I$t铄LpS'%)$Nsg.b_wLlUs;_2lxPS.M$V.I/(VūUY]QWGʫ_Q!TIe'L$I2tRI$$I$4$I$n$I$SJRI$AI<$I$xI%)$I$.RRI$"hIJI$I:dI)NSBtI$ВRI$NI$SRI$铦IJI$I%)$I$IJI$I$RI$HpJRI$I$I$:dI$I$$I$I)I$I$JRI$2I$$I$I)I$I$JRI$I$I$IRI$)IJI$I:dI:dRI$I$I$I%)$I$IJI$N$I"I$$I$I)I$I$JRI$I$I$S')RI$铤I$I$$I$I)I$d铤$II%)$I$IJI$$I)I$t2I)I$t$$I$IJI$bI$I$$I$tI2I$I$I$$I$I)I$IIJI$I$ZI$I%)$I$I I$I IRI$I$I$I$$I$I!I$I$IRI$tRI$'I%)$L2tI2tIJI$I$RI$I$I;9VUI I$ߨU_ʷbQQRtS'LI$I$$I$I)I$I$JRI$$IJI$I$RI$I$I$I%)$I$IJI$N$TI:I'IJI$L2IRI$$IJI$I$RI$I$I$I$)$I$I*I$NI)I$dIJI$I$RI$ĔIZ]o *xEL\Q\R!EIE%('L4' )ItH$N)I8L$($H"Ĩ2TR L $"P+JJ`P\R:Hㄗ4BuU5A!ث9YVrH-ȯ3 6TJR*$$`xJb%QLSEK *A2RQ)%t2p27 )IL'LJJdMpS'%2Jd&N%.dcNSt:LIK铨T PNE2*]$LBIRI:duN:dI%)$I"1I I$$LWI$I)I$IIJI$I$RI%9LI$dRI$I$I$LI$I$$I$I)I$I$JRI$I$I$I$$II%)$I$IJI$Rg**L%)$VNNOEsLSQNS$H'L%)$LIRI$I$I2I҄I$I%)$I$IJI$I"JRI$I$I$2PI$IJRI$R)RI$'LI$I$$I$I)I$I$)RI$>$I'I2H!I$t'I*I$t:*RI$I$I&I$RI$%JRI$I$I&N$I:I$I$:bI$$JRI$d$$II%)$LIRI$ɓAJI$NI)I$bt)I$t%))I$I )I$JУϥhPBWX*1ʐQ H% EE:II$%I)dɄB C5Dn%1p' E:;CƒTJDn 60B <&:'SQ#}%87Ra^ 3]$MfVfYBqT΅@I Z>0'PuC:(uP!%3 aA`o.~E7տ[-_p8;?"I$I$I$RI$F6][ E˻O-)pb_pǐLdF_RI$:GGm lΠ1-6jgY̰m6P:k/3a0\s_c<9_w)cRI$~H?Pz&ˋG*dYwTtV~L/$KїܑfC4=PI.u/l :{5ڬkZX7YwZ4A-!ЍASy^(#_b#n8k$KoczYZ89Z_ŋnuG;i'#ytq%3'7QC}t9yc>ȔItW`_^'~OUNYZ\Y-p+r,8ùJ|ˌ2zǕrDd>_)$]O[6*/NFK |W/+׹*l e',ء1$[xONG:Ƿ^k\XTeݏ>gCss*8,r~'"grc=pRI$i5챠wiYu *?ŋ1ZH C6a=Ȃ%K t1"8H씒I-ˏ!?Xu=`sv srޡ"_ܹ,v\\|S};}N-wS|?3x?$[ݍ\  ̓Yw)9DZ6BeݏTQf1C(',<ɋ w)D>X$I$T[JXlq <w歵΋18X%c\w:$buZ]'ϯE$y%VbVs- gϾvo w9β-!FTz0(6Md˘ xзYY:m/-}=Ʒ{-ʇ]w{?ȣ7)gG8Ѫ"NJA%I%$LRJI%$2))dRN> )I% )+\KثJNԷp[%‚ri$tI(VũUY}QSGʫ_Q!TIeLZJI$I%)$I$ )I$PI$$I? $I' )JRI$I$I1:DBI)I$`t)I$I$IJI$H'1IJI$LRI%)$I"I)I$I$RI$$JRI$I$$I$I)I$II%)$LI$$I$I)I$I$JRI$$RI$NI$$RI$NJRI$$IJI$I8LI$r%)$I$IJI$$IJI$N:JRI$$IJI$HI$xLI$I$$I$I)I$I$JRI$tdI$IJI$I$RI$I I$I$$I$:JRI$I$I$:I)I$IBIRI$$JRI$I$RI$I$I2tIJI$I$)I$tI)I$PJRIJI$$$I$$I$I$$I$2JRI$I$I'LS)!I$dI$)$I$I I$I$JI$I$I$I$$I$IJI$I$RI$I$I$I&I$RI$NI$I$$I$2JRI$I$I'g*j$I;GrT(2tɓA I$I$RI$I$I$I%)$NIRI$$JRI$I$I$I$$I$I)I$I'EJI$N$I:I$TI$I$$I$I)I$I$JRI$I$I$t)I$I'IJI$L2JRI$t$$I)AM)I$IWSʺTA(SpIJ ӅR锂PI%,9L' pTJr JX2TP a$1*%H()P4*HWUbB) ^`AH($*%H%悖I(I< 8I+GtyQ*CFDjJb7!BwRtS )wCp کU0 %$6iuCsGEJ.A(SaX(% N.))QEa*±_AhM(,#!))*m*%/Ⱥ7uo./Ȓl ryFhA󈩤I,tI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ijt?=mQiqѻ޲ևuf`\~}kƜα1\O-='1 =ıۑիnU9{N:6#ާ>ٸ׳"?cAik: Zpyi@ml}OoEگkq 1I4?\1w5ͭFs鶿P_[ךޝf-WVZZc+2E?R1Hd?sQQEyCg1̺m==Y_E_R.pmOeAq*x?Vn;n5-.ĿvV ~SƸZhk}œkߘ+gcIM;z_uxY[7d b~`_ -cEgԵqX=Ov=s dś괙C:>% e_Ukwf],Q}w^緊!v.ֹ-kk3n\.=?WrS]Yֆ5i$5E=>`;C?Noťad[+626\.c`1z{f-/mk˧lvhahk} .ѸɁʟN^]Mi8sد˸xo@q f+ʓ+z{Z[\..ƭF>X捬`p? dY9O{?[YV#3oKk_mƿgL~OVvb͍G塃`YًK3p.s}c}U:!ʼnwP?#Uvǁ[Ui)}jy |4{#VkwNų2ٴ2oTpq:M ^N}Sϣuu/!Mf׿<`]2\;U H0D}Lķ$Ve6lIMVo=_lY}<]m-nck67 %St^Mk\[_"׵p ^ucYˎ*%?Eu>G?kTꢫqz:[v#7Pzw@-:+йVJ:}t*۸~pzgObԀt1TI%9}[}wZR8TfP\p;ڍ7Lwr}Xq*$z^#1X1==d>0zVRʋhi^I'6{kwj67Z`c ki$OղsWnujĹqorI/6׋2luqcQpzgObI)ӱs X24n;A]k.?ڙ~ڽW9O#gd˭}zI$\}ЯCp}c=lޥc>K ∍Jia5[A~Cw@s>ѺG_kA%~(Ъ\@A@zQ?_*$3#KʿWcTfKFj=ֿѯu-;D?vJ}s>_c\nq#syrrXZ"N]$o\f5NcXZ֟vqPqqc)tFO?m[I]yd\k聕vcřu q$`}]6v&=utg ZS .Ѵn?IUI$RI$I$I$I%)$I$IJI$[5 lUG$(3G~D?5_oO;&Ѫ"R$:d)0O )dI:t<$$I' 8IJI$k?w[P}rg-b?ee *CɤJI%(VūUY]QSOʫ_Q!TIf$ei*I$I)I$d%))I$I&I%)$N8LI$2I)I$tHhIJI$) R)I2p$I:b$I2b(IJI$$I)I$I'LI$t)I$tܥ RI$IRI$I%)$I$IJI$I$RI$I$I$I%)$LNBI)I$dIJI$dI:IIJI$N%)$I:d)I$I$%)$N$)I$`2I)I$II%)$LI$$II2JRI$2I$$I$I)I$I$JRI$t$$I$$I$H$I$$I$I%)$I$IJI$I"JRI$I$I$I$$IBI$I$:I)I$IIJI$:JRI$I$I$:I)I$I&NI$% $$IR )I$ddI:dIJI$JRLI'L$I$:bI&I$ZI$I%)$I$RI$H$I$:JRI$I$I$I$$I$I)I$I$JRI$I$I$tRI$'IJI$I$RI$I$I;UFrtI!IRzU'LE$BI$I$I$I%)$I$IJI$NI)I$I&NI$I$$I$I)I$I$JRI$tRI$NI$I$$I$I)I$I$JRI$I$I$I$$I'LI$IRI$$JRI$I$I$6$$J*U:U"E(NH EE%, ӧ pRN0OJY2tӦ JRd锧U JbTJQ*Ja@) )S*'U 0o "'+ EsS'R>%^TN*VlUH-x_lWBR*%$$L(5L&*%IE2 AD$ɓIL2d1IK)L&*J%$8L Q)NN)$铦H%.d7%.&NLRRdAD"RR$JbTRR$dIRI$%I1IJN:IBI$)$RJI:dI%)$I"I)I$dIJI$L1IJI$)RI$I2JRI$I$I$:I!I$d&IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%6()%)$VV$ԬNTw)wr%2I$N:JRI$:d)I$I$JRI$'I$I$I%)$I$IJI$I(I%)$I$IJI$NI)I$dII2dRI$$HRI$$IJI$L$I2I$$II$I$I%)$I$IJI$)RI$IJI$I$RI$I:JRI$I$I&I$)I$dI$$I$I)I$I$JRI$D)$$II$$II$I<&O RI$ )I$b:dI:I$I&N' )I$=>+CgԴ(BWXrj AAH$ )IGt)' RИNXCxQ ˜Q A%!:(9MġE66"@vYAwt20h("*n5B(N%6+ H1pҦ#%3 mQ aE˝]+]-̂X L{/8EQ$IcI$I$$I$I)I$I$JRI$I$I$I$Ժ^6R+29yEO`wH`oX1鰖Rnݙ*h^+}1 %`/UNUSfXR1>'+cmc $I)~-9Ջ^+ѥ?,yV{h,`oYos}tW1U}.FKpmms~^X?yz){O:/W'!Ωlk]}X=Gߧ$I%=n'Ν ]1GrnC+h]jLΫՆ4f7}VoUU{oAe6g||l;+*}5dK1q_fOo"}JX0\1Zl?X}I$I)ԾW[TN\iղnie%47b渶:Ɨ1mؖ[[Vw\»+/~nM%Vүэ[ŘX XN?~Q[~I$J{Nװf1pXSoO_A#}u}c渶n; k6bW~N^EKf n\͘ͽr ߵ1ޯ=?I$IOH~tM;7>__CJ4.8Vn,ez{wSo鍌}=Iv=umrl/z]Ĵ^{2LoI$S})u}wzK~g oW qO6[4^)+nq7R4 h]/T>%&p?v?;$I%=;zuokK7K}[=&#KW!sS,ߋ]k{EO;}o]j\ϫTWeEߠGI$ScLx{7뱛okbNnkz݈tT3wI$St89 l ~~=7eTϫ@^nU}V{\{:7j?#XOX6{-nȫk3etc5g?ۓ2gX*KWKw3{?FI$}uٽzkiή};2.(#fpN }{M }~?{޹]զ7YC{[u t~Ȣ-#ϴWm^cI$Sf}l؍{-okhGijtpub٭C*Gt<Ѝ9ռޙK+U?z=G>FVKF#2"ͬVV3gI$ٿ[zn lq繬{멶G~NE,}4zߙ=l60fFX6Tg1+vzEڬ*3ۑm\) 헷 RI$Si$I$IJI$I$RI$I$I%__@|K;=wMUFD"n7).N:d)I$JPIRI$'4IJI$՟_wLlU_wLlUs;_2l!Šri$tI(VūUY]QWGʫ_Q!TIeei*I$)$I$$)I$dIJI$I)I$II$$I$'IJI$)$II#@) RI$铦IJI$$$I$RI$$JRI$dRI$N%)$I$IJI$I$RI$I$I$I$$II%)$I$RI$I%)$I$IJI$I$RI$I$I2I$RI$铤I$IRI$I$I:I$I&I$RI$I$I$IJI$I$I$I%)$I$IJI$N$I:I$I$:dI$I%)$I$IJI$I$RI$铤I&I$RI$I$I$I%)$I$IJI$$$I$I%)$L$RI$ $I$I$$I'LJRI$I$I$IJI$I$RI$I$I$:bI&I$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$I*I$I$BI$I$$I$IJI$I:dI$铤$I$I)I$I$JRI$FrHRd铼h;mEEI'QI$BI$I$I$I%)$I$IJI$NI)I$I&NI$I$$I$I)I$I$JRI$tRI$NI$dJI$&NI$I$$I$I)I$I$JRI$IIJI$'L%)$Lt)I$I$JRI$I+TU*TEK"PL ' )I)xLR4LRN%)2tmR L$%D€S !P*eEAhaM)anVjGq yfu*eLfMXeu9[n-sGK邡ch.(}>7I$Sf8دyqٻsFq~%PpBz]:T沏QOo$I$"K]Xf(quycqZXW%ht}?.w}U][ڞ?I?FI$aOP!?ivVl< i/}tuV4ђ0leYf-}7ջfN/=OФI$Ie]u|wf=zP=vw+Y;u^`ˢrNE~;g=_oC$I%=2Kןpϵ}6KZޯ.Sѷ?I__*j7WczYw"sNC+ɱWߏI$Sۦk \fGK̮6VcѫWc{?o?!WrpF8f!cvd_NڽL[3=+I$IOdfoWSnPosY-2nF?=j>o|iɢ^h ~7$I%=KWQX ̺ǮTf{j}~~W긝CXYM rY׳}u^V[I$S$|Ïn-kmKNoe>cZ~A:,lLoo_ȷI$IOV/?SoUHum f*l?t3n md׼:j]O,ؒI$%]8>NY^Vk KZ*Ӷ?]jnf^6[IvڋjȮ~~ĒI$I$I$JRI$I$I$I$$I-@|K;=wMUFD"n7"S.NI%)hI%,I'R$IҔ$$IO>ҒI(ؒI&IKjm%)$LԶ$$e'ؒI2J Kb[ J]$(*{RR&JP)KAKJ )lO%)$PIO)lIJI2J ))zi)tIA2/%)$B螚^JRI4}$$I$$}"))tJRARI4(IB7IGr[RcR^Jd()'S$e)@#) S$ɷ%WXS))J;nU(V=%nU(V=JfەhHdRф2*SmV)z>I)u nUvUE/E%S$w%UږoMy$I(Kr6sHВu nTSVJiw%T؛aWM>I>I*'Cޟr"pRJީN &-U4L3*f$N(N)2J`a0d a"H8nSBQJQ1jyJQåA$nhQ-D!1j8t",IH7T@VK%AꭇjJcL[JhhBuD0 Խ}yI.kPH߉21UP)ojY ًO B4)dMT7TɀVPctDhP*.R>*$MÕ0*g20z|":|"Ke6_p8;?"I$I$I$RI$I$I$I%)$I$INo.f-N un<6̊_nT~/4׉KYcu-6csrm]ZI$I)eFQuHj[EG]}]fEN.uÍ7/]rI$I))f7W:ګ .sq#bl[_R}, .ډfF?,ϷV$I$CgG,鯩3zۃI6uߡHnm۳.in1yC{+TI$Jy{M[C/mW3}ߥ?­qv-y}O}NI$Jyy}*8W-=_s?1}?G}88.u:ÚNӤI$of{ 2ܽwnuUa3b:Վ,K񬵖2LJ}7ug ouMui$I$_Ts*}.>E-}B=knn}v;77RI$IO1վ_v^EV1Zk)He?T~u>l8ŵ]efRo4I$SK%>خk#g#OOť:.:kiBnn:riBO1t $I${z[K7{ Z'.:O51 6?[c}VտI$Jy:e+ߟM[fͦӗ.gm[?EmZrd\-JNI$JRI$I$I$I$$I$I)I$Kf>c-Ew{?țFG~D?5_oSN8IrtI! NI$I $$I8 $I'V3ձU /;R*_lYH(&I+KI$(VūUY]QW@*gU[2҉K* TI$)RIJI$ vKIJI$LI$DRI$$JRI$tҝ%)$I$ )I$d$I$S2JRI$I$I&I:I)I$I$JRI$I&IJI$LI$R ' )I$`I$$I%I$$IRdI.RI$I:dJRI$I$)I$yN)IJI$IJI$'H$I$I$$I$I%)$I$))I$d$I$I$$I$I)I$dI&I:bI'$$I$$I2I$$I$JRI$$IJI$HJRI$I$I$$)I$d&IJI$I$)I$I&NI&I:dI$I%)$I$IJI$I%)$I$ )I$I$JRI$1N%)$H$2JRI$I$RRI$I$I9L2JRI$I$I$2tI)LI)I$IRRI%螒^+TI!$$*ATI $QQK(I ޑKIJI$RFS)*I %ޒE$ҒI$M ǢI*A/A$ҒI%^gK*IhJA/]$*$(ITI)UvZ:qtJRmKjtΒtJR[Uϳ:JM)Jƫld)2VHL(e0=wgВ$BSYJ[ o$)J;ܨKaW2qJ;ܨl)}%S$w%PRh?ْU2IGr[Seh nАŔLP޳2VS%S47gzE/H/Ji(z@}"+HbGdʒ"H~^J^*dICz4RSi iN1$TU'38*H>^ KI} RU& MA8i `JJ}₴*JRhJIR:8wITܖ[֔R~R9ZbPU6w%USz,ϳwRn?n8U6ީ1<%2EG4 RU6S1L)r ҄NH$I% 2tL$JRI$ Q A%1*%H ILJR*%HFFBw0'jTZ+ 4uTW:/Y @5jy44WjY5&QE6ǂ?5LdBq<XV}A%Sp>!2tϠ)) uOc?ځh8)*@#,!a%7e ’)Js,H8$vM$MJU!Y^:镭$`ӄMJU7/7dzE/Hs<=U7<nhۀB^Z` IPs|BG9J&8%SrR}y$37R?쒩)Js{Gu蔽gJ*i oD蕵=/xITߔPpM}V/पt%)T{O7g BR:=_ooXK+l$O JVwzyVN:wITRhHb}r~ATOfx4V/_g+o }%S-;|R^')*U %jϨi)g!/TUpJcʧtgVM!+U6}DޢB'L%RRoU/QAKG9JRR_U/U ;'G/CDi$\zz`$B~h BVg%(BxBjDܕzE)BSS/Q#bԡDԣKtpzH7GKRޖKzDW zj[nIKKzmmM鄍iKwtz[Rޘ)oL_))[m KKz[$[}mH%%n))mn)pA%RRۉKrpԶ- So)$JiRڔ)6У6JTLGzmS)JԶRݢ)TMB$R^žԶL%=зSJڊJ[w%# mEO 1~)jm B9[rbd5BP RU#BxZ,7BͩdjZoe_xUm³:BԍtD`Q:)0Ί%@THf5S[IP%H8Jd !H(Ϋ%/Ⱥ-ET]AkO9 VX;}-e%k(Y -M7HO5q1?c+%id}?t}+7H_k#_1?c)~C_ȬTǤ&53}+/H_k#1?c)~C_Ȭ&>“to/?٘k1fbVJK[g>“to/?٘k1fbVJKWg>“to/?٘k1fbVRKWozmrJI7HO5_1?c+-%}zmrJI7HO5_1?c+-%}zmrJI7HO5_1?c+1%MI\)>OF]?pCKf'oEf6/MI\)>OF]?pCKf'oEf7}zmrJk# }8!C_ȥ3 7"RZ>|^|Jk# }8!C_ȥ3 7"Z;)'H_k#1?c)~C_Ȭ䖏i'H_k#1?c)~C_Ȭ䖗%}*}8%73 7"O5Iizmr^|ܒR}8%73 7"O5Iimr^|ܒR}8%73 7"O5IimrMI\)>OF]?pCKf'oEe=6/MI\)>OF]?pCKf'oEe=6x8I\)>OF]?pCKf'oEe$6x/MI\)>OF]?pCKf'oEd['菹I$Lsr8{F?1?c*)TANTI)Jp ~R$yO)tI$铤$IµNԻNԷpDp8\I$,]$_(VŭrVOAqb*?(H}U$Yӓ)VI$JRI$PRI%)$I$IJI$I2I)I$t$I$2tI$$$I')RI$2I$$I$I)I$I$JRI$$IJI$I$RI$I%)$I I)I$t'IJI$$I)I$II%)$LII$))I$PII$I%)$LIRI$HI&NI)I$IRI$I$RI$I(IJI$I$$JRI$&NJRI$I$I$:dI:I&IJI$N$$I$2JRI$$IJI$I$RI$I$I2t$$I $I&N$$INI&I:I)I$dI%)$I$IJI$I$RI$I$I$$I:I$I$I)I$II&I$JRI$IBJRI$I$$I$I)I$I$%)$HV$RI%yr7jQ$۔H2iU1N1՟QzITpM(m)m*K78IL(m)l(?g) rꄽ`KxPR؅yMtSpK )†ŸbيAO z%/%6Ķ(tJ^?IK D&~SyOdTzoP%%&<':_iڒR@StfQRsBoU?hRAO'_jԒz~oIPC9E7ڼSU?F{hj)|RR?Q/Q zjǤ#@H悑*.$A/M^txlk)}{kToL%siO鴪C(W*Aa7b%?Ҩ'IH7 za] 3))鄶t4'T>RI)*n)IG}_ʇJokKGr%hJCbIK%%[[ܘ+[[ҖjIH䔕mm\lKb.b[+3>impVڴKjAMlr-SbY+)В鸥9[ږխ1eG$[SrqSmZtRM"UM-1,\oIVJ^Va(ZhC7딑moE1Ǖjr&HY~]%[TQ^ BPKCz*ފBfae7RUނ BJ_i 3)z*^ B9_zcgzɽdmqHxJ2%]6U5OUdɅ* IVR p7NFeWc!P)BJE QN8N' )I)ttdN$&) x a%,TJrS A0RhIK""V>HNS'_42YV*U9 !PD򴟨TAGTR#-u4 wϵTFSXh `-T9Sls&:O%i\瀐Cs2lwd̯m 8r0y+{mC}hm m q+LuMfW<\[g/JW p5v)oquYd$ %Ğ}Ѡ:%6 ?i5<'!ַgO%\x ?i} h^xǭsyH|J0~!h$^Ip .tϊbJە\J8x+0g i\=;z&QFHs,[*„T)mܬQZq\|?'8CbT~'LζIdJײjJ(1V&O[u:Lq? [A/grmYU:LwK}8RtAnM+* ƺPۺJd&.JiTg>j>p!/"KrZnSw<*Έ_e `\R)*gS7>GOK(c}p)$Sgu%/v㺮8Kfgj&RU6Ri?H%Kj *[JJMB7d`|{ NhjyLJJJׁ u A#TƖM))̰?xD7]`h oM lhlj[ZFQSm>ɉS “[*[@LL\)){Ϊeӝ<Ojh)S$nSʔ'0DɒSFz.>i> )1hC(ljR4LJJ`|=!8OpH )EH<~aǚP!6)0ʐaƿ"J%$i:NxDHh!6S))5'S" R.6Q)%0 N+S>"&/S⒘p>R.KzIH4ONL\d $)nHBR%%0؜0) [ܠJc iynH Jc8jPr}*))mm<Է&I%1ڜJBQ)hH6(R.Kr))mmRI>6ҘjxRIOtࢗJb}ztJA)JJ[l% P)JTe40(N> JI)JpSn7d% O)I)4ԉJ{L:I S&%- Bt2iI%,BPNҒt"TRP(O)SRRН$RRJ)42:IJeFSJJZ)&ܚSJJY:Iԥ)Ja%- BtJaBe)IKBI҅)JTe1))hJRܔ@L)JR)JJZ)O[OiIK% :ܣ4)<% D*JY(N)J))d$M2J2iIK$%"4(IBI+wW>꼖%%[rrB((9$LFDC'D%002HCrJfҦ˜C*"RS0BpB' !H!THBRB$M E7}R$bBtȩI$$R&N$$$I'I%)$LIRI$2tRI$$IJI$$2HRI$d$$INJRI$$$$IJRI$I$I'I2RTI'I$RI$NI$I$$II$I:I$I' 'IK$Ip' $IӦ R$t)$$I'$%I$J;R*Y't]VW?u-)!I%ib$(VūUY]QWGʫ_Q!TIeI+IRI$E:JRI$.RI HRI$JtI$H$I$I)I$ItRI$JIRI$$RI$NS$$I$I)I$I$JRI$$RI$I$I:IIJI$I$)I$dI%)$I$$$II:JRI$M I$I$$I$I)I$I$I$I$$I$I%)$NJRI$I$RI$I$I$I%)$I$I)I$IIJI$I$RI$$I2IRIJI$I%)$I$RI$KRI$I$I$)$$I$I)I$b$RI$I(IJI$I$)I$tI%)$L2I)I$I'LI$IRI$'IJI$$$I$IRI$'IJI$I$)I$PRJRI$LJRI$2t)I$I$IJI$I$RI$L )I$/Uwފ-hJTޖkBP%kKUw%Z'IZ]nIVН%dܐUܖjI$rctnIVIYm$RI$zU$V=du^RjI$ZSʴ%ZI%gLnU)IVtGtK)JJRI$zɍRI$mHUjI$}TTIZI$_U/Q RUjI$}TT)JPU$FS)RI$oU7)M$ERPIIH؆%ZI$OQ/Q $IKCI)$D ^tIO)E)I$$I)ME$IKzpRI%=nQI%)$O-)RI%-oQNTI'.M2I!I$}JdRI$TS$I&$$J%XUjU%BT{J]:d%]JvTCr!CrA$SIR IJHRO IK&L' )J%:bR%DS ‚IL P*eDSa$n ; S(CDF(Ax#ҫ0. +\HceUiSDiA.U*g+FY2H T4 wCsaZstB,*a<PK^$ZxDpƪRTBI%ߜ"TI$ҝ%0.AJSI%0ژ241RI4Em NI$&R\$I%1KÄx)RDQRV:u*PyVXyBR%%Ko;b>)tɹI%(~9KuN$%1 \! 9:iK$TOÀwO7 rIJgÄh$$'IRv_HiJRI$iS LJSA SED>䏂bR$鯊v|ȑ2I$dK!H1I"%.)`t Ph☧)2H몞)L))Q*PwNLSɺ D'&HLJ \sӲb?I/dÄnAGD"'#qRL%$+(Tᧄ%2JW:y':/ʙ<ʌ8A}'ґ)))P RHT"eD;|ӆp>QJSJJZ;q@' /bRRS\iHA*EE!+JPJ#Jf2aAeDR Tȕ$Q AA'#PB$cyLI$RNQRI$')RI$$R$d)I2IRI$LJRI$E$RI$$HRI$d$$IJRI$I$I% % $$I$xIJI$'I$I(I:I)I$dBtI2IPI% 'I%)$I:PR$nSRI$')$'I(NI%p$$NJRI$NԷNԷp[-R(&I+KI$(VūUY]QWOʫ_Q!TIeS%i*I$I(JRI$$H$I$dI8H $$I%$$$I$'))I$I$%)$NH&IJI$I$RI$I$I$LI'I$RI$$JRI$I$I$2I)I$I'LI$$IJI$N:JRI$L2JRI$2II$I%)$I$IJI$KIJI$I$%)$I$IJI$NJRI$$IJI$I JRI$IpJRI$I$I$I$$I$I)I$dI$I$$I$RI&NI)I$I$I$I$$I$I)I$I$JRI$I$I$I$$I&NJRI$:dRI$NJRI$$RI$铤I&N:JRI$d$$IN%)$Nd)I$E$IJI$I(I%)$I$IJI$I$RI$I I&I:I)I$IIIE$IjI$I$I2I'EJI$I$BI$I$I$I%)$I$I I$I$JI$$JRI$I$I$I$$I$I)I$I'IJI$L2JRI$$RI$I$)$NI$$II$I$I%)$I$IJI$I$RI$I$I$I)$I:d)I$IIJI$I$RI$I$I$I$$II$I2tRI$NI&I$RI$I$I$铤$IN$$GYUVx )J*J( 7{3t՚*UIK7"7)HI&Nd%)$R 4$1I9L' *I)J%:bR )bTRtQ*CU0Ʃ%TʃD a 6NnB+J+JDiA-wWۂ((( ((V** QASmR%J *Ս@p*@L$R 7> ;>Ӧ$R#Å )iR e<:b9Ny)JRJ~Tj_exp!E.i%h&THH *L!A"3JH€S7(T JfN S SOޤD$$PHIK:hQ()I(N"$I4'%.dBhO %.da(N$LFO BJRI$ B&IJI$BP$I4% ҄I4% $I2I(IJI$$(IJI$I$RI$I$I$I%)$I:d)I$Id%)$I:d)dN@RI$*A2tI$铤I$:`$$I'L$$N2tI'V>3ձWV>3ձU|e *CɤJI%(VūUY]QWA*?(H}U$YiVI$I%)$JI$I2I$I''IJI$I$RI$)$I&I$I(N$I:dIJI$I$I$IJI$L$I2I$$I'LI$tRI$'!2JRI$t$$I'LJRI$2IJRI$$RI$I$I$IJI$I(I%)$I$IJI$I(I%)$I:IRI$I$I$I%)$I$IJI$I$𒔒I&I(LI'I$RI$I$I$I%)$I$$I$LI'I$RI$I$I$I&I)I%)$H$I)I$I$JRI$E$)I$t$I$IRI$$%)$I2tRI$I%)$I"I)I$IIJI$I%)$I$IJI$I$JRI$P$I$t)I$A2IRI$L%)$LNRI%I%I$I$RI$I$I$I%)$I$IJI$I$RI$N%)$I$IJI$I)I$I$JRI$I$I$I$$I'L%)$I2t)I$I)I$tLI$$RI$$JRI$I$I$I$$I$*RI$I$I$I"$I'L%)$I2t)I$I$JRI$I$I$I$$II$I$I%)$I:d%I$dI$)$I$IJI$I)I$II*I$VG *%)EIErryIKLZ]R]%,P܈Pܦ\$NI'IK$2A0RIK$ܧ )ItAH(0*L JbT Q!L)4 Q*"0PR#(n(FTV@ZpL?5p qIH%D@$鏚r{$䓦I-j?&YNM)v"$O+Rj *Noޭ uRhljRI%/>!4FdJ\$5KlhRJRI%(x#HkK W?u 蒙΃I^0iOum"`~⹶[=[9(iu+#T#]Aj |UHJ qtI‘HH2xRI.))a8!qΉI2J\Dpn idbIRttNr%2RQji)b2 d4N54v2dFRS9RANqL2%Tb%1IKTLR&)1))p{P$JbRRL &HtN5LJI%('1LIJ ҎE2E2HP qdY e]ÌW4>e`5g7]-!ݕ+{uC|&Vü:ZEն&O&~?j?MwHæBW ?zΟ0ZHS\}MVz N~E6m{@ߨ x崏vMu/顓>l Mt۠7Ii};/0Vې$PvMCMOiU_1W1 h-:pOoJ.,%DXK|U&ȬS;Ss-HX?۟l/saɮs G ,=xG|UJMø@peg|kf}U%s'_ 90?3]g쌆v\U[v[q }9//Pq--Å߬{9Gعm/\?^HncI?4]Om0f &-^ %gO#ɸ^3cy11ni|TCjp GXgh0'm(Jh$D7WcCnG_{KL?ty/Ve6cZbu@Jޛ%;SPwcyg&g\ ]૾&xL??ty6=fx ^l&V X0s??4 ]9/!#>;g_vK!) >η[ ͂B,`Kk??4j3YaɮΑK0r>AWaN-°a03??4g?lg&bz]Gu]t$G\U&[ƒmIz։9P?Q*ka$ѫd4LrPU<Y2'0j`, \'ƧwMH}Bm58x&DgWݣNRHw{[וZ>wM!oC0j3tU+'jRezZXXC>1ۿj_ kmKKG}/s?%&VGyJBTW>~㷜5ۗOF3X =U+B?{?K\?&i ~*dKw\F9͏ҿdߤ7/E q \gׯL6~Eg20gBrxe1u+6>KntGW<0NTI' $IBI)I$tA:IRdH+_\Kثg?o[\k/̶[)Hp8\I$,]$_(VūOUY]Q[?ʫ_Q!TIet+IRI$I$I$JRIJI$I2I)I$t$RI$%)$$IIJI$$RI'L$I&I$RI$I$I$I%)$L2I)I$I$I' )I$dNRI$'LI$$IJI$N$I:II)I$tI%)$LII9LI)I$I$JRI$I$I$I$$I$tI2I$I$I$$I$I%)$I94))I$I$JRI$d$$I$I)I$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I2I$I'L$I$I%)$I$IJI$I$RI$I$I$H$$I$dI:I% )I$I$JRI$I$$I$PI$I$$I&*A3RI%I%I$I$RI$I$I$I$$I$))I$I$$)$I2I$$I'L%)$I$IJI$I$RI$I$I$'IJI$I)I$II%)$LI$$I$I)I$tI%)$Nd)I$I'I%)$LI$$I'LI$I $I$HI$I'IJI$L2JRI$I$I$I$$I'L%)$I$IJI$I$RI$IRI$$I I$I$RI$$IRI$$RI$zZi%)E:e^rr 9IKLY]R]a%,P܈Pܦd%1I:dI I)2R)N$VI:EL&)I1 `eLR )Q(J7TR'4!*0V@5Eb B :*wVj²\7ho+G YGhNYf ]B]r>K g EOsөp׏[ U\T<;J<Αf3 r3cEJ6Y"~+'U_Xk߀aB&57Rh> _2yUҭuPscRO?t>cЕ"ܢjDsʷ)*ii Rǂ5KU(Ht)q)TRc&NIemRxWe"UܤrTp_uV)H:%ixByUXBvX*܊{r4h+LP4ViU>қ=U?}l͘|IWd&HX$qI$DzP!KWߢ#iT>֘ Фi L~4-Rܳt&hIO>֝teo~iO+h EB8&VpKrlhR#A/ٚhuZ{[rjc*Szn'.hN mӘ\K-\%c gxIAD,.-u (%浐:wFӧ*ґ$4)l{&op;JbR %,֞7- ҞS"xSiJR%( #D8yS$THGne"SJI$4HJiHJhRL%*@J%)Jba2JZ S'1)1))`5N8)jS$D M)Jd8N)JHZ)$)& PRҒptI4iM(dBxO)&ҒJI2S IJNA<)IJ rdRН$L))II)L)RNSJiHJ)JiM))d'O)4I:I1)HNS&ҒNI)M)$$NJdҔjY$yM)JiAJJNRQRД'I:RSJJY$)&I'Q%*I$򔦔BI$)M)"$tRI:JI2I)d)Q%,t)I%,$I4$JRI'4RRI$*2IRI$SʊI*I'2dN)())dRҙ$TC> I^s^%Rk5ZͽqhTnea E~\*,2j=4y<a/.K[o)Xu<9V ;bWz.{&~%Hɻg!-l _HQ}o p9QEp2@zGdmጆ|V~r]ah`\RZCI93x#n_t="HELP0`.i( Cp{:v h{jdd֙%cY[v7y~Cׁ]dezL-h{h6K<{hXVYyEݼ۫&6{mv{^|?h7hYmN SEV],ᱤDˌ%J;s{x-?tx[U-!9`pJ2Z^@%HHBG)* s"O0j7 0MaJ^A K < 6ƑT"$VrYpCXi$s yickn"c!{Ekξ /dv' )1Xxo a. 69ϭq;EnNO1hg y#[ZǖԪy6Hc8|Rpx13YjÿWmkRLmxFgpgOcӭzZ̐5B5ĉV~{xleD5J]{S] w@vc^mn[Z h$Ϗt/h y!^cZ=N" w*TVu%x ȬZ{c`oV,;Ez׈w~q> K\%N>1(:>NF48pM^}9U$uO']diܠvH4X)hk#sUPZm'@7-+~xV7` T/6\ Z;vzCC \"."Խ==sAo{أ OvdxdV\+|aScⵡD>Iau $ƹ \+6 l IG!ccY?9NǖO22 T=iVYSYĔC7m0]đl B Ļ7:$8\Qg][Zby\g=Q #< ?$@ԁƍUK Z N]2tIIJI$pI'I2tL+?\Kث+?\KتwYeJC!I%ib$(Vūr_VWAqb*?(H}U$Y$$I$I I$I$LI$SI%)$N$)I$I$%)$I$RI$$pI$I$$I$I%)$JRI$I$BI)I$I$JRI$yL%)$KI$I2I$I$E$I I$$IBtI)I$bI"I$II$I$$I$I)I$I$$$I$2JRI$I'IJI$:I)I$dI%)$I$IJI$L$I2tRI$$IN%)$I$IJI$ $IJI$I$RI$I$I$IJI$I$RI$I$I$I%)$I"I)I$I&NI$I$I$I%)$I$IJI$I$%)$I$IJI$I$RI$I$I$I%)$I$IJI$NI%)$LI$$I$I)I$I$I$E$I8LJRI$E$$N9LRRI$I$I$I%)$I$IJI$I$RI$I$I$NI$I$$I$I)I$I$JRI$I$I'I$)I$I$JRI$$I I$I$%I$I$JRI$tIJI$N:JRI$$IJI$I$TI$I)$I$IJI$N:*RI$dRI$I$I$I%)$I:d)I$I$JRI$I$I'I2tI2I$I$I$$II$I$$I#ѢUY$)(\Q@g))t铫Tu+lIK7"IILRI$I/$IH' 'Lt)$$JJA@!JbTTLT*!H@IL!@BQ ))(QWԂQ8@U%[vW' AhzLUc=ѢY% τ'ڕV.))U2a[ ơ,6YX?W.rIGLmC{ gU`}WX Dx+bLhvIVè<6LÄ;u< VTMqQRUv+f4 e6nsppǂ [ӐT~nL\т<' W~ң%9)}hmR >*'([KJs |GejpЯ}GqMh0dž't5L6RU(LcBP}9*r%5<8V!8 P9'T%DkwGJÒT~|UB{FI\I$Ne6h *uw' §)Th} +R9SrJ^OD/yG鄽0;ST"J׮R7)L$G鄶"$:&JAE a$2u+K+-P}aCM#5YFk\d *u~*3=<zJsj;J ⊙D98))4!I'$[b E1OI)a)ySuӺ|P΍vEn]7U2*:@ЎUuljkQ}/a3r|ZGCUߴA@~E8z3ʐ8I);U\A[*{[ƅ3q&){`n$Bgdzm Qs\L;a5TV$4N lGu&:~ր y(6Nr5@t4n'="L£~vH@FZݶ4Ak\qw2kCl*\-9VHZ!϶=GtO ̾XAsi8>iTY葪H4VƍJUA7` D @YmlTy@訳9v?_Vc 0Isa-ʫK!վ&: 1MnM\8jWQ}{}A ,'OlZ=FKBΙ2kSF!4À Q Hf4ΉSyznuV}m@* ĺ4R5s`udYt=&X"cA~=B*b$Nnp*i= e5X#!>2 ]+NR i<*2+WP݅wP%'R (d"k;8A|Tmk;hE~3,$pQ)A$Хed̗:=!<өA4S:S-.'@#DF!{q캦:8:w=e{ɔբ61{f$MFAv|86HO b5(o0^}tH1授h> fZjBiFÈ%'i/jUFOwyIlĸmb\܋@OFuձI+ F&8BpyI. -A#S+ITvTvNZw9{U<ۯV@'Y_icݧ+)~EĪx}WQ[#OD%_of|-O_livh'sH(x췚$pSBtI$铄I$$T$g?o[xV>3ձU|e *CɤJI%(VūrVWAqb*ƿ(H}U$Y$+IRI$I$)I$I$ tI2dI$BJRI$&N%)$I$IJI$I$RI$I$I$RI$I$I$I%)$I2I$$I%I$$I2I)I$tBRI% $JRI$I$I'LRI%)$I$𒔒I$:bI'L$I&I:dI$IJI$IJI$I)I$IIJI$IJI$I$RI$I$I$I%)$I$IJI$I$RI$IJI$)$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$xL$I2I%))I$I$JRI$I$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$tRI$RdI$I%)$I$IJI$I$I$I%)$I"E%)$PI9L$I$JRI$I$I$I$$I$I!I$I$IRI$I'IJI$I$RI$)$I$I$$I$I)I$I$%)$Lt)I$I$JRI$dIJI$I$BI$$IRI$tIJI$N$I$NI$:dTI$I)$I$IJI$N:*RI$dRI$I$I$I)$I:dI$II$I$$II$I2I$I$2pI$I$$II:JRI$JʫJJ QRQUAg(N:RNq)bBTI$I$LJRI$)-R'L I)I$bR )Q*E1RH5 BS RILIP!L‹DjRfHFK#UU<6~kBEr"TtM\geVp i "HU.*+7* =֋T0h bSO56QLq!1*%9E%.BnT$JNRB08LS'"A8M LJR*$ ԂLJrJ*\ LTTA+%JbܤtS)&!%):dQ*J$$'I%tR*$BH\'LD(I2iN|$I$ĤI{I$"$Ip{% BJRI$)%JRI$^I$%sU9IAE v-* >LN\ҰIT74(3\4RH)A̔r&TN)  Jk'T<8V@;JPSIM73]t*yVP^"RkS )O w?jbrۢV~S uUȅ!@pQS}~*V0 NOwQ)!02[LTJyLRRR )$RRpxNJD%4BI<$I2JRIGd&NTe%):A(KEE%.H'O)I4BA:PHIJ:INJdJJZ/4&$S$JiIK'I$$ҒtbtLƩ%,$4$xH2iIK'I:E$ĦtO)RhRI'NRLNt䦔LI:IJbRI~v{rpxUZ!laQڀ̦ 'v] ч ;n$Fzz &;WZ=G6棑 > YS5y'ij0묆815[G Av@Pu桸2G2[4<SCF\!}!>ί͗np]ȢnY*T@coUo^fSZknݯ`}x/c  -ĸCq(XcIsFG3Dfu~*XZV[!BY`pyzMkQߒ3scѬ%IN5 !ʯ<<[N2\!$p϶w*eQ%w?sYUwg7Jp !]%S\ >zfmw3Ii݋uB+|Jٰ jPhK~5lKOtW:I -=yCmn[uvX=BEKw0ojVQ[d/ݻksvd'YuSU`%wZJl6ZtrV= !L'X<}U1|{qb Nc{.֐{emi=걙V|6!5!6qGF׳kbY.&H1A}N>isO?թQָ y" z MeTƴ0}7=2Ls斊۟Q e`I"O=Yu͍kXpVcV;{,V\f\8 lkѪn{K<:uOk#YA~ iV-P ۠mXC/ySk*;=Du5JTw ?t5Wm }Mi.wkTQnj]RTbIw@D rFm HoW;(][iVh}s>1(IkY^eEv!MD6Ec\_(-5v:{!KhgmKā*dWq; 5?$98hpDdzGxW_w@$LձۦCoc;]#륶 Väʖ=R]^3SCBoZSX: *F)>dFdJ;0k6>y;= 4wjx{ Uc׉ּ50SU1nמUP+dnA(1'ࡓ@rttA$;P$KDZؙ^^g2F5jc[kǸfba=A8]gw!$cwF{t)Z1;~ET7\Z2?bߏMDA 쭸H.um.x! {5';vCjlg"c[U|h\}ʎgV$|Ю-[+LFQ41 @+ „ota8*II:IJI$QVI:JJ?;R*_wLlUs;_2lLp CɤJI%(VūUwY]QWA*?(H}U$YiJIi*I$L2JRI$$IJI$)$%)$N)NI&I$RI$I$I$I%)$I$IJI$HIJI$I$RI$'LI$I$$I$v꒔I&I:I)I$II%)$H$tI2I$I$IRI$$I$$RI$$JRI$2tRI$$JRI$I$I$2I)I$I$JRI$I$I$I$$I$I)I$E$IJI$I$RI$$IJI$NI&I$RI$I$I$I%)$I:I$$II$I$I%)$I$IJI$I$RI$RI$I$I$I%)$I$IJI$I$RI$I$I$NI$IJI$I$RI$'LI'N:JRI$$$II:JRI$$RI$JRIJI$I"JRI$b"I(IjI$$JRI$I$I$I$$I$I)I$I$I$I$$II$I$I%)$I$IJI$I$RI$$JRI$I$I$:dI2I$I$tRI$I$I:I$I'LI)I$I$%)$I2tȩI$I$ RI$I$I$2tI$$$I'LJRI$I$I'I2tTI$I%)$I$IJI$I%I$dI$)$I$IJI$I%I$d$I#RVkXIK&NW\RR'VjWԭ%,T P*iBI$)$dL$S'I<:JY$N<ԂH$"TN4L%,TNE1R BILa1*GU S )*$9EmZ*=N *9<u^ʽH(ҤWY3@D0|1|+JzS]6$%QQ)NJ0[3Z>IK5[+YJ*bTh2E5Pd7?jJWB#Y(/VJ|q P1l)̦pTBME1 h8Lʔ':hRK \lKjS))}JhOK(:i J\98r'UvJJILdI$hDRO ^IQO))I:bEtF iJTQN(LJ]$S>IґI E Rtr)Qz*RI$BnB (v -3T%㮊%*O@0.%c$jN%M$JJ`S %0#@QQ!@ʐzJk=>wWdU;5U=INenTj2{%]AlvμLJrZ;{ xjƚp%SʉI \$$FQR@':DRR xR%1)M))hO <)& H)R M*)IbxR4R(NJDiI BxI:M)$tI49)JJJY$BrRSJJT% RD))d2iJRRO 4JRR$җ $)$'Ҕ%*NJbSJiIJ$Rҙ%*I$2RI'ҚR(I'I!BT>I{{翊kFX+.7D@Y`o.Kq]|_$/!VJ6<8l &U^ʴv iRiq,x MG5fϸTipii~!pcii \fxLB'ex*!4ϊ kdWTIhh6HzKˆkºokiUm}nql1kd>ot!pgBRPЫHWjm`v0qCs㲗c_w68M]%PC]AJޡp㲅EK;lk7iq:"\L40QoiH彐^J0żʇVw7R[s撒t8B!&^ (:c&șy+$8D1,#oUYul;sK+XCBC\.gom6k&Wawcq>(y!׾HO Τ2}shT#DT1G)6Iw YNqhhf'< ٕKu†12]X`Oca.?OJO]!&9t@A}} }PY{%{*Φ晬˜{5E9@pOGe74*׺j҅$1pׂ$CyFc]V~^Hi}4DE3J#+P#\6mmk509}Uo Bx 64mZc"v s! NxE4OVq(&DqZ"&5nv$,d!YFrjgidUV96tP,w1 I!3\ !֝I%;{ #ܒW>%TRj7j nCtvEӸGhk J_nq4U*6RgՐ;PMq``vB^zm.z]ck@䧵qG*(:8 %gTT7q%JiEA !s wV%nZ< KDl}UEd3EnEn $-c0 .LHATE@M<RE c Ĉo >ȕe5q .53CV]H9Ӳ򣿨Ȼ_L͂|$./*;-[?#OF_kެ8Y+@*?"t W;) -I$O)BP:d৔ОRI$rIJI$V3ձUk?o[\k/̉)8QR.M$V.I/(VũUY}QSGʫ_Q!TIfI+IRI$:d$II%)$N9)$$II$I$I%)$INJU2܆m[ {_|djIi`ap)z8ܣWw-6=@gJ;I;u>( D{ݏ#ݳ鏊kq{G̺#A/V51 MI!(@05U[^K/}C"VNJD8CyZsp[%O]H0fܫ`#:L q*-kv+kxE:cq~XZhA;߱ŭ:JMr%6>sr 3HyVHjYs})>ͤ!϶!ă<ˊ*{C›Y>-oZ!$B59^&;e4ϚF G=،c|BNu[]Jł XͯQ+VUg@5GzKgS;;pFF,ed'(hDN)YCDg0ImlkasTR݂io-ySdf v[cL]鶭%[kkԥs\ ; UZL1O -X<^A.P;(}h- Gמ\lo Sv;#Q?u^D 7]`Ą769)lDoH|Jl,⓴ < 5X&c}d9*w: IsR'(Yw'C'p G֫"TK& x1 hQ43[(}2Y\;AvBA$GnG*ڃX ^ VThlM[wG1uWӗA j l_m k. <9g)X7=!h!]b8 rPeZ*M3UvA=ef~ά׵Gq;Sΐ\Su:$fKݫFys%M{`?ըom5Vu8ˌvR~4Xô79;Q^ˍJ'cp.{Jk0tİjQ_Qn#S h.kKOPOIHk̵k`+k–~tPmB|>Kl\VjՇ0~)(_^*9$B.u [Ut)X),5@9!>@s=&}h{:mTl] NlNY2öL5ׇ40*.sIt$omۘD(TV2).ɬKb܏+\L4Cm/O:pv@Ʊp|[vHlZƖtYGnEpHdd2P\n,Э*GxyUg]ضa~ ᱟ[?1gQy x90:mO0'c,{O&Пx[E$I$IJI$p RI$:e$$rg.b ?;R*_JC!I%ib$(VũUY}QSOʫ_Q!TIe2$I'LIJI$I%)$I I)I$I$JRI$qdJRI$% $I$IRI$$$IJI$$IM)I$JRI$I$I"I I$JRI$$dI$$I:I$I$$JRI$I҄I"% $$I&IJI$I$RI$IJI$ 'LI'LI)I$I$JRI$P)I$IIJI$I)I%)$I$I)I$dI$IRI$$I$I$$I$I)I$I$JRI$$RI$$JRI$I$I$I$$I$I)I$I' RI$I$I$I%)$I$IJI$I$RI$I$I$IJI$I$RI$I$I$I%)$I$$I$$I:I$I&O RI$I:JRI$$IJI$HJRI$I$I$dI%)$I$IJI$I$BI$I$I$I%)$Nd)I$I$JRI$I$I$I$$I'L%)$I2t)I$II%)$I2I$$I&I$I:I$I$I$$II$I:I$I&N$I:dRI$I%)$I$JԤI$铢$I&N%)$I:d)I$dI%)$I:d)I$I$JRI$I$I'I$JI$$HRI$tRI$I$I$LI++WXIK&RQ@܂RR'VjVتT%,T P*E2rI'I2tI8O)I&I$$I$)( )PSĦ)0x0:b5PR )P!MAȭԫlW(< F;3@~ FɍxYBU[zQ蚽ZbtNyl@F Ƃ\PV@LTRLJJf)tRhB-RS9H8S@LD)(`)$[)H@E Y@tD!D=L0l&*J$[ HCn*AJM@VRlxS<@)Hd Mc=;J7!ĕ;%EoGt7<JTH' F Z(bFX5KjtArKx"RS6T%.I(LiMP:J[/5)IKBtHD$JRI$[(JRI%)G NI(8);IJc B^CI (6 НD'I-bTT :bRОRM)ILa$ yIKJ)xO)%$S)JS)ԡI&%*)SO&'d ȅ )f "VT (N )Djd& PґLxH'L)&IJI8I$& I:I2iJR)$'LR)ZNI& &I2JRI'NRJRBI$&IJI$S%))I$)JS$I:ILJY:I$$RI:RSI$:dTI1I"%)$SRRI$JIRI$$$$tI$PI$$I$IJRI$2IRI$I)$I$$$ILJRI$4JRI$I$I$dRI$&I%)$I$EJI$I$)I$t$I'I2I)I$yLI)I$I&I%)$NdRI$dRI$I$I$LI'RPR@$Koe~{D|2m>(Y@D|W>bn?݋z"oCeulۿUucMW6Z3k'쇎 +k2Ն}%Nl%ΖL&8/}dpEï%ьcnABOufe{)&x=iǵlp[-;FXE~~){\boc_[~T]%aˠD2f[\<HQ}9OaӶZZ's6NM մt{(t>Z5%K+`yff)+UK,vB7 ,nO{jiVZʨaM]("ҽT pi䮆ĎxD}A^ڝ:ީ_S F4@|Js2:{I 4#SkXeS uiR8TsP =) dž)$v.cC?8+X`s}V(.0}!YN5EA2%@MhuHUj0\.9cj9VU̫^ :0Qݐu.w8*X#]aX!**cSpqyvOJ!>=Z+S#I$: hQQB&*8b^FݿJR,tMđ%V2VCFoo}U2%ۥ[KSc!]${ƠsCG#;HUb+ |BJ!u@sDF?+75iUvS:q+r{ Ok\S8sBB gޓch=έęq+4kcwܲOS:oy08nB%N$|߳YY-񅟏ԟXxGqȘ^U!)4EA {݅IKO*kZK^KHgc5E%!Gb#ģ% y*O*u>f[vF[kOd56\!BOVIqEeeϒ5sa˙[`8G*Euo`;:8,Ρ$X$(vVl~ h\Ye7*9ډ&Z+y\&>>O; ߩO{[j .nڡWk40No@XHz[q yӿ [6#]RU$?'V9:+Y@E{5X|P{Hxv#'uW}(C[^!%JǶ$L} ͬdq N cNޒaw X`|s[@PmkKI(?ZH9`yp-S|Xtp .,a$߰]|ҫE9iAIo2J=G SIDjsH3"UTw<$wTs -.ZuON3Y;ϴi6HkuG}kft'Z[OuL;)Dc\oױS?g][}wȪI\אGS3Ϧȭr'iwo!gPNI$NIJI$p$:d$RI$}sg-b}sg.b?ee‚x\I$,]$_(VũUY}QSGʫ_Q!TIeIZJI$)$I% JA%)$I$IJI$HJRI$I$I$$RI$I$I:bI$I$$I$PI$A$I)I$)I$rGTRI$HIJI$IIJI$NR%)$N$RI$RHRI$:I)I$r$RI$I$I$NI&I$RI$I$I$I%)$I$I)I$PIJRI$$IJI$I$RI$LIJI$d)I$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$dI%)$I$IJI$I$RI$I$I:dIJI$I)I$II%)$I$IJI$I:dI$I%)$I:dRI$&NI$I$$I$$I$I)I$I'ВI$I"I($$I$I I$H$IRI$I$I$I$$I$I)I$t'IJI$I2tI$I%)$I$IJI$N:JRI$dRI$I%)$I$IJI$LI)I$tI%)$I$IJI$I)I$I'I%)$LIRI$'LI$I$$I$T$II$TI$$$II$I2I$$I'I$I$I%)$I:d%)$I"I%I$dI$)$I:d%I$I$JRI$I$I#ҬԉV|PRtʽ,rN:W*8U*VJX2TdJ$I$I' AG )INIIH' LS*A8LĦ*J%H) **J%L ڒuD(nEjcU+ԫB N;:\ ѶcE}D+Wp>`Ǻ+R_3UqA:Z^Hp̂ \Zqg ӵ{a0GN*pI:B ȤodY Vŭ$J5ZÕJ7 fZRQ͐9T[ʑ 4GX杤T.j,ם=0XlKT,h $p&S6q?r.AZB& w)0Z@[DImW9V8f&{ JvV J̚3MR6$REr !]i#Cp@׺ПuU͏l=UCKAXus nꊦ`syhVYEOwX"?.v [dLJV5i KekUe4;&8%ms`VvʛA ,;}7 [ s#%k)+-{`FJG8T.Gb5XAGǼXOsag!ZIUix۫L̔o K' Xk['BcKh`$hwҏn\{m3ʃnkٵ%k@@5iGtziG97q" #諾TL˜|7I;I|5 !N}{=;EP SVAh:t'U},io Qu8pG%͞P#mŰ!EgTRYQIoӑ](g6ÙؕEŠ [%wk7,Z~W8mi,yW@xXl$wϰsShy#A,h`5t >("VY~x s"e9^@3$M ṠFzlQcB;RG܍f3t >Y-G]mCA~S=MG4TJYH>c}k/%U2{)9T+=ŀBcl[48׺ʎ?"*y<> g!Z?1gQy\?VMG%d>4rO i$L$)I$2t:I]$&$$$NԻUwLlUs;_2lAM.I$V.I/(VūTY]QSGʫ_Q!TIf IZJI$I$I$IJI$I$RI$I$I2t$$I$I)I$I$JRI$I$I$IRI$d%)$L2tI$IJI$ PJRI$IJA%)$NNI&N$I:I'IJI$L$I$$$IdIJI$I$JRI$$JRI$I$I$H))I$I&NI$JRI$HI%)$JI$I d)I$d$I$I%)$N$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$JRI$I$I$I$$I$I)I$t$$I$I)I$I$JRI$2JRI$I$I$IRI$I%)$I$IJI$I)I%)$I2tRI$$$$I$RH$J $KTI$I$$I$I)I$I$HRI$I$TI$I$$ILJRI$tRI$I$I$I%)$I$IJI$I$I$I%)$I$IJI$L2JRI$$IJI$I$)I$I$JRI$2I$$I'L%)$Lt)I$I$JRI$I$I'I$RI$'I%)$L$RI$'LI'I$RI$I$I$2tI$LTI$I$$I'I$I:dRI$I$IgJRPY2rW\RR'VjVتT%,T P*E2td%P )I$$ JRdI$RI$H(R )d' ^j)Ġdp'%1)rMmD )Cr!PpE`WR]vNVVy|qG*&qdm2%QpBJ„Qrb;xB%FgTk|1TITH )Sh@;$d&R3$!H D5RP(JQ( Ip)I PR $mPĔ)BL!H;KbB$ےܙ]j,hFf'% ȁʯi©k%AVByNuM$2 $dJpI#4NΜ|p))hH&y 2)I$ABN JRb\uqrҒt1JRO )I$\!E)I'D_T* Cd'Q J9L钔&$@)$!(I$gh$GUq7X@䨴adߺkZ*a|5.'sSZ7{ fzAu4kHKC]-`!90ѕ/0:#R{#@|kᡚn:.u֠>Lh<.S$&|6G%sH @Zl$574T2kid얈sKD("uYdm?CƼ=rv%DScΎB̆}' tN.gK0F2{=ȭգZ==04 F5~D3! .. AUl mEicw5G@ij05$_p9hV}n.t=Ѵm]\4AMCWN!80)R\ڹFqkO1s}0$JK6̋~< ρU.]` ˝CY]aYe|eu`QYLi:N}nc]eqNJ:C66[cn($]#MaXfSߨ;ߐ -D85>^(n{Fٗz9kS>zfm h *X_a`!tw@',j|uXԻt^a0C@)4ם-x BnN $V{j|8no`[ t/80$TOe8k%3|RCpɫ4oo4)U7h_vOMO,2wW%5)&<+.}~FѸMY xA,,5rvGdjG*׸3VWq'ז. Eo5|JT|7JnphʮKjw~L=Xkh kEed6e3iZd]21*ag$He`ne3;!Ά6s?b۰d h$9| {i S6KRsN;rMmvǁPӴIJ$tN %M`;5 71n$G53h|c `ׁ_d]-lFD{hTn\ZǸdsrgBC5a- x>ljb HhKZwF3ձWV>3ձU|emALp$IZXI$(VũUY}QSGʫ_Q!TIeIBJTI$I$$I$I%I$I$HRI$d$I&I$I$I%)$L2I)I$yLI)I$A:dRI$JRRI$I$I$H$$I$JRI$I$I$I%)$L1O )I$I2I)I$t$I'L$I1I$JRI$I$RRI$DI$I %)$N:I)I$I)IJI$I$JRI$9 $I$I$$I$I%)$J!2p$$II%)$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$JRI$I$I'LI)I$I$JRI$I$I$I$$I$2JRI$2I$$I'I2JRI$I$I% 'JRI$LI'L$I$I%)$I$$I$I%)$I2t%)$I1N𒔒I($I-*I$I$RI$I$I$I$$I$I!I$I$JRI$I$TI'I2tI$I%)$I$IJI$I$RI$I$I$铤$II$I$LI'I$RI$I%)$NIRI$'I%)$L2tI2I$$I'L%)$I2tȩI$tI%)$I$$$I'I$I$$I'I$RI$N%)$I:d%)$I2tJI$$HRI$$$I&N%)$I$IJI$V@UV{$d.@g( 3N:RRm)bTʁR)Hd'I2tRI$p:d$IJ)$p&NLD)2Q*Z0N)rLQJ`B GJUqA!pY9@Z֍>yVƁW^:yZ8-UIZ$T_C%MEk^ !Dħ)S0%8Q I ILJLSh TTaID)DY!H&*2))tt%ʉJRR$$ZҘR)(H a/Q @I+)mRoyA*EG򤅀RI%E1IJN:J)$I7 %AIJI$I2RI$JyIJI$<$I\& IJI$(pT;'L%^+CP_I!bj1@h6I%L24 !^I)Ӧ$4' &!b 8I2yI4')BPҒIZHM=ԈL*J2|RN9S" NBH+6QRBV0 D%.'LTJrTJHRt2r2tJtRI$iI$)$I2E$I$i2JRtI4JRI'I.I%,$LI)I$I$%)$I$IJI$I2I)I$t$I$$ҒIM)ʉI I$LI.RI$dRI:I$)$I$IJI$&)$$I$H)I$E2I$$I)RI$I$I$LI'LI)I$I$JRI$I&I$I%)$I$$$I$JRI$I$I%)$JRI$I$I$dRI$I%)$I$IJI$I$RI$I2JRI$I$I$__JI$uW7$mk(Fr#GrX"t5\Zx%ӱZ"N E՝Ăd7LZ_`Gacoe>]>J0׃y2d~R{/P}"yP}oZl09SC,$QwPqp,p*7RMAn*$<ދ[~uPם(.*ٷS a3ʕU i3&Q fBgnB;*y^v(`\G'R.ud|JJ恮}J5ΡI@p0^X]4GfqsT|7c:"Ӫ64ճMgO;vϵhs A4Obn.,`kxJeS4(Nc<ʱ&?YkƧRP^5vAi{xlu,huHY!!ٞsu @lc4'Z̵1@^: 7f0{Oe;+isY{KqOatȬܻ+y j$hxOV{H)@ C:.[mSmy^FEĉGeό-!:"N [0ucs lC$8|}A(A$%:W80 ߫JIJ8?ؙsttG%ZŦLY; 5z&0V6jRuPmh&#X ݕ x xlJn4H$'*ö8J/"Q  ye5##-a(vtv5q'_šCУm;rLzތ:@uG.ɘpHx1wN :Ҭkt-)Aq.orv^Pqt(׷qϩ\{Դ< y4ЋUK|ZtRq$OeZ{I~IX'Rvzitʎ3J $&u6hXim{ʝ=.s 7DM9{FX*:$jIC$puQy$c=90mmDx(Slm E86gB"q2 SW&<i,#/$mG(oC xTplЁ|Ufcxm5'諾~(4wџd3SʯfOֈ,_X6; [6T8R|bd4TY`'MɬK`)X͢rRLߚ`ἀ5Ny%BA(6F/DDQ;qNX 2KjXzf^V^IX]obEZϏ+CO?w>\L (>%sD+kf & pppl6gQ`nvfnh|oFk+\ z(ueĝ>cS2/OD8\  s[-oOɷI)I$RI$$I%S))I$I$JRI$IdI$$$II$I$I%)$I$IJI$I$I$铤$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$JRI$d$$I$I$)$I$9I%)$I$IJI$I$RI$'I%)$I$RI$JRI$I$I$I$JRI$I$I$I $I$I!I$I$JRI$I$TI$IRI$I$I$I%)$I$IJI$I$RI$I%)$I$IJI$I$RI$I$I$铤$I$tI$I%)$L$RI$'LI$IRI$$%)$I$EJI$)$JRI$I$I&I$RI$'IJI$L2IRI$tIJI$I$RI$'I%)$I8LJRI$2t)I$IIJI$VjUR2rV {3N'V*WT%,T C*Itȥd铤$JRI$tR'L$ $$IƩB Y$铩L ~p**E1S!6  ĕUB_$507QV|/PJMkgkAdgS\, j\Is3?1|hsr~#UǪ yL&D'\5H%@H :Jܚg ÕacT eFV9"|)wS&u \RҸ*6q }?!F%{)I읏 Jk-GHŌЅnvJ"5c 7K'.pUzkh%jK`*ӝkYpǔoTl.cK9(ڪڟf{;8U c=վKI QN勞8[ܡY]HvA2΄!i:m54:+5a2J(3-!x;ΆT2rMGN]Y@-:=9AZ#۳5 -TƟ1[]Q$JV T@m:q@PwkUL%ǀH٩N1~ sōV?TsӸh+| nxxji-Ɖ}y+6oxg*N&9FZw{D7ƻp6Av $ 쬻" F굀-t8!T7Z d>H&NU8n-i۞׎8(BP{a&K^8VWp$$qΉBb*M\rj"~ss3YѱuC}>v,QKq7(X6i+giJk*`Ȇɭr8lvYXa>ٯ!άCD:KN,6>=?vTKd0Hy0dS{Ese-OߒT8x̶qXop?Z .!5.&'EmwqB87@tAz푡I'74J5i#ĭ:) *0ҌrA<1%[`:X9Wlc_.hC t(щx&?V9˩h$EF)%IH(T$.2t>\%)$I2I IJNIrI$I$I%)$I2tRI$IBJRI$'I$I(JI)$&!B EKH- xYQ{9Grg(<)(N4O*!8AKE2tI%,R$2tL|!d%,?)p2I%b)$K R %JT!OIK/+Q)-L5*%Hp8Q)rRR:d1L))II2dI I$LI)tI)LI)I$$2RI$RJRI$ E%)$I$J*RI$I&IJI$I$I$LIӦI)dM)$TI&LSI I$LI)I$$"$I&N$I&I$I$LI$IRI$I$I$LI$I $I$"I$I$$I$$I$I%)$I$IJI$H$%)$NdRI$I%)$I$IJI$I$RI$LJRI$2I$$I$I)I$I$JRI$I$I$dRI$CTC;)I$\[ƿ$6PA!?QZJwZr8bbn?݊ ξ>HfآgRٺI^cYP5ovf ښI q w (0ae^45 Sc壺];vHo&P+e\ry| |;" `ĵ0cXmqkv@R~?sO m iR"晈*\I!OsI aRȭ;HD+0@@^Ƹ4( 颖;LW1C-a$ÉQ͗Q_NuYW{`[=ϲƘhԩYf=vp]-PvG>ju߸ø8 1\&gW;I=>ҏM["AaU :B, 6RAIDu5)hi7!@[}xޱ;]  4!^^[BVc;PLt#Y5JFDc[+UOt$+CjKe k?r"{΁3qg {, =nc!dl5 nBw3{Ңk 7#ǹfV7B^Gv4H,$]$ 6Ne:G3fw;KUtͬ$[RpI?쩒 $: x׊85G!ԙK Y1¨$oKҙpIVcAӼޟCGJH!ĝg;yAWܧ[f5B֘`MKkcC[t*I.!\c#*;..F Ǻ_!W?$w4d^ C=2`?~0:@o0iDQBuᣴS! U^ńKtZjĞ /O4C !68m"_S7y2:2쬇2.>> zEU;NIB*i:\[HJ t[}@ Z<ʝ][v@%N`ӭo0sQUe3̉YkBVmW];føT̢>*b@" ̋# Ǻ>v'k`{dSDXUg% .n | NϧL.3([{$pANxw DX IJJ$h$HwޓMaGJWxWYD@T\-y0}~jbnpaf7. ɎC! %i>t Hi)cIT M^2W`k!sf^{kgPSWm!.Cݑo ͹xN-05v`ahpFwv3MRE׋]amF O(Wd@5Ulg9A@9=\*)-UѾHox}dJ.-s}ݣwunn調6]#|xݎ%Θh*CmmD,}ĺ`i@TuV 68v#CѦ (N vBn;sBpkħg:*sv0{Gdk[2dºlX7o"4Foo[cp&Hㅔޤ润Off[ְ?IfYa q.l5M{*wR"^hlHY"lq}?[qͮy, kEe㾰6&i,I$ I:@$I$JJI$Y't[V^wLlUs;_2lAM.I$V.I/(VūUY]QSGʫ_Q!TIe)B]I$$$RBI$) R$$I$I I$ $IRI$ I$ N%1l$$JXc9G1hu!϶ck\nn]o}>[Zq^}7³]cyI~Oe//)!AyF%Fln~ % KUÚGҭO6sYwQQZK1+D߉*I#Mq[nj`=U?b~ν^COXFS{kg}YY.~f[0+ѦZ\8$C g4EGY /qrsMcfA:w}'4|.B34\LJyLV;I t:tI$I$$$I'LIJI$d )I$tLI'I.IJI4EuA5OdUCȟҝ!F +'L:R' TI$:I)I$I )I$I$%)$NI$I$$IJI$I$RI$)$I%)<$I$IJJRI$N$I$I%)$I2t)I$t'IJI$HJRI$IBA%)$I$RI$I$I:d$IN%)$I$IJI$I$)I$dI%)$I$IJI$%$IJI$I$JRI$I$I$I$I:IJRI$:dRI$铤I&NI)I$I$JRI$I$I$:pI&I:dI$$%I$II$)$I$ )I$I')RI$9:bI($I-RI$I$I$I$$I$I)I$I$*RI$I$I$I$$I$I!I$tI$$I$IJI$NJRI$$$$II$I:I$I&I$RI$I$I:I$I'LJRI$$IJI$'L)$I2tRI$I$I$LI'I$RI$I$I$I%)$I$IJI$N:IRI$d$$I'L%)$I1N%)$I$IJI$N'IJI$L2JRI$A$BI%bk̪+I%b9Q@܂Ĕ'L+LU[bJXB"TI$%)IKI$8L$$E$(IJLIӄR)' $:dd%,)RCA JQCzQ>>V RJlw[HXYI4T'䮿EFҧC=-[U*NQE ԔXS4$P0<:`8L:&NJ\&8QMt%.BI' TNBQQ%H' *)bNtҙ"RRI:FINTJIRt‰kI Id )I$$&))d$$$$I)Jo4RI$$D$$I<&NA(,$KdRI$EDIX_5W$w]a$I)% 'N )R2J!8AKBe$I< JY4)&*IQ$)RRM:$X!H'4O))e""Pޒ`j225MEiE):IJdD'LɉNSI$7r):I$:bRRNR$I$E2JRI$dI:bI)I$I$JRI$I$RI$$JRI'I$$I? &I%)$I1I2JRI$I&IJI$$I!I$dLI$RLJRI$I$I&I$RI$dIJI$I$ȡI$t$I$$JI$I$I$$I$I$$I$I)I$I&I%)$I"I)I$I$JRI$I$I$dRI$I$I$I%)$I$IJI$I$RI$I2JRI$$$$I$I)I$JU1 *U!I{^F9<&WgEl=Ynpq |BC{\4\/?݋ aۆ-|#ƞ+;' 7հ>}O\u/pf64VFa^/ê5U.qp,ߢ,RK{Q"%t#Un<05wZr\׀9*̐tj2M8#odx{$JCjZ[{f):h+ kc< +sߴ;e -$w%08{H^ۋUѻXT?p0{j:ucG9E}=Ұ2EckwaAzI [ C_0L/Yc9@k,YC@&4;Q:cT9Bï;Gf̳d6- ۨdx%MG*5~G t쉓]% VQzP#-GYcKt>k#P-aPccJ?s&*d M;krW{5Z~ᅁÒSxTkϭ9*?ok|t#s\[:4x([C,:2d=/GQʵqpsI1(=.v>nZA鲶 WHgRI \yuƂ~(0+A]SVkݬ(C&9JIeuQ&5{ SBL9@'SG%ml ,X0=O#Jcho vUuOU45auZvYcl{ ף}/W.l-/i|pP 6cmO+iս۸Rm!hƞHf5ǟ<ଲpsI= :jڂn_,V%Aަ )~ECL5}wCy?K7=a"7}%`~Ii4)wH$4PjIBJRI&J$$doLlC]?KتwYeH .E$V2I$(VũUY}QSGʫ_Q!TIeL$I'LTI%II&H$$$I8 !JI$SD@TI$jBrԔ$ӳ~pyGG1-mG? -﫝d{p2 4W9l#K>l~_ɅOiUnYH#?7#.˧ţXOO[Iml5c7N_VeGCOd8#yUzrU79FB_֋fP@A=xcoVS31o^8 -nm߂_jGAY0?r?Xͤ XYM;}ym.]F+l>\F3ُY> .sۏL͚??NmߧFUtT8sXc1 Hh{X=w$ex[ܶŬǺk?Ff,\,V;4ZXe8BFS%1$}?,ej#_&:o/$ƩXw]?qg7r~$~ЧJ-hI()$Lt)I$I$JRI$hqNyEuHRdC UWh0aj4[OtE"ZPRJRɔL)$)Q)19i ԔIJO*?JUpC*:Uʙ4I$O&R$~,:IM)R$d)hM O)&)hMt&O:$<)!92DbM.P*oP(+TƒT‰)rRB'LTJrIS2J]:dHI I$&N%)$HI$I$I%)$LI$$I&I$I$LI$IJRtӦJJJRI$$$$I$dI:dI$I$):I$S$*RI$iK)I$E$AJI$$I)I$IIJI$I$)I$I$(RI$iN RI$$I I$LI)I$I$JRI$I&IJI$I$I$I%)$I$IJI$I$)I$t$$I$I)I$I$JRI$I$I%)$%)$Nd)I$dI%)$I$IJI$I$RI$CTc;)I$o^+1M7$w ]o^1Fm՝a'.Kq]|cůUnZxtbqAv3$[aQXEnK[XkPo XkORjkjN ;}dV15t?̡|h!ғ )[_k$k=XƀHW4/سj$Dc7iLWYa' p}K@Q[S7yjms,[P׹@suD\Y\8׷(eG! `/ī6kXt}F`#Sw1)]"7Z# ا"N3>JؗV u&sE\NnfciQOۚCƇD9G~5chѡKEyVq uO#9@wp0ʝ6UdsF-a.M4H't7%0GxU1sXu3m!"%Njk[Iu2Pu%엽Ol;.5t_Lqss uͮއN+kvO! < vtt*.}\JЧtʃ7tۼV5*-nZ=wU ʓl h ȵ^\vΫ7>T_& ~[;A2ʋ.1V]UM;(nf82q!V(Z'owDoX \|Ӵ#r\VBSr3o+wvLPޓ.۰RV'H@. p1Ϛo7)hNmsrb;n[@ y>)sŤ%m 8RFOrf-#U ^fLu v&#oNLXhc$P+CD]mzkX{"{YvVYXkOtlhvfkjbkekۘ JTT7>Ѥ(XX&4 =vAn;$@Unaq{컩_j\ ܩ' +i a2mi!Tg^ 0i9yp!I0!J6A*>>0>6L\KL<;D7Z!Oucp"O +S̖@:n;%颭]ƙ:SwLv@WUmGRsut&ej؟Ȯ⮥t\Z 0^2Z+KRIJ)ŠpR$SnE RJI$P4$I$;+Y-f WA._Cw ?9'!TرRDJ[. ;=ngc?f2ѵ%i =VN74CrXy6M=GEz.&X̩ @x8{lZ|s?Lh΋kN!G K%}d(1gfsC[4Rk"{~}4zw7څ_)]|1-3Kݒi.oVsTªi*Y9#S*c޺vupc?@ce7}ьq].%_:;րOLI'SY"1Nc Yǂ ~EX3o0֏9 5c ͻFyeëuQO5cɎďф$ĺI$:dRI$I$RI$ ' )I$ gPU-2lP=+ΞcWH1_j14eX)@4EnSjft+K0YqۛR}V?YqmF?SWÃjd%<&}?o EsOO/H s+h0pէ~Ai.<{ 6YXj~4coJ~ u.cb.U^r"3$uv0Dl%{ }/M+>2 kDki_a{Vr\9$d9GW4ט-(W4)I(XԒI$I$$I$I'I JRI$IIJI$I)I$IpI)I$I$JRI$=,vyXwI]$U3Xǽ?{Ep` "KuF]7P/vcY=*8|c >x%=b^?$,Ye=8-*FUx{~qۋY.?ܸMa*m ψ8bdde2X8WDۻo>'5kRh.0I)Ӌms?su{ V?B0$qL?{#$*Ocqk8rS42SN2t!I$I'I%)$LI$$I$I)I$tI%)$LI$$I$I)I$I$JRI$I$RI$JIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$II%)$NI$$INI$dRI% $RI$$I&O RI$I$I<:bI($I-*I$I$BI$I$I$NI&I$RI$$%)$I:I$$I$I)I$I$I$I$$II$I2tRI$'I%)$I$IJI$$I)I$I$%)$I$IJI$N:JRI$I$I$I"$I$I)I$I$JRI$d$$I'L$$LI$$I'LI$I$$IH$TI$I$$I'L%)$HN%)$I$IJI$tI2I$I&N' )I$B8UiVREH] Q@o))N'VjVԭ%,P!BrI'IK$I4')$Jt% $pTR$'L )tĤR&0RĦID*P$M)Q% @)(n)P%rhEf 啒%j=QdV(,zr~H ة>JM^JM%jwY܀{ LÌyt"gT=g*hJVw>#98W<>-o0BOO8+HǪ9d}qk/mToh {cV'ꇲ)Mo%PPc!9z䶝!W4JOh3GjBkꄑkK9yMrUPQk撩>)өܒ}`4AY(S෎ QJNooY3dX?d> )=!X:%jXRCqeZgTXe> Oe1A*mŸ$T#(x}wU|l{H2|NO JOaO:.4}a_"N๿o4U -{\xfSNv%b#^ZO&4=н8ENz[¤S߄_RJ1TfWPN Jsd&UGBmgzBDD⒛ޢ[ %8U(URoQ1(۴*#Gx-( N U6wK+#mU4:bGjt[ l-TB5f~^>VfЊsUSy?"L4tCu$ruA@7"U`jjIM  KD'tS%tH$$R1N&N)ILBIBpR%):A(NܒT)B! !M@(7TJ-RLTI J$. bSN'I2E2JRtI1I$$"dI$I%)$LHI&)$JRI$d1IJI$)&H'I$LJRI$I%䒔I$$RI$I2JRI$2I$'I$$*RI$dRI$$ RI$I&IJI$I$RI$$*RI$dBI$I2 RI$I$I$IRI$I$I$I%)$LI$$I$JRI$I$I$IRI$I%)$I$IJI$I$RI$I$I$I%)$I2I$$I$I)I$I$JRI$I$I$IRI$U1 U1I{mv9t9k骅kw3K3ߕ#VţZXJο.{Z5OÄ3d?Y k=ZV @n/$T:.53/s!Xc2][*qrOrۜEH<6|e3;!Y9" x#c95Ghkkom䥉u3~weB74p#iMưL!fUm=|Qq#SOuվ> t=nH*veց3Sh :)Q{c[kuWٶBn~fĈE//p%}'hmm|TX`7UvAtjЂjǝ<=WWy1yk5tyYX$aW3O8@sYSFǡĹX@xeټN:>)*># ȰvKA41~ LcY*m7]uZ4 4,] 5;sx"UTv]sZ cL١Q}ΨEtX4zI֍JV6E ֒ [¦ީ].q5&uwCdžPHc<BB #Uzj[l1_-= fh;7T^A=ncY %+154MgNޡTZj\FljBZvKRbO =4=NxRȂUrNUH{H5XOgjZ%0˃l/'IE9l20P[*êʁyِs&>)_d056ƊAˆEf@4 0U:2ͬ js%k>vrU䷋xޞk5 ?DGd: 3NG%3 A\7v<ӷK/Y4{Awu CC)EVvK`@ʲ̠N>T MZ߇:qw AHU\;Y$][JNhT1ĕՈ9F˚k  *YQHB^,<:pqa-`MKȝ+ &?67q"7G!Mڶ<*5 ͖ \|yJ֒x1:Lo4tTk DjgRC4=ԬTZU mmto -ln+KٱoLf@ vN5{kO3pauΈA<:|ia: jŸgX;I&Ϧ F#`uP}lc%6IvAݼ&>KOS4 iug֤8;nH!gI5cC'@ n5NwhCSIs=HYky sXK{t Oe|&;]oi) R}?H,ך Ek7u$+\|P?J,.!w:v8׉BZ$LP 4%֫dct$9;,bd&X@:G_i:}0 |_vĦp\{ul#hhԥǂf[!V%~紘 A?VmF|]շKqZt nƂ؄ 7ONc2@N!@*M~-5̃K xDž@kI"h2'itdSn/ ]r; #q,# y%Wf.,0}y~?"ۼݩ߯?"<~I\Ѧ`DNpMI%)4% O))t$')t&LO HJS#tg-b7_?R*_l]M!"ȤJI%(Vųr_V7Aqb?ʙ_ eETIe8'w5Zi$പSYz-U[W#_?^Rcr8NBC/ ˬFMQTԺ`, ܸnoڗ@y+  B_I2cq_MGJӱ1[?XG6.ED&>kUoN9i oLc%"˖DxGVDϋꖌށysg"b{0ߖ@880k¨:] nw9ādԶՋZZ[T$Ԕ:b$J@5@h IRI$ R*MIJL2w:}3ߊH@&"OW_I6V9M3p'/R=13ْ {@jOW赦Jԛs6 x8*o?/ծ+WR2p:}~_tLu diiǐ?Ig;<4ئrLr FBqOCYV{ :Áе1wzp7NEcW ,VQ鶞Cw4g%??~anV9s5k#WoOb󮛈쬚"Kr&=кx^GOX8NC l1ҧUoȷ+ᣛۛaxǡi? 3XG-.h'mog%iZk}^לEx?#"2RsZcsga£QHl]w{e|>LDzB/XF]\%o0a7 ^~?Y)ʫ }$J)$I$:dI$NI#cW]mO-Z}(i;qc|Y؍5< *w-*\d/# H@١AkV/R`Yc]n?W:~eZ4{OYt}[Ḏjwk4m櫐q8%/k4gN.&DEϤjVV!jҦAA5AQoN{s=sT z#ͧnո C8#V_7 1:\xyA89BI4hA.4Z 1ߜSE^ 2KSiǁ?IR\?*;/^=Ϛȡ߳uwIV!O pB_Z#?L|α0~?-`JI$6I$I$I$IRI$I$I&I%)$NIRI$pI)I$I$JRI$W:a/s{\cIK9SQcmga|Bt% zu6;Nѻßg8]զ w U aPxmMcjj7?|xnk}\7;oa076ވӇխ4gWga]RYUѨ 7z/_rMD׵dڕ5ޓ;>Yl~{ pEH^ Uh'ϾRc#1cgu5)oBqŬqYL"v8wkc02bJ>sS~mlHt]S#dq,s/?ISXș).#ڭ7;+dꙠ|ӤJI$I%)$I:d)I$bI$$I$I)I$tH$$I&N%)$I$IJI$I$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$II$I2IIJI$' I$)RI$IJI$I$RI$I$I$I%)$I$$$I<'L䔤I $IjI$I$I$IJI$N$I$I%)$I:d)I$I$JRI$$$$I$I)I$I$JRI$$IJI$I$RI$'I%)$I$IJI$$I)I$I'IJI$I$RI$NI$I$$I$HI$I$JRI$I$I$I$$I'H$I&I$RI$铦I*I$I$BI$$JRI$I$I$2tI$$$I$I)I$t铤$INS$$I )I$JPREH [ 9ILt:RRm$E(NSI$RɒI$I)t$O $It8I*LdM:JRbEH)JQ*9LS%1*$H)SPʛTA%{V+U9Zc*ʰHs22m4Y1X)(\Hj[DgTV7DV B 'JdtUlna8LMy(Lؒ" x7LiwY4!8Ӆ'9K,g_M JԪ"H[]t]/ D`yM8ub(V&A0Sn3=_PA$O_[ wcZ $O}ba4(<%Kq:aL*lRmM>Tk W))IЅfBPl~T-t+xG*ݘ{Qp~ **RzpZ["4<ُ}PZN׿WuEGl 1-~*Bh%"PJQ$4ģW QHQB$)l xVd<ʟС"H`ZfVUNU%gSA'.pqVf!.  6yẀ5J&KrJN=֮E`hV.cͫFO"!V g]5U{" 5UF]"gMGd8Py ً䯺78" Sή|uW(s2WQTp =%}JuVܹ`JŴgE†r(z["Tn㿚ǗrZ2Jt0)bNI ROΉ)dp4%h(nD"+P#P\TܠQRV(TJH]8L(TIIKL2b2J]$L:dI$d2JRI$L)I$I&I%)$I$$$I%))II$$I$$RI$I$I$$tI$BI$I2*RI$I&IJI$L2JRI$I$I&I"JRI$dIJI$I$BI$$JRI$dJI$I$I2I$I$I$$II$I$I%)$I$IJI$I2I)I$I$JRI$I$I$I$$I$I)I$I$$I$JRI$I$I$I$$I$I)I$I$JRI$IIJI$鏈L>!I/p-mqIrlWePڝO`,?uZ; T_-НAV\I龹wU\@}tU_[KXa/ͳ@9Ii \趽D>> {@WҹR?78N LH, P֒DD:ف(.LZ@K\," Lpdu &\\ښfy+\mkAŠ<'u|Q\8cک~S-K}JW*mYmdUZ|tݧ[Sǰ"U[1Dڴ}DIA/um6;tf4w 4i'q{GCi7770N)Qխꡯ?4fu3]5q>e,ܔ)}dѝ~)z2}3+>4*uee+M3+oxq܆a06ךN%㰉 !fu8ژ=ۜlV?5jG22!3cԭ tgUG~(0~MPqz'F=V|G(QtaciKS@$Ml!>nX#;}Ib@|eX. g5c?wXHV >aM1.!评 f ANCE O^#O~c1ÌCra϶g|Z=7>SA=Bf #5VZ|Coڻ,q!ђ?vsuǓI502],hR%&XНqo6W9H/IWH=WV0?ҫ9Ǻ"g=V mg]0Wg.J]+?/'Uc-u?x~ţӓE^ƹ][o>;?e~9PIT>{yCE{>] ;O%+ns^w{w,VqV}o38KGKQ&!î9w~jeXoGE^C_kI?T'Ig5II$I$LI'I2tI$RI%{z͸;7֍ z74Vp2 mo_h!ޞmcCH{r}762:U6|5żjӨ(hp+-=(c8?{}0v}Xz,+!Ϩxx?hp"4>-ZȖ# <3DAq1$6frءK~ʾ{Asr)t{G7s3ku`.r ~cN10YC5ZY5jY ?Gu:pHpCɯPŒC߁y߷BH{luݜƿOa/ 3b<ɤKtRI$H I%)$H'LJRI$2t%)$I2I$$I'L%)$I$IJI$IA $JRb%1̾ZWAh̰*Ѭ\4uG(&AMO&CUa5}VcG!-:|Wk'cO't-gl=ݠߵ;W `4shZ=ӭY辒?7yT|k77Oog)Mlh\?;E:CYObc1 1s*'lV,{=/z>}WOk?]9l8? 2+'M5%# CeQݨIY`VG܄IC4I$I:I$II$I$I%)$I:d)I$E$IJI$$I)I$I$JRI$xI$I2I% )I$I'LRRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$NI$$I$dI$IJI$I:I)I$I$IJI$I$RI$I$I$I%)$I RI%)$NI $E I$I$BI$I$I$I%)$I$IJI$N$I:I$I$d)I$I$I$t)I$tI%)$I$IJI$I$RI$I$I2I$$I'L%)$I$IJI$I)I$I$*RI$I$RI$I$I$NI&I$RI$$IRI$$$I&NIRI$$$I$tI2I$I'I$)I$dI%)$LI$$It:JRI$I%)$I$ )I$B %,TTw9G9ILt:RZRĔBr)Brt<$)$IRI$ %)$H' %,S'LR AEH$b1R)द%1R*$)SSP a%0rQ*]PRj a!J)b0VR\ӹ>ZBU Թ' WrQZ ѵZ72y쫚 ݴk(\'<)oRZkb6vDw V$͗ S ))svP<-[FUkO|T7Pcܧ~Ut*O%ۧ U3D!&=P> !& ='K%2ОLX8|ϊvFcT!Ue`t@Ulֆ駊4M!LPS;n"48ƎcwD`4X;vitXD4#TTn<]/LkkX]Mb<+Aモ_K\%%ZsKDkZ}5?[!Ql"8ߖ (JHxb<ׇx)zEFQB}g5V[ J$xVZLՊWGe1?[7p2`гjX$h;]FA\&FC!݊Ea-;] g  $׵ X9L%G:mկ%HBi'H賌v^$lvTm=LpW9Wphs2;{Xϥm϶hP$0ksKqJZO,7^J"&%׶9k%h\u?+>bkyvu+4hm g{UrK >}ä>YҙcݻIY/-pBPph T?l?qw_H罠Jzkm╮nu13ǵdpE}ñ;ls0Jg̈́ޠ3UnSN4z/Lqұ͐H5j-l 2A?5^8Oռ|[Y klL`;t\5K,oĪYCFM'4Bk[;a|CֵeSf,:n] hhn* D#,kH'2>*/up縓ky>- 몧H-pfⱄ(Q=LkM} VWKNF'alZn 48=Ƿd7 :7#@L(%lZH R/ieb$skUK\8ZL8%U[i`vq$  oSnUne^8Pȡߤq!ܩ}&Gjx(4x-LB pR.$K`} G(uVβ2_ i:q3QqI): !mipGd .| hYL{I'eNL)eVg {#7}0`v 5NCzD?asNr):9 #t%M׼~ێ֝>J/zWuv#UziNJ;3Em{4ٴvGuu~u:L{aRF%jMNAsO}ZiB}V:dBm 9@i hk)SdwUP.thxCٷ3Yn@/ qSn#Df7ݧm gRfbˁ׀5)cWi /pq.'M5UeB!Ù@oL{:wd*c`#LBXYF.xRe1: msl~A)ծ]9슴;.i\ִOB5>92X};_aKI\ׁH3.@w\mz?gVHgQ+ mvhc3y`BIƩRI&I$ $LIyIJI$NI)dI8D'[V4OMlUs;_2lFp"I+K$K(VſSwXQ'ʫ_Qt_UL2@mzI%NY]2?Z{G1U*Pwkh+$8xMTXANUhn'ih^*A~7~ӬVD`ڱ:_댻uXOmFShmngv?_ṵ,X_ZCh:GkqjƛuFmG*Ϥ|d}oWzu%: XC$W B9-{߾ሡm<4T)&YmD$I$JRI$IIJI$I%)$I$RI$ 12so4OUF[<3 Go뷰' [iFUi8܃v%tRkpޝe'&\,#F!_ !:~[Ƨiskuz.,|~<8|eQ#(H_J..rc/z^E<nfECgr9{Hs U\.:];SoOÏݘ4!9Sc:ԣ_ExXf@6;ްV\uރ~z"ctW̒v MCW"dp*,H,bcPFgH6F%U{vT?ѷFЪopGW>-qsݩ'g88'2&N=~X9Km#+-kvڛ9qE[حZhR @'I$%$I$tI$$$I$I)I$I$JRI$t$$I'LI$t)I$I$I'H))I$d2I)I$I$JRI$I$I$I$$IJI$I$I$$I$I)I$I$JRI$tRI$'I%)$I$$$I'L%)$JRN%)$I$IJI$I$RI$$IJI$$2JRI$&rIJRI$I$I$I$JRI$I$I'LI)I$I$JRI$I'IJI$'LHRI$tJI$NI$$RI$$JRI$I$I$I$$I$I)I$II$I$$I$A%)$NI$$I$I)I$I'EJI$$2JRI$tRI$$JRI$$I*I$$tI$IJI$'I$I$NI&I$RI$'IJI$$I)I$dNI$2tI2I$I$&NRI$z^fR2r\QAg))N'VjVU*V%,PP܈0NX$I$dI:t$$JI$%,:dNRBxLTID)Ħ)b JbTJQ!L )D*%H)ALQ!MD04()$5ZUZeRS s^5i̐FrkUv(%eZB0G͞8Zy:XKjJ{xw1䏍B"np rNlkⵘ'EM.1]&1yVUlq`&{KFekZH.{;AQrGrR )*$+FHT)ZTJRqCsBF6 tT1ZF~*Mh8r*m 6&+^j~Z)OEԁR%DMiGoMSY]kYaq$2{tX+<, x:!f68_yPI%_li).1 klh#m`ns 쭒TEÉ>HFJQ)!+xtL%ZgxUXUo',-">]qhhמ')'V8$VvIZEOu<PH.oa(h. |A \sUOy [e䪆ȱy$ÄM[X5Jp;0Hv&rHVsJpIdo3'D굱'UHkbRLT\tWLk5p5Ar0> g 3QD 8FWN+TXxUނqѡgGt!G!Pޭ4AUaĨN!p0$Ҥ ('JE ((L(T$A:d铄ǀI*I$8I %)4)A8 $(D(oF xU`*&vǷ;ki2 4"W)ͩK!Hf_{M<Y>JYKw9 #!H!N\4BXuUre̐aBTM[ܸN%x2dSŀXkӫJ ;_3g=P !Տaa,fZ} $ꆞk&ٸK8Pz\">0M1~b0ѻqAWHfn@Vl#T: hU\HUjpc[cGji:!ʯ\C*@Vz(I~nOleL4q/6P(s. mT`y>@qY.H0m|#j+ 5'f;ҫ,0`hcqFAt=_a5ĘkD (ʬ $i>) Ax.a1F\<(sILjM1Ý6̭%D{,2Oj4a5Y&g*Lqpq3is zF\{SM! UV2WɬXSk9ڈӏ꫖YPT9 XkY'HV ϻN"c֙ Jñ )]DxO{oh,'uhgn+I $J׋wnU,pᢰiit<#cѪ UU@F /ipَCa|$,쉑`x5ㄑvA ŷ֨X?8wMU[N -5o%4ȳO`}7#5~1k\Ò0n*EeHq-q77l Ug;R%I Qm{%*BYn${Hu`uLlYq] F4 Ki asNۈLB V]% SбlP{YhM 56>4{9%OU<ݮ'.@o*+/>i,!+)}E89U} 7yӸ @hݲӧfA{Z>*TRjԟ K#HZ:jh#av04Pm,h׉#Zl QĄĩۚ tQ}Py $v*f0C _ֲkdIp @i PV= ">ZqͮFC\ 4\QD3.)Un˒RwC?mnonTZ:;_{K| J9XpRdL'I%)$҄? RLhO %JI$>7ձAOo[\k/̲[)!"ȤJI$(Vſ]VAqb~y?u2ҋd.]K_\ncqk`|lX۫>敯ױCsL~J"2+&!_ힸhsr݅O,;_Š fEn-p1.u56F\B'RmNVt'#:V8aPd}俞9z׶'RtrRj7`$$ƺI$IxRI2q+fE!g)@uY&:+P!JQa8.rBS Jԍu[=?*Z跇}63I +71w'a+l pDcg೺ʬ4#V;]|KB[r/CacaՎ-gi#}?6}\k'[>-S6?W!8i68x|+"捷WWՄPCr6=9Z+;Vb瀷-;"1^3x'XВu+*%{#9d{I>j;(|mQQۚ].z='װh2 xZ鹭fC8prI%k"/qMB\?̭4DjNͤA%!$H!2II$$I$A%)$N:dI8ضIca]Vmnp,?sՌ8=g#xq)6>EsG*I7V;7-"smoYt0(qJ9@fS@vZS#6d5}w-u}C{ %l}{Y+'[=>J&.Me3Q>8-r֏_b32wwV04GV;h7)6GJ.~]k@2Q1\=Y DxF4ku4JXպ4?uRr sߥz63jJU81u a4@ @@WnX(f2f;QURI$2I$IgXg% I&&I $I%\$&NԞeI.=,gl̐CGbn+ 43Kv3k4+!qYG5Pq.u@'וf<=PRpuzM¸ۿ4Tު}ߧ2+Sc1zN&nm7rq,LW`>; :z9??gh, vk?=T:@с㹭@8yN.}3Yjj~^M^\GZ+ůG-IF dK!D|{%sNv=WpFnG_vU[l;X$lT>X+vM8kgs?J燧d8ඬ+~E/qT̴if} lx1ŠbmaG+hkt5U6o9:IJ)ŵŤVLID; U$cI$I$I$RI$NI&I$RI$I:JRI$$$IJRI$dIJI$H$JRI$$:JRI$$$II$I$I$$I$I)I$I&NI$I$$I$I)I$I$JRI$tRI$$JRI$t$$II$I$I%)$I$IJI$I$)I$dNI$I$$I&<'LBI$4II$I$RI$I$I$I$)$I$IJI$N$I$I%)$I:IRI$$I$t)I$I'IJI$I$RI$I$I$I%)$I$I)I$I$JRI$I$I'I$RI$N)$I:d)I$IIJI$I$RI$I$I:I$I$I$$I$I)I$I$JRI$NI)I$dI'I$RI$$JRI$I$II$I"$RI$JRI$RZU)bTU{( G)N'VjW+TW+IK'"')铤)$I$JRI$tRI$ RɓN' )It8RQR )e"TQ A%,TJr mP A%10TʉR @p$N5 $ ;\PiR$9*ڂ(=AJY{gFPGpC!7ЫHYx |jH)$|ʃ vKwޒRQ%.L2؟%TU;h椤+BxfB#XPNuS%7ݒaQ~6@BsʉNeC"7@"tIIG m cU*W) Hcq3{-{8eςBH0cR x[/KxY2R캏O2moyk ^ڗDX3H M,wcL /Js9ஜPtꅤv>f}cr!=L,vKqFj#Eϵlh M+ݩ[e+q Շh$<-*DՎCùUvKJX=SmUHc| u"!ecptA-@u>*#FZe2KIt NI3qƺks ,˷gBNBǍI;+G5cE{n.hocL;H~ ⾔3*5ad㎧X.ޤDQsCYMvA.ozfzzYK!ݐ6m-hHNէMRD!kրӠA9举 : dUvV=#Y%a C9+l °) ӳ_!k2X̱.EwDZ}ҳi tk3 kb}IE*77W%QvnSZ.Wuq ܡ9 pJim`(.-F14xSBUIGSS.Iq<%[ifdYPdNl?jhF05:8.P;qBǫU/ic&?Jzò˚ƖrnCIښOPxt`\5u0PiI*8W9?ZnVeVRFWfV{$A JM.l-:WQe:%]eDjSoUfI ƞ6亨{ !X.q';e ٻ^+UvswD2U{3\ֲD. ׽ŵcC*%`>`k6+Pbx,:'qG^;Ì'Ƿ:M:X [˿Ypw*sjsv۴J5V̛֎zuqyB`EXmnƿ谸|oP}6{eTu\| #`rگh@%g7up9 7-^,}ZHѥWfE9,l8"B}$Ӳw^rNWMnjL6#i>)h͍62懱 5I BaNsXWQw7t/|5Byl#.t WK^}9yIOfuLПwW[Hs9qJ3(mؕZΗ0>*ۺ.*,X=Hp@СY=jא$'}շW*C[.`ᡄ϶k`#YU*}mm J2{\ECkOksyQP14 ε"; iq{x;c -FVXh 7N*V8<}!9:|zXaB ¯}v>.# t-.nMSe{u_H>10cMl>Jv?Hvg&aNlyVmm/ Tdˉ G U|AJmfƽ $/F.seW6H!I|7!&صtM_%D9!0NLJeuzB'Eu]~%AtO[?"WGm}TMG/1hխ*S{zGYn |>͒#(,hpqhyo">ڝ|RizyE5٠C'yf]{\_Ц:ǵIbDd-(PQRJ"bP?HX1WUG#uv5s1d9wfkE+GwO XVI\KNמ55I0Zd:4>7(kOjNCmu2uXӎK!i|{ݗŏ(zP}~4so'15dM8HQ&f8 2I$;m 6<@$a$$I2tI'IJI$I$%)$Nז0B.i7^3 (܅$ceY-;b8f'~%ًέp\WN!ح|<<'694H,inr> ?]Ny*]{u}~hWӁqng-\ax΍tK>E73 .͵(`82 |!!"`Z?z׍gZ ?Nw[s[ x?&NC15UĞhSՋA@<- 71 !%!rz Q? 1,96~ 6ŔI!p>wC:|36?}im,f| \/.ná2p.6[y9H@#y)~D{L._A7(fcW~N?= YǟɮNKoݰ}\ vܧ~@\Fs+J>TQR;\ؓ`),8ҐJjOG%7?T|JXa; hYRP9̓B>ENI?,UwSBAD I*l+I+m"Q)vkxs=NOԊvR' +?m ?E>T+xKӭQkYni0/Kw]9_YuXwi8kRsCPWVجm Ci`k{]sQNǙJ9;EP[~ ּ<1Ս#+Ks_s5 epo}ٷlg 5WT4~X}tAvMص0k~| Io\Y+22nj}wb~\f :_c+xfG>䵃nG_ޟhx/SCOP6rYhY;?]=,[D7@V|*e9~g'GjnKE]Y?I ZXXk-sC]٣FXqݐ?#qW_v\|KEM{9sϾݿ^~X h:ŏgfu ]78p]%Lя=0c̴c`n!I$I% $I'L%)$I2tRI$$JRI$I'IJI$'I:JRI$$IJI$$I)I$t$I'LI)I$I'I2I$I$I$$I$I)I$I&NI$I$$INJRI$I$I$I$$I$I)I$tI%)$I$IJI$I$RI$I$I%$$$I'$$I$dI:gpEJI$I$I$I$)$I$AJI$I$RI$I$I$$I&I$RI$I$I:I$TI$I$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I)I$tEJI$'L%)$I2t)I$I'I*I$$tI$I$$I$IJI$I$BI$I$I $RI$I$I:I$I&I$RI$I$I:I$I$S'LI$&NRI%beVgJX^rr9ILt:RNq$JӦNRɓI$I*I$I$RI$`%,E$NRR AD)TJN' )bTRH( )xNSuIDF" ;9ȁH(!IBB P:΋'%ۜ|cEceL>$0Iĭflh= %a`wL- 뮗 wZ,: UaV[i\s$hnuZ 16N@)u- xWeFjD"QCe#\?چDoD("JJHӮ"4<@D)dPjr8NH29D!L0Ja$ҒR"yO0JP)BtbJS*%$m&v:#RR;k *ՏVkapMʎ`%sTi M_8(2/q{7( 糖 ,gHMJEN)N%Vabt\ei R]nn~ qL,1f'N $B[H `R,pGٹZB"4Cmh^L`}=5Qi^ Ro@*;eȡQG!Ҧ*N4VV#&9.沚r#s6TO*/UQ^Z44 GUWC*n(e9XGhLcrHRp%3P!$3iDPڈ*2T2JfptTRI":`$)8LIXNJiH9$F*J0 T\uI $eEIDI$dbI$&I I)R:u))I$pD)n;&IJI(IDo 2J]2I$JI&IJNI&NJRI$RRI$$$u):JSN3O1N2$$HI$IIJI$L2JRI$I$I$:dI$I%)$Lt)I$I$$)$I$I*I$'I2JRI$I$I&I$RI$I$I2I$I$I$$I&NJRI$$IJI$I$RI$I$I$LI$I$$I$I)I$I$JRI$I$I$I$$IN%)$I$IJI$I$RI$cTC;)I${忝 z]R~k \5\#EkbuluvϯWEp 'o(SPi$r(ywHk!;mm`P}rdheI͢}Цs ^BU΍C }ہcݵYvA,}!O(Eze3=3րJ 1aXpaUN7S6=\ =ׂրRll4 %")4w ڄTǻs*ŏ% ;Oh'E7C:KxU*ӬwJ=k0 cY@Ub֋+-"|WTfcif)h p0c#Iֺ\Cw wDҀ;Բ ]?j얖>Th.i!ړH8D F꽹xCA .nCZt8p>-:|VU$I2ح] k&:_zhel>kxGcKk.0 _iP;qەKA<3xHQUl=F:[̢>}W{͖~ .dSyW9ymprU4.Q\Aqi#]l hDl. vEDZ;U| ?J<sLQ4f۵cR/h*s[]?5qHiLc>IpkZGP~V9w*XqQ`!)60KLfxE`h#rp$ILop}gݢw3C.kYtƒKZu:yTk}wB6 k*sƒ,&#۬/lVsw˙30Bg$nG'W}@thR Q]4CunlpG3Is@hw<eѷ}YCB:$ȑ:jK;rY[x|iĝAITni2)¦mpFq[CZiGſFu:"ߕ^i6HwEn=+K@sAڍ6i!CGl9aUl{`\H*NKCNµ{ZnYۤ*Qq|;dkZlnt=ԉt>՝[d=8W(q5kB:-!ec$M4:ܴlX U.nw ^=-vUp5@{(5΋ J:#Mk\솝wSvߜ4*=Ic)kqxy}'hvK]j !{΁5pFU:)uN'ı< m'HzEi y{Ϧ[4:(KD w mF9$44X1S]W) ?5I}'5 `DJZ {4U< _ݮ࠼>!_sZB|״> 3h{lpo:f:qVDv;Zr+>-s_s%I?, H?ò6 =-EVF[ZHk*r2`sqW(β>x~RΆR{wmΪUa'ݸhe-hV}6YXCSWʆ GYuiPPw &N Em$X~QQ SE2QAj*qXV~.A]~N `2GO7_u* A}ʿLcεoܴknIq/y9QY|֖O8?R9?"M7P{v Dn:y%,&\3g`՚9CūW/&P2?F?%tO~8(i$#ƤI.RI$I\?ufS_2<FxMGBS<2/g04?k Yl655k*xl7{)K]o#Vkk^8Щe#V9ycH0B1<_GoOm ӣ̹aMϦa'GxO*Ο}nf{jm"} X"^A48s\9{xv:-'2-my4S\80״5Y2*zelȬO02{\ev+%ګh:8vܩr}w].&Aէ2,[x?wsCBϼl!w-? yίnw7z}Lc&ߛFZFMgP j5l?JܡY8ҙe[I ?0e@a[sv*zkwT[ >^J#85˔}]oCYE:5c3qĬu%0XDr{cTGviwa_c.ph`ז뵣XեrgW pKFwA bcGc#88'Tkd?[?D~pSJZ3.wi;Gb|MkMwͯjZ $TWI$NI%)$I$IJI$# ;$${I]T:J1˶dl촏աhߍfZ+h{|9>z>'_Uc|<c4Dkn?(lJk Z64r<^Bղ:S>SeuBݹo?qStgC)[{2z5$~{ b2_\?N3r#Ъv6OhaJkqIA;G-n[i^4Gۅc: TnmY~9gp"jd%f(x{Gne.Gj?<1ֆg9PGNkhZ .oTg$v6.io5|:ƓO %0̜?#^H$WJkY9Ǹ7O/BcHЎt8&@kSM/6Ud273X,uT8ZBM0Mȧh[Î\P2LL.Dnn=s8w>cܦn# Cy- wg4df}kqhmZhpйREFH|26H?*ik`E'-;K=64qK-ŹՒ=KQs7\*Wŭ?y!~q\/;u 1-k_c9+#?>o!'MҰc*hэ1I {]tI:dIJI$E{2oѳ 2$AZ}gה|[?'E`-!*Z{.x?^5Ta%>'ɟW6F? tfN@{͞לY~X >'x9RHPn c1}֏b5R?h;s{LւOC][UzT&ϣz`w!ab_S}+4Ƚ#F.RfIkOvE<#3LO+K$/n[J@ C^s:&)ʊ(m4k m*  Q)rRS0>FpRQIL!M* )*%9C}WJ#DkYTHX=G;$je}>@URUJ&<[|MRMJIY) !1Vj3WƪU@6TrW:,̳+h\Ҝn.NO* )8'"PJV[`;+ PpC!L$0 GdV:(^{&DHAȄ9%2VSjL(70yMCTb2t3)Rɔe$JX)2T|RvDbDj *J%TJH] J%1 ʉILL2d2J]$M`~JS*'$.d%!)"I&LS)I$I&I%)$HI%):I&))I$II%)$Lt)I'I RLI)Na0) N#Ʃ䐺ILIR$t$I$:I)I$dI%)$I$RI$$JRI$IIJI$I$RI$LHRI$I$I$:dI$I%)$LI$$I$I)I$dI%)$I$IJI$L$I$'IJI$LI)I$I$JRI$I$I$I$$I$I)I$I$%)$I$RI$I$I$I%)$IJ>!EJ>!I/mȷҽ~Eo1$<%,|Ft%xD{q]|tqkd0.px9V{C`H7Xȹ8yBeLֱ FKdS :^o`DsG!5C"?Is2kq܂@6pJ6ai#R+#ڤ+@;֪ąR\ $]`2yWj1i(pLb5:NKerח'E  wHc% GX~7y*^DŽ(v\@zA3np'ƽ6ÁQHA{.lsL8"m;cXđ #Y{[sl{Zw4+M5׹FXX4Hټ9\T\XHZΨIv†uD;]N-߸NJMuA-y]ikx bN#;fExG8x3A8)Ui0։=~Cl'`ljFGM8ΞiX|xU1s}0anyOmvVIkAEe-Cȶulk!-{HC.4pRI .G{y!;)k=̫ٴC;Np9{OWCI M _X$Vck$?z$ P=IۇRx h2uAiED4$QlH:[ƍdl]k]59Ԃk`wpG dNos"A '%X\b@1a,w"}11d4IAwC{I#R-# hJԱmBT:?m̸ɍ?My$AEoRCZ|tI3`:#:)Ŝy(>d%Gl+Y^Apc.'AnCswebPpzIZ"ɾjc) Z@*4^uhIͭ QîO*ns .q%E;$;*(psh|K@`5 L92UIa>^ ;Bjl2@IiUM. L w7pDnNUj\4KGR S{Q5RM#*pU Bw S.:RO $~Hh2c[d)s2`jr])ِjPmmk7XsZ>~[=a7BT e=p<s[)IXxHZ[tVNéP;}Õ۵`ɕd͒@wuW@>Oϭwa斨!{qc8Ɛ! A-  CpGuu i ׏RPkxv짎\;Tұ{Z#cOixUHC^I-{*+ - 8P.;*3Q099trfp5iu"5)c]`u`2y 8:;=lfM>w`=ݮ4>)f;=G~o`\̠*si{#=_vUX[RfX0PQ I tW \۹;֨SngXm'[Snp [Oˀl0S76F$rk _mzTkӺeyhqg5r@9zhq2H#h\QQ?g]/sٴs~?"G<~L\&tV\ B B% }I$ J2R <')QN)&?MlM _]t[V[?u-+8AFg I$6I$(V}cF=WO޹ރ(V}``Ukmv5\HTIC#wVWae*'zw1C767"5#b؇3CA_]cF5rv2Xˈn6Ù;N?R}{o}- Qj [iT3Ǵ)%BW.bW./cN~[XxT>ێ*&U;h~~K;Zg-~xvp5ֿkDZX 6H#!X%xk@Y|MGO[6h2~ /ph䮋, ja~^C2d vˮ c=0}Jy7b{`d $_k3{ |K~wr:Mk:a\ dx\nR XACq2)uc?3¶11]Z]NZ5G+7r74.mo%g̪@uc=?ѯ?Ϸմ4/|%1K?YlŲ69qmxzl2^Z'.ie22ILfze A#RmǘkA$c0k뙮-Mm>mg+nEnH4iPqتO.R7` Duw0i}+°# +)x汋1.T۽>~je (:IBI$I$I$$I&I$I$ya&Vn= w)@=/Һ"RI&[XlOXȬG:-pQ${Z_CC#ʦ--?"V[X@u9]F*[^GPd6TșQ7u@[\">j+]fYW[quRXG;|}Em> w;Ǧc7U>0?+Ie4S3츬t->+_q}4cteg&Yk,ɫ1BS; lyk~F#2U/ދRk2I$VqKOѸo+Ue:Z~lvh5S㉎Nc|$EK?.kQS':bYe'misO]^dݐ㧰 >?j^vY^>e`sRnh-o[r[O9+lѣ6oޫg5Ytfm W+fF_'s(?heψ::ne#7ڲz>䵤JYX:+s M-M~ EfKXI=#/WQooGNY}^1qۑ鲈0?|7lW8Ui ~9f\{X8hVVҲK=G3eUl`cA8?T2qN_ח[ ЎK̻j話ۀ0D)I%I$I$I$2I)I$tyc LIRg-n]nm:21ُWA!nYsrv{]X??|YY'VOeD?kb]jϞͮ`xe?F"-@S7?EVֳ?rHDo&8]2uW3 [5{[G>?鿲濶[h57ԲߡǠzuKXX^$bodCo(E >KiZU,ù_֭&I2J I$I%)$I$IJI$N$I$I)I$IIJI$I$RI$I$I$I%)$I$IJI$N%)$NI$$I$I)I$I$JRI$tRI$I$I$I)I$I' %I$\RJRI$JI$$IBI$TI$&)!I$I$$I$I)I$I$ RI$$JRI$I$I$I$$I$I)I$I$JRI$t$$II$I$IJI$N$I:I$I$I$$I$I)I$I$JRI$I$I'I$RI$$)RI$:d)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I$I%)$NII$$$I'L%)$I:d)I$bI$$I' pI+%VY#DQR** ufnRq$JH$II$I$I%)$N JRd1I:I$I1R AD)Q*ED%S1NBILT QwREHjHQc@C~gpBJ`*$U< O5g,tDԏ>|NHak{c~Q/Bd /<@RS_-ᵒ5^ Oi]S.}́ |*fHh&O+/ kּ>]^DhxAz1Az%fWl^M)@O0j#`sEFS9 \uu4\J+I&>Y[`T= gXq:$.\<+I)(P+ Iw*&iHESr E¥ے: E3]%g YO`h0GcZ@VOڜ9wג=7|M))M$ssOxUs%$UMrV|YY xo^e )pz·ǂ8]oHtIbygE$&GKSe 8͉<[I`}KrdU_~/;=&|R: -`Q!pXqS{@hV*jLiYc#YziS4(H%(H(SjԨ74B"JQO JR)uJ!? $U)I2}SRIJD1)OFp )p&V = 9 SPjLTJrӦNTJQ:'L:II&)ErL⒗H&NxI$!tI$$JRI$2JRI$nSI$&N%)$LI$$II$PI$dRI$IJzdD4|Sn>Z"KK.p]8=Vj2`}AFHrdzó --q&;Bzpx֖{\ֺO#s$*F}M#]Hq\ʃ_.WSDF29BXKzU|۫ͬlZ/ k"Q,@v8H096|($6%Su) să;5.9D /sݫ`KniJxmU>䪗IH(9jiL{|1#gq<-7bch˞ӴʟPh|kl>51%ޛ]Ɗ=8PF!>灷4cT$vK)[Kr^]en w*vmD6Pk/KE0eySX=Q2.1:)X7Dv)q}0[acOm0\DhTV}ʋT?zmq[eVc_ɝ8NޤBU{ slCAƹΒb5W^^j}fj~ikw9:B#CpHyak)MFVG9Э ׄ3xǯ{"jhI>h YU ?HTT9V{` JRNc %Wv(۞uaY I=ј.nʆ9CYhKE5LI@eO(sVlkje:L*x ;4&m=v] A*Xt<#`MK0N{qظMWk-r+{%Lur[ j(jEW5H .`= v\/(.d뮐vSky2 $pSmGU;+ZnzvCF±nH51ʯEnm@& =dk4(=!uWmA ɤmS}< 8W[`\DGtGFN-``s(UU]lkksN32Z%l\&)0A]9 y`{%.wYjZѪS<.K?1n<*wQ\v\uѸL~TZk|wˢDVI-sbᗂ}:TH'C⸛szCOAZ_n[qHeek-2CV]ñ|i&F ^lZ_ӾۖYm.c[ _P)fҥc8w4cͯ2 @Vwn7 cy5Hs|T芫paw#B[A0y%[Thl*޵v?Q mL}FX FיAV2i :A(5?Qkɬ䳈Mo^#NQO@1vQKn=u#k*j⛿HPI wTjub=ܣ%iDCܫl8VpcAq{ijG+-4-<.33=:W!]F~EkG<~`$!Õiʥvzk+nM)@Y$NE: Y2dJI$NyN$I$?71$@Էp[=Gz\I$1I$(V}dl,~UG>.ʫPc/(ʒ:lvTw} oSnH.q9.J@> 0?!g|H[.vV;9=va9h# *>z#M^N#sOO-ť܂[9[d nF9z۬pAֆ1,?dͳvW<Y9ans{ͱi׈ ;>_cFk܄nf(%S ܢ:V$I?wܺNoٿ0?yZQ$F!79C/g;G_8O[qϦ1!D0@hn3/?MյN}4vrD" :i:$dtRI$Ф2tA)$ZY^$v[5)2ǒaYͳӢ#ӗ8!ؖ uo5(uW=z,-p#FM=E{x,`z?O܆L$p˥^(«ES^:}c(Ͱ=pEHCޕ]EZ0m O܁Լp*ZˌK?f!U>/Ť[ hL~ᩙBC;=ߏ#nt4Nz{N/kC4X1ZUtQ As^ ӎ+h{`b.֚湐'mgtviW5v=d9ppkWEn;i&oįC.;ڷ:XƨHbR^ۼwC^8Cp~ \zuqv\14cOԧE49vbVլ[-pfKIqW[x`.iq77k oVCG/UAAw/.w]U۷^?o>n:vn=S@@4?Lg}vzdT(Xz-Ѩ12Q-SB$j^S_'{g?YVths}{e*>PsEV=8ۓl@M_%fmξߤǀa0=?sJRq5z3ܵX>S3#uKZ?n!Ec[8;h)$k$NI$I)I$I$JRI$?kT&)Gv98K]Om^wcY'!i_魣.|ZNB8}8t8bnNsH#'s{YC;:&M b`ya5;.p+um >S8LöKwk 81[Ѝ@ˮߡwQb١d*e}h\?ɨԬ/k#k?> E.g˚.%.{|*qx jռ+z{mKu忼Db4DFj+uV}0#5˚UY^@ v3нۨ58փVv(s >گ,6gW#JNf=qE.Cgj&Op.f-99x ;lUjHdcĈ#ݹXmOcm#ܲpgZ|ysSW e'W޷+ۙOۡ\Yޮ3H![~[=+?Կ|i#7&1_[ zUY<C-}WwǿVS?T}V^qiþU7[*}-u-'z4dU9]q s<u[~3uDy*e6fCcs_Iv>#U Yh.s|Um}AkxM6h50Lcؑ xe_Y*X CZlsL.rk4\9,0t!%eӿ|' Nߣ/Y8i*'-5m_}kt CGD\4oM `c;'jUƘ- Z_kZ=ki1aFE|M7d? Su6̧e`qgef7]cJ}!?xNV']7[m~s+߲KD@>z~zdޟ7y/~?Of{! mZŠXXiMk='5Gd ם{Śާczq;hlh?\X=jZ8,tY\@hcwUu^_Nb0Kqڹ<5WR?ҟYcj-eg~q[?:ni~WO#H#ݞRn#[F $I&Υu(e"9ORI$I)$I$RI$$JI$WzKlɬwݽ:135J'@ Ym.мm?1Uv%I%:>`?79sP\+pχ^( hfMn,x-#Ȫ;Mn5GsfyW-Z k=^x]OE>U 5s/!pW]cjDzwwk}z!yY ßˬsjo;\K *U׻!wg{>.gXmM>_k? R_̀NƩY~oG]Te9?A!25NN]Ͱ4apnOiUNcHI&I$RI$JRI$TS$I'LJRI$d$$IO RI$I$I$I%)$I$IJI$N:JRI$I$RRI$I$I$R 'I2IBtI2tIJI$I$%)$HI%)$N*RI$&N)$I$IJI$L*RI$tj^MύVnk=½~ilǀJ~bcqC)y@H/ dt*o%>#Oh!eclԭz¼-`;Dzn,0thA(Ji.En)*i :47d#EיR}>O =:{+ ~IOfB맔@A.v>3dI_<7O KNMd0 "hT8tZ.p&Twh9%ۇyZKA 5Yx >{݌F@PuDk[HQ%I%jTSN8Q)rBJ]$IQ!DBBp$&rt))d$Mt)I$dKI$ҒI)I$$R$I))I$hI$RI$$H]$I2I"$I$dIIP(I(*!I$I2JRI$I$I&I$RI$I$I$$I$E$I$$$I$I)I$I$JRI$dRI$I$I2I$I$I$$IN%)$I$IJI$I$RI$$JRI$I$I$I$$I$I)I$I$JRI$IIJI$I$I:dIJI$I$RI$I$I%**RI$4֝Г,,2.g@{ӯrT1v1j%?v5ƩEZ!_ԱpkkyuP^v\u'zԨU[`jpKhh v IG:tuLGI;h!=!ܩ32aFʉ`|IO{ t?ih*gqӰY5 c!wt[ȉG8 9J܍Q :ѹUml;k5:}D1A=HNCtg dp0Z<ӟ;։V!+=eAz$]w?#o':Y{phS۝Ho^;VėR2wvDy+@P[]s ;*!QHiHuV6 2LL\dm̠c$hv+\JC<)ꝎA> k"R.*]c,B cu,fW[=f1*[sزkd@&MfֵwR-jɤS!vE2i,x4* {zk:dHk`Yol+H!Ep5@hkl5CXֹ"퓏"2ZuCVttEc9D9yԱpt4r(koi\=2 tF]ߴ䚜3 kv6],KBoT\ة<$$;u'vQ->ԕX~}WS+ h"̑De"!+̀Ty@*s6Gp]mkZ~5`㈍Q\hu`56Qs:@[5>ԡG(ZA6-80L%Χ[׮h4#6XX> |q܏4VC :$VKt&~m>.܍tJ 5YC{rap. 8Y$4`y1KE^Q,`&O!hx#V%."F˝Z dX}n K!5,hmaDfaW09N઺X:Unit Ր\S7%'6 P5p9Geo]Qhps;ϼd]sZ%N ^[Vk墻@k pQMɚTIpk"*l:tOXiAyStU~"UD Ʌ`4w#EIc#4Y;|챢IugBw>2U9")ϺNJǦ_)}[TiKl-Ӻ4YL%=h4hVu9_ Kj\wOw:xsm- P2 ED%qi ִ# BAtduUzXV,4Y9 >-t $*wbn?"lZ #~Eg̏y?_7t[A>(faQ3-:` RҒIBA:A%/)&NrKRIBt8dDR$R*_lR=D #BI%iI$(V}c1Բ]W7_غ?Ok*?C辪IG~u W,:rytً؍ gq/jWTU~_$lݏ`*f]sw=] :njKm=CV Gl|VS}7 $vʮr=:96lr↿4}2no-G {nfCPKLD"Qe#?ܥcCUnYK~6ȁ)a+ n9eq]੢d8O(|HZM#k@RI$JQRI$)A0$J˰\-F[2 G,C=ըǛOF.-)$M!m1i|,7Pg{WaaRŚ|d=?X(2MĎR]nKIʇS?JRZTv+= k\j3٦~Jt8j kCK;> ?e0}j=ó;%U3sU>c xn@:U{UAtcY!Oee-ʠcQ׮X}͍?nnfޓm1mm?;Ou.I]Y@q-ssm=?7<ӹ\r]s _~b -5.z۟mY<5ZVS}9Yk>r~fAmguYl>@k5 nXh$|2:ۭV14 ةtѵ'1u7v<ݿOfkf[4hg ֌C@R7;=_ +?Aotvy{2xO-prq#c6[8_/37֫`N0S>P U6wh-OdN_.X%I$ I5n0o(!ʢbI5,5l$H-av2G< Ӫ$I$IRI$h5C?. YkuVx\²HƻmY ַ}VyiO|.)Qz#NU,>[Oq^uTy#%vhs s 8CGRs5FcR]I5>ś-~5]lgiu!CE Vbe'];7n۵`Sl:6[>LڙE0 yԷobԭI b%ƪ]!Fj ;ڵ^UvmWVB} j8~JfA 'ŭo{d0DjF=:=ߺU~dXQՠnN}ԠUcW Qx׉e~uv]βVFVmulX7mԏt뢽A#V+4t[C|ZtO*=P՟jh ow~MBƒ#џ.ǣKl>0 csu#Y=V-K5񟘭t|q}eVNgMc>`;4-_1U1azv;&܋{O$q~Y^-w4e\'C>e!i?y߾ɱOc-5`〨d~rǢcXGW:[~r<7H?VIbe5\^\3+ohpT.Ñ Hqݎj|DEq9̩izK's$ZCa vk?/ޗ&L߶XW]A'|?E $ JHVIRJIgcEmъY/.ih`OҘW꿼< 7 &ycc&r{MeNvlgw 7?sˋVśǠ];Αzkthܧm]^\\f NɆqr˨?&1{l:pL; .:>T,ip øٱ@|I>"+ +Ǻ5Ŏ@~eG\%-ÉX}ǽ]Be2 WY?g{=k6|JpUf6i$'O BJRI$#SPIhL HbM`8E$,s5,wRGtX=LI+x9L2.'埥 7.Lo^Goſ5nSLu?{4&G`gM/Zk^}> 1jw-ZQ1:VȈ*ڽ74eV*v_nY xe=jDNl폢zF wXHW'zQ?̀7#z`w 1ջ^('JH,gTZiz; mn N3nic\NbCu8=V%jap%ٻ ^5ﲗ?LGXi[9}:_[%8XDMb\*slY/o%Lលs7Um{AJ]OEnuSLJc9<|pQ2ierF3,#sL\`pͶ8xBV L.aӅX!TVS,(M-3ʒI$]%A I$JÞ :Bt(a!RI&PI$VI$I$$I$I!I$I$IRI$I$I'I$RI$$JRI$$IJI$'L%)$I:I$$INI'I2tI2I$I$IJRI$I2JRI$$RI$d%)$V)G%a%,TTr QAo))N'V*WT%,PPI$$pI$$I$I)I$t2p$ Id锂Q A%,TJQ*AID)JJbHpBILJSQ!L))#rPrTBI(܆Tϗ*&SYSC%$tJD82 UGI21ϔ|%.giolJѢG(q( ~*LB@EaVk:*:5jԽ,gOk ,7KIU5T@rRTe7 |D4G*`JeTFRS1=ԀCD)S&)ʊ*d<Ί`5N;!¶PP+IgQV D#  on!VFtNuV)VĒh,0X n SmD(>)6u+MvRBu%:hU+Uာ"SuNtTHp1L0a8tQA^a JfU{7[H9pgTZLcuXWihp8Ec! $)ȡTL'JdIH%)4)BJ@J<*;QBO20{S,&D4LJJG RO JRS$RА ज %JS$2tН)I$RJ' $2@(%d:I9 2j+ D"5 nP(3TBQ*'U"RBd$(TI?I*=%!@$2 S RRI$ɓIJI$$E%)$LR$I$S')tI2IJRI$2t)I$I$H]$I2tȩI$IIJI$49,t2x ))d$dRI$I"I&I$BI$I2JRI$I$TI$I$$II$I$I$)$I2IRI$$JRI$d$$II$I$IJI$$I)I$I$JRI$d$$I&I$I$I%)$I$IJI$I$RI$I$I$LI$I$$I$I)I$I$JRI$I$I$__JI$Hy'`qBkr vSړh ͖rxkۏ"cbjgwnZڱ7Oy3d׉f{<2+˲CH4v_ @vے !95A7 gkùSasH\Υr(hq6NQn9,<ÌJFK+vM,8cciX  J2%S[idi6KqS-5)*i̸2ܙ,p 6!p!ZVnk=%Cѵ֗hu)zNdQA[{';_ḽ"F-w $ܨ2}%(tV+$3<S \89^ }㴚|<59sSVa uDt#NOAFwQ +Ce9 +q`6 yg?}ǫ g#dxuyw.5U]*56)0EV~N-l%ZU<@qn#vPh,4rڣ!j@-B摈']5bxXdZv8B[#t(\܀5FĄwmp#UEN$XuZl0aTǾ; #e;Zגmgh+WPU*](kͱ?щiBD"Bֹ8 To"c]Fe\G/f<+hX<c&Uc 5;(8ƨz1LޝX 64xS`/v%FCCꛯs#L,iJQF"YYsC=ݕXh5ʰX_$%M6djf+3Gt&Ɨ IS>L a $­c[]ދuv' ƹg8@R8<齻t>)y{I\O*6Z]`{3Vdx9y#WuF kf!Wv=Q{ S`63F#l8:{v@eN n%;Ď"{7 CQc涵ll-߆EvP#lG2vS|IiIHբ0upkt'nUD"ۘ?F!q\g]h7x0u\_IoV$ڜu5Zpx!׆FX&t UI$JIr O)JnS$2tJp:I/:o-bI}woSlk/̶[,_IZcdI/(Vd]W9_غ?z,~U\E}UEID^nX:;K^}Z|Oo'g>9TTտ@j6p?Y];hXmxB~qߋgg,𧻓1_f%x~1':=27A=2_u^v$WIQL.2k?GM$"\$ 8-Rq~%Y8x{_\b(9=:}> c'siMK4 B.q?AOiŭ~]%4)D' R|KIn-%TJdI%&!EJRI%jnF摧P=jaUBZv,rЎH]xvL$&*]:jwb <ǹstsLw/kSms XvQ* ?% QlLw -5 Nv@9`v+cJ EQd J=$1sQ%]: @DjecVs΀tV2F'O)?1r@333<[7sW{rkqOn1!sn.#Vv3*5?N.*-Bp=ʥMn -*,sKZe< eZNOHjy,WVk,>&= aXmXy9{?Mn{+%d6ca\uWX.{W5-s9YWe$.chmIZ?Y|8|w\#_jhpK!c"6L}}/qƵYƳHrSrNX& Hy^BypzYJLd69՗P[|QAbmG$3lnMxjj1-K.,3PM>~j`1H)b&ZY9ub3Թ)T^?~t(]F[e߳?=WDyP]aR4p9+(j-C5v Zߢ4 *vL YCp&/Fg (Wc>8V?O]hf_,ބ6GogUH?D;]/uEo~? ^uzEo3c]E_ٔuk#+tq<{c:΍KYpoޢ~LJF LJ쎴Mx*{ϧGn<\|j`~O_]W;Av{rrsk ?%g #[I3C?NӎvGxZe}=bK*D&8HIF ͩX%gBi=N Or KC/ݦ6vNmp#I:Tm]Ck^=K954<\. }8]ߤүh EW7'.B he2=GFuKRf8o?KF5~xl/ͪ tg׎\ ORdRd~jMu*:?5c5jKr rɋ1#TI c*̽y&%* I$N8TI$I:JRI$I JI$(NJRI$R)%)$Q)B BJRI$ B' IJI$.'WUIn&qS#V\p&Z)̓l™r ;A_.ڈ yg" P,`*u6]p^-ZK|uVF--{l$]-:;NѻY&?"<+Xak$Ô۹*+u U:[XI$g/ho6ߤY4$ǒ0 Zx-NA1߄lwtTnX\>=KciB$ ǰ8Z50{$ <9NXԪ³QA-\#US൬lGBP恞G*0:}yW1ɑr)ܢLm0 ƈI"4>cò S1I2\MH!8@ X2ʥGV+su½鴍BVp Uos$Ym%&ݺ pE[i6֑> Wqjg=2f>Buv< JjC7 RN҂EckVsX@vThaʽ/pOK[,B\Mǂ-.pp=ֿ!R 2XH;^؆zhKH&5C\j W6MȒ" ah`twe ƸVD8gAPswMԟJs\]=s\m:J+o`416Z%@@{Tv0 9Ql oX^*bÄk' 5/=SW旨+C wAKey0?zV6;k%f,$Fh?4 ξv asdM&ΰaV2-kA=ԾϑDGHve2trָr* R-V޽w<ʓjgOW{\xYtNSwN}MyHlxD6K>ruFMQ(7:CVS=|j-. ՔӨ u42O }fY۲<=vzFfPppJ[kÍ̀8VMƣr;0W=c{+,̷h[.۰JXƏPGD Ĭˌ̯YcYm{-%U4Ge?niڞ̞Dzaʎi 6ip,aq-Ί}xT G*vٸVbz渒|E9B8V^C %iXE |Q[KT 񣆇'\qsf\ wQnH|{ތJ˻|*˪aD'IцK\yZ2M|ݏOe v!H9Y9}<^\u }%zO"# P}:6daZ\ҥҺ nCC,v1S}gU`e,J'/s|yhpE}M>M/h -#@kIxx>4ps,o}6Z"eJn]{?X¢*ZFs~-u^ 5e7s"#_ͥI8Xt>N{ZX~a{:e.d y O8rg"{g JUmkA:n&ATCqOb#gΤ\0`UQ_[r\U2 sdL=/׿oGW9}&Y hkrS0dWK1:vAx*kjҭĉeӎkY?a'f dH*l+I)I%)$$д:vqַhB L)񑁱aH7ӿ>&[4aS4hPz1sr\mmXdIr{h}6jn`+!ި,kK_N^[<71PO:4X&OiFCs -.  *Zv *wiHyB}Mmd!bU[ǼvB7a6D0 XUh'n?r1ϧt4^c['+H ^}֌I}Lm`mWqc_\" *m׎h;&/ч_Z }S0JRG}tBrY@?'7mC+ZYQmpVaGΦ ]{lQ lH᮪oOv~UGo櫝K-5 q fIPGںsYZ;./aO/_@fz, _ lF] v[7%l-Bd?Tm5f5JEn&](3l⫷̶GЏh 8c@|vm\˘cOXcoaU]˼ lֿVsYf(o~Z=DJ52u:2(,,(NH ".< Ϸ\Z;cwn.6ONcmiRw٫n0\ No6ʏVntv~lF8 G. y8Z҉z`2 QTf;d ܏JQ1/m5 gvk#~vAAqޏjkMBw?[_W_nk썪l9 r4X@黪G$QXi0#j\\ n[k3t_R'R9dK7qxt[(ƻ.c, n~͡ahfkUXv{톹Er)'Okai'k%æUMVwPf}O 8o}m_UsZZ\'_%;+  gb *e;`_i 8?ԣlsOx{?IqHK/O At" MK`Z԰ 9ѻVnPr ˳{H^?۫?==YC>{tǹOH5;O?F殓{W?>)c1p.tO;mC=7k{l䶻iW'hsO;? ,2)V6^3}`%k'ur@˯hdA@jݳ1׃'hl+W*cq.s \}ky_;"m2+ξhzl^~ߏi ;}E۽{;?O+}FP{[[45sc;<&;ϪklA wOV.d c2mn5>KUy-xe*u"Uwr$ sChs})0:żlcCdHVa>.̱ݛ%[eMo҇ӱi[{#SREa<-)C釹ی:c朗m~Cv{dL:!#7^> gSQp)F.OPs6dw9b3Zo,A9f^{TUXN"~hUכFpzGq?Wϭuk${uVtlյgΥ,lw;OyLJy 2Kc#Q?I1mՏa6xQgHXpFs GWRMmHog+ы^c̹J7LUw~kM=?-̍Vx+.Þ'L%' -&3ҷa 7W[?BB̚ǁa*F' И `ጟ,$#U[?O)hah7mK35:`$m[)|hjvy\XVPmG[7X!Ŏ=6?b^#M,o&o#ērv]߳>ɵ2ǨuLnmsv߳ s]9)%vAwObзwӐD`cm2(./CO?Fra20̜J&F[vXKoc%@_E\q4ku/=W{ƻ++p-%?wыv :umKQ.1,j& Jl-Wb  Ƣ1hu;g{ʹ,Ljïo77zdUoh.sOͶUV.VUsر0wP7h̭wߦY-'#%WeR]="6( i ;te;+fL)f[u p}:}W ȳx߻m?heẹk cqXf };xU[>,#%V Jf=ssuz9Y GJkp鰵sT ΍ܺ٫R;~!33&6kG]| yLkcBG]AeIoT7;Y;ZST{-siի+[yl=?]Mp꾋OO.DfF4}a{u.uq]S~qtqaΈq AG]mlCBn[~$9\f#n\c%wlAGm{G"'b<5MM-γh1s8lQq<Uo7ֻP 5?W﫝3]y!i1ՇWloq28fDF1\I$kϤ juF*K1ؕRq `>?[Eĩn<vaYNRJv9e2IkYzH7OrcldTKKt*Lmh{CT&cP8%1d֑铠DR8SeLcRI&({IFn!p.g>?i7e[Xy-Vp >i4!]% Z?Q?EsEo[ܜS~ ]-Bv^RQWgnIVuQ 92S ]I$$IJI$tFS"quxG6U8%1ǡ3d8Fԙ$\,{d7=_ dﬕaQ ؞=n$-sY|>z=cP73AP .W ˈLBlSUq]}õ&xKZ$T8<Ўaf,Ƃ?1RI$H:5UOd"rc(RI$pH*L I$I:xIJI$v0Z?`S;|1w_뢒IGrτJ!4&-ddB% )I$ pRI2+pjfc:uV߳RSST~{rqI\=+UJRpL+},uR zӬ{lsʖAT~g+?zu7q WO}LRuWj8VFeۤn^{F%z[h-q: ,C.\FrŌdĊP(!i }pIԭhpBY׈rY,vtZ48,Y8NkJW4@ŤΊn\]W긂yKF'Z M`X}IhJkZ.yls)!זr=j`(Ӿ [sC}ks#Ɂ32xp.8~BzwPmDpz9"=&p4hb}R{Z@'X\mut dhGTad0Cr&ln'JMV 0c2ZtkAT2~Yy-%Vmmg1V>[%qF'6Ql-'ߐzcohefG$iuGin(*6 +$N.eL+6 MHSNeJ`ڵ:K@%cg9o z/PsCkBͯ Y`dNJfecVObWD@>+HOx!NJa%<!Pkl]`*v=G K kyUe Jn) Tv>cbXf,g$GVBN:ºI$$ )I$xI$JRI$:I$$I$I)I$I$JRI$$IJI$H$$$I)RI%IJI$ ' )I$t:bI&I9MI$p& JRI$O*UV9$QUAj5 %2 J:$JӦNI'L%)$I$IJI2t RɓN f ~_bV{$Dw:{I$*qpuV *#R$L@T ("Uy*%5-kt:-kT]Akpp_Q8xY(+2edb~8tT'Q[lqAAsRBd@"9$I&N7ID$I%8)d&S>*%.d$I)I$dI%)$I2tRI$'I%)$LIBJRI$d$$INHRI$2tRI$'I$$LI$$IN%)$I2tRI$$JRI$$RI$I$I$IJI$I2I)I$I$JRI$I$I$I$$I$I)I$IIJI$I$RI$I$I$I%)$I$IJI$RQR鏈@$Kڳs&;3]64N D~+GC8G_ъ "tO邪1quV5͉m@e$}#extVs[ҀĞLuwC,q-BFkU5gaj:~:V Ѿ1x(]gGs@k%ոR}%;;yP~djޤ,i!{ch*-4*me<(kd΅IԍcT-@V6t豯sòp(BD ouNcq4Z85p%edɄ$zi3_7YB[L,Lr}&Ov.pR |ɏm4we8%GzwZY~nsEb,ڪqq:QzX58u1$dtpaWKL <fuC\D8DA*nHkZe&]N(۹aT4l2!ʞ'p.Z;ӹOiT_h !KuAo%fͩ_?KَDwGNtZNɨse;aև1c]tI5#J khQ9ZDÈcx).asGj#Өopꈈ>j%>:T֟{IUcN5M?*M1{秿Q{*+~%c!}ACޢ3@Z#L3eV70w?jʻ}ˆ4 8̥+lmUAy \L[UJ^/oсZnp; HJ֖{eHcke N<ukpq~UPZ>IΚSˉ^j5Vָ߷x'VJIu`AΦuy"杢UfO0l{I#Knza9i ޤD`[ݺlI0g 9 ΰI=-`)X"'QjS0S_QR6֊ࡳ:äꞗwG@}tkjo<qh9uvE m8KƃE zuBű=A j3bpIHgcp )un0;'1OS@UQiV@0xHީQ dk p vDHʾ  _H0A($8VG2\=n3+w渃塃-eq?)Z5:^ח9v-+S@v쪹q ARdt uaGRζhEw%w+!a*G*5"fe.TkL\I5(EٲK ?h #63ZW8k̽ZYﹷ9]|> R+y$S$I:d% )\$RJRO $JRI8QR'KꘫgwYeiWB=D.A$V٤K(VqCqwÕtG>.(;"HdE4t}UfDGV)[@1iF[,y_-3kr]][X9d=mC &3N'wRL~TfPѶɃO\B.v-*}{7p~Hg˯W}dAାcڏЏw/qk|S?ZkZ.eYV_ӣa2ͳUnOZ,}6 {̳kW6ƻ4Ae/K(pT|kÛ?;[ˇ,'>}Xu ^(csSgCon$B*r}2Y ?K^Sy+y YIiޖܪR\YH˴T3 vO#:`}G7V[7~ MDn9ZS9GpT$9{ R }'v-YCy׺R`?CյbB_(14V%KQFQShw|_Mլ Z߃~v+n4H-6*l`FF1e(46-{Ӹ܊F.v@j}I_+yMmU:MɍӪh}UHVkEMwӡ5918I@vL9ROd}\>0ݿ1~A{6νmitlAQ 9āݠj >Hcd 0Lv YULLU05./pn6:ͻp_4fDF}Eh'sH_u;FROH&[WE",vl&cM{ԘkOX$_T0.5jVj0ccwd}C'c.CnxbGFxF~ 6{ZgfʛMF\.'(-o;* VSi?IO)G%fROF9-f֍IT:n&ߑ`->*Y]VZq?J AV0<:ODHˢSg;|,͹! 72OT XGլީQ ; oFM_2_Tr25DreKՊF0xf;1)E`/ow'ncK-q;RX{L{c}?%Spmh7~Ҭ6MϏT4;?yi3Ez5mոxZYi>Jcd|ټKs\}lm{1jd}2,4l7~ma;5}kE!\=Siu^% W}v*iI*΅k5n}LN~+spvڥ '5Q鵾Va:i'DŽ1NUY %WVX-p&tڤ ݯ[I2.:7}./ZzfƠq{݉myװectpsjҳ {4$sVh?.6 |[שqv=diwnZ=S{O?5rX9{KISyMvϯb4'_m s9nfN6-gXWT5l/k~h?Aʫ0ɮ=[H>n([+&];3"]6'"-O>fzCю\?nS,e.}?kyE}֟Ml;A|gV &J\ㄡpzOS(#]^mnWjX0641Z9vѫUh:Q,lMֺLF) i$P|]ыʮ/am\K6 |QZݭ ^kó-[1mXå̟s9$4i]Qau/"IW2-ѥN?Z׋K̸_n8_N;[οM}d^U`4 ?T8&[/~ d}EU*nvw nnFK TC[]kww?婏BoIo1w?k5Y?CK.ǵCFu6ƘVSCCK@-]v7 2AU=O* 3ZMr}LrN8[[zX})fYA?[gzk),N/em==ܦrVzm4T%8WXϧn\E s+wͷ6_bGWv6[k \㾦f=&t~YB.C^Oų<'QRnL]U]ŗkvk7+q2gUb7Ҿޞv0Sօ5ĈqG:]D4{Zlde@>/wT֫tJ͖RCwKAt5&2GA{T~&^@1$& Z$́ȱ=}[[I&;Tsc,\:qc#5Wƶ[7٭ʷcX{X{`OMQVG./-۾)q9sv۷+#`9Xkk> ZT,> I-VihShzKOr.eN}lִž[UuZ.ulFvn[o-gRC'E#:x6zxsKFT)}vq U\}zb eWwKk r.W`D8ore\7 .q|iQQ#xRnɵBlҐu-L5h 3خ6d˜N*v1GeEhLI%FǷ0~R ʚAHj#mP[(ݪ-m!㺇wm3f0ӈ|QsS*vR*^ tXJ>@cvXo-vt?X80ai~ h>kw< !(jI*n魪=[$t7Z:f@)lz"ş 2C#R5SߪMl[\k5?Bg`Z9\~}%hi8EOc75GJ8Iwt ihUf(VȠ͇Pq*9cH0G);ud`Shup cZwTX5 = B%>4YpM )>($6U CI$*=f벙[dJmsu !d> [W1 n:$&kI0UN7KEmg6 cN^xle(Y6L.@g!vT~wu[NL\P8Dm#s±69Q7x@Y?g,ޏȳjc[q4:Z(hiQq ~( j]5N,g AEe '95ҭIJ׸f1w" UM!0`ըm ?5 QZllv :[:D$Cx۩yn tPUrYi%2]>IC#;5չ^wX <q`0hW&SD8pdBLXn pr#yU[ØANSUI 5d(L@ @rGt:iJ9- oʙè߹r=~˲'PӚk}wa͏47tc[8wzՇJkw4@ۈ*;pTu;:>k_ M1a'㪿$[K~dV}p ΂Z5roLU.?i鏠kG֜;m'nhh,t8)C`3قb<Pj!ZjCP%h~3jnNUAX77˲ɼOtWoff48Kq\1]QAS,kW3nmǚ7ֻ.G|t8Fpq!\o*hAzZָae!hB- RoͶºpfS6*N⃍ohy09@#!t7Xg&yVne(W5Ou~faveabCtUa-:\,ۜi)%_{s7 1>;JȧEb qZe(ְI!ݐ+Oeۑq6h!S]PI* ,UDʚZ)(ԒI&NI)I$I$RIJI$N8IJI$I$RI$IJI$RH$I$E*I$NNI$I$$LI"$I2tIb%W+(bTUkZr 9ILt:R:$JI$$I:I$&N$I%)$I:e R'LR )I IK9QR `$b1R ADJp2QS h4AHpDgM:y( ߱k]rre͏\%$fk0h'-t-uJfOk Z-bJfV_Q|7hB >AXRi :$úʵRfRAef~ ^˒d Bc@P\Ae=ʮ7rJrJDF #J0d* T<(O $D @Kw&'Ħ$'0dxhI:dT9&;R㔡DS${Hi vRP)2QS6 {Re2)߲2Q"JJH 2œD(TOIH(wt eM@H2 bT eD)C aD"28M1 PʊtБ ςI)yI2I$DRI4&R)yNGѤ'HhL J'4 ҍtIL>)'DMT)RJyp!" I+R2_!yIK&NuL BA+S"C%L{'JP2lN9&@? @Bp@*X<QBv>LvEi2SI C!Kڤ@p0TvN  %MQR@DE3r%2I2ug γ Ǟ$'LMn* 4JI %EI纫u+"SHr}=t2rsed#?L`3zvc8A&5Su Ru q2Lr+ k^5N_0sA 3\h#x(.dPP3+w{+ ę&n g?UyL(9A8EtV\tkky@eT ;AwJf̂'FJ5[w؉> :ڊ-[k1<*vWh];9[NܝH@{,`?sjmp"탩XY:`<)kƒ ]D H&06wW* ՛2!,ʳ3[ƟA<;gFe]78 yԥl8A:;2CΩ] c+e8gӄʫ [A`wTKw`ѽ[ʈf|S^x: 94 @t!k7E-\d6m F9Scþ ۔<@5KN%6װG=v|FqGLa׀^g@93s?G We]>qOMtGg5r?eMur+3 B9`;it:>(ni.JTY>iA5͐5ȿho`|4DtZ dG0O_ (^j-f2cvKBsnN<^0jt(4KF*kRQ}[#͸m&|Pi׶ q-sȂt ͍ "J9/aw=uRԂ5\lon(.ml.[nOiZ4d4>@ n[@T vD9Xb1l;+A04-+aLsZv}9o`U]\5AZޠ} T[s5ܪ8>q`;xt꧆6uHWa.Du:PQ30ᤪ6X|#;VYa53D ױ> EskeB;3UZ`A>¬nsU!Tcxqv,!Sn[ 4ӔQM)m3e8X $;Lw_?"]h&;.Kȭ#HgQ9 LhRfm0Ouq4铭ɒI0O)DJRI%)Jt%)2tҔ)BxIJJL(xoST>AԷp[=UB*_D.A$V٤K(V}`9?/}l]OQwU_ UBMkHlIlx{o [z_ٍWO9y;j虻2,?Aab?v7W/?Xy]\~{6X;0@ K>k\˧oϬٯsZƝ~|Vwc[Yamr{vLhY$GI)dTG6$L8+vxY[ݍ;GJB zk|"Pw5G M!B^#SD77K]I 0|VF!wt)>܇8HcU;kuG`s簟^xHl~y6C[_0J-.o$P䵲~(a53kbjZ8}`|1}1ۨݰHFḭuԙScUTڼM< >FlmԟUf5v,5r|3YvC[@@ԱKHC`OfH|<\VG\駩Wf-vK]f_Y ޥ')`8=D7X#dP ;>Bu5.2L}O]M!l$nTn.Ky4+Է$7YK1Ix9Ih`/*Z˾@H{x#s\[XJ澱++ckT\Џ ܔ!u{߱~i>tV[mcvױuOLT^l{Ʋ5wp1kΏ"{Z,imgk\ݧi?{sics\\ }?Y?V]mǍ?>ūOtx2L 5(y X KIOb锻3:˭i,e{3-[\i'wk*ϲY=F툱?_A!!A,lv}'kzt:<5l{sN툑i:sڰ a @?+r>8iioe솇<ưٿmWKN4PRߚ3U@O-՜j;d WҸq護5=aam' j=/7(;N+kcv?k] 7^'Cɶ2;8-f{U?Sk:MSO%@o`kw[+Fÿq#!X@FC% Gٲ*UsBYUD-D+8}@hE? >UzAP ?׭ʧC;K\Ik~qnrmշh:]2u]&)# 32qM#@¶f)Ze[Ä;TꚞGC( ђx:oaA3b#Y-a~ߠdߤTj1i~Z7EC~LL0*/ǯGlaئ+!la\Ԟ~rZukξOn&S-e:"*̱V`CvCڹLv5Z\} :f?KQ[aZ e[6 Kc g&U5v{+UM4~OXl웠c=YT#_jdpI\o־rĸ<wc?Q痷#Qۋ}Ź ljCF;T6n=|s?[9NGQʲy0[~Nܜ:;44Y7,shȩ}^ rrxխІ >ѻ!Î]WڵOcB>7mbsYVv~/YEHpU2:$r]a@gs#qVvH }"}p}=um?K^. Te|yӅKlu,LvV,lܚAymF !=Oޫ5>]s\=?U8$;!m? _O!FVJS]gGw?ϖ3]Xh:ð6偝/u~G7V,ƇOКܗ?q[Ƨ 0:W[]K~bmU:f9u-sǟ?ʱY;]SUЍTv`Wq݉Xkޞ- #mT z#EҲKw\gߙ4?GbZDF|+̫kmkg6{:CDPVƈ GI]-@uݓA'Wk9]<mOi ^wzb5.͕!cq}$nzh];uat\?7ut0l]Qi;,vo'`G=@Ա4$)륶~s^#C *vazN#, r)`Xcj:2ˉQ,YG.hgki}յ`?&˿`^ح+|^Z7t1q7`86houhV^fm NV󊭝Mc#U,w*Xehw̟\\Nk*ua7[>PÁfWsXrޫ'+*lYfG\~N?߰jG]O$naDå1,LOX)fp"1L?զeq L3|:ls|ҙ1RH*v**wlcN-R,Tjҝ_$X{̄C.:=$ezI$('f kШ`_`>Z?$|g>\F,'<7F9ָLrvmЕRk*s_}7\4 хuHVxO`+&2<^]nѧ &eil&{Q3裄]gnCjϥ塮Fs-$ЬF%f*cwgOk]Oʴ[Ncw[>I 'TC+!T]"cERˬnCభh97ڃvhBC$T֗xYc?6;60 '⊘N'2p0)$N9IѠY {b1,GHy@$y)0HwY6c>*AsX52XDߓc$LyݴA%oE%]R㧉\Ƴs5#R2X=Q{0c,|$q0ea'bݕuj|BV=U|I(f]MOLDZ>:-nڀpXpy̒yxJ5@ו[PZQsLV~JXfcG/ny*>?4c21]$Lk6w+ȪbO6Ӱ .{0H +1WC ڍ;bMl@l]O[n>z֡su縸̝5]?NdT Q~T{WvU7 L&䕺,>o[p@N\88_ &d*n{JU8N9^JyvPIrP;ph5{ 5FsB$&hI@쥑U-\\I,I Xik,a1rd;_0-,ެvV5\H2q -c$rp=;}B6=tȟgNI/6uKW^Į#:Ŵ(g!tk¹htDzh#㦫 W4%7mA[Ƣ{e_cd@Д*n {Fr"Vژ2Naf.6um\'lwUt{?^;TtYF/?KgtzqY^dw}gP=Q7%UnnSF3YM۟sՊ2bwCfwہ8> G:Rso C|h~VZ9XcD$|BY.DsIz2ClTaǑl mvgV6!pU*a 뢽^;,9سnP HǏ\[~k!аC:Fnlv֝|5+X<4NȭDYϥeRˈ12܇'ϻ-c!ecNGeSWi:_8WyWBǶѹ主f]aܻ5Y+$C@1SD /BdP{dD($Dե^5ڃܫqbyM,Em$5kgv.S8o-κ$5ι~8mzrW'ΰjyK0 hyINɛ0!9]/D&dςz_dE׸Tƀ;vDFc$EbNHvudXdR!I%Cfx[942 ״<.ƀ~ >:5- VU^Z[s1>=f}yuUgyVXV#u)1‹M{LaNJ[=1V_ GMbo@:ʣv5@#y1JO8xmܯ@ENRSy֍psR}J~ HP!JaAGD#!VjU[ʳQA!kgs9ZI ?0Bv&&ql\"L |O_vQR~(V-43AAGdR1JDQ)4"@%`'*)RRQ)\(S"JT D*.)(L!62Bj )(R 9L( %3 SI4$i&JIIKI$$)RSʊGN%.($?"5O)K$&IH}j*MI r)qPJ)OpJX)ĥʐ$e?LL)3$JJ`#ONk<_i.+֙T>tV^p@3ՈVXD;a8NKt<'i'AyE (O+z-ԁ=ẏAFt[맊(oixw{#X tO+s2xG+>Y(8:/$vĢj`}vvVnj⭼U:#M$qNA0a59<ߥSZDj;:LD{6Cw nW#?܋ ?݋\T]q }›]uRqm] ˶w;@s{F ՚0} BPԗ.][ǥ^g\F ,򓺎>5Ί, (]k6HFkZ*!یm2A } i wCUk.6i(e6GLQe5l)9Rc\ם ]K{z{nmmyׇX l`.?*ca<5^!I}{FnD9 '^P,۔ GS s{HS8Ձ0'%VsƝEiF«isx,Kx4+J6ױ^Y;A)rC: Tpq }G .Z8rz)hYeh톝dԝy*uc>%PI4OHu7hg/y#; ]*ʲig^T)2;* шiXlpX!'ݤ<ƽk.2eOnuH[ኽC<ZZX&tJNXk8[cztmɒK j{ HNCodÄSLJc0t<m R" vR@e:j5CeM,:%VQQˁpaM챢4 yW`'I+"kQ _U;d$HV*d˚q쓛괇pUkw~I 뫑Ki%'18cѲ2g.'bU"AFCѠ[oiy%BCj!ƆAJn+v~Tٸts(սrp{{F->ࢿ0:dRwYگ ҬUcl*mǬ&yBqca8 VݎO YGcgpձGR-d ޢ%ba_(t$p^6 ˏ[Y nV nx;Lv 瀜;$#D!_cΏXpGבd?@plBv)>,fRljIx$vnԨn> /' YIUpofSoWf8ԈhWh!ӡ}ĀfAse#]K~b拆p|V[DUM`5]Y8&q|UppN?(h xx뉎ȭ"60IV=:O EΘ' nM{5t|ÄNR[e)L2x2tLS'dtR‡ן=71MCKꘫgwYeJ_D*_D.=$V٤K(Va,~UtG>.(ƻ?J/nDC<@&hFWC"ҚR*%0d΁ZusGRk IZнv &EEб>b5eO=:xUM.`>amY09G V-uw~ki[@e4cd <"纱xT[L6䟚MBt{^"5 U#yS[5iVzNC-elS.U/~3m.p֍">׽0|?cAq"Cuw(xuRob6mFYEb,vl{]6Ũ</u'Nl7d @3ovKK0hknp5éntC1G oTf{+\&u?S>O)|.8: =VcUZH1K3%ka8]Y='vFC.KĞ-˴;˸`> ωeGڨP =^ܯ av.xjd9a>p},-26)XHÂdH/w˻׵1 /}Єיtx 4+CR2?׏Y1ˈnE!xDϳ9Ya@v|©jF> p1IMqE-3 Cc 9WfxA㫲"P͍&G4H8|_-lk~bMxw}'>A>\ +4Ǿ:QՒ>] h){x5Tj֒)D(YsXMO2Bydɂbky8gSsa;Ze!45i 3;=678aG,eOA'OVz/ c0*ωqюDTꆥp^&#2` c[MW8{3nEӹ'?s'>K tnܦ6齼Ov^}=[oO h;}7d w11mLT"yqڷ'fǷ&~iǠKDѸ=xr=†01S-6ޥX[uVfmԆ6W}] vR7u-qY{~pl6U [_$ü.~Y,1zU`ΏIkW,/jM8AGk!sSƑ-j 5:*}JTqUKYi.͵:[)^5.( 5u nm|d7䉳oݭ- ߚ̝![OǸ8ƿB.wհ\AڱU[=Z+4s[aO^Nnfl)cmu-'pZXAj+}- S<wX,4OoJClxvӱpd:ѹhɫ{G}FB[nQmU:.Li'Ymֶ $81moIcuoph;\68Xw:{br>9{F 7S_eafd'3/pTyʽR47?hȤ~9kO j SSnaA أM6D:-;$FF)jEI⯭XF6_^߾7Ss:f`I!ѱ ሄġK)s.0# cg<5Nj*G*yLْQ\#H+0Kֳ%9ی]^Q`$o/?wXۋcx}lTmGIk״Qf(s~Z+dۋo҂>mb79c?sISzv^kV}8bzGK~SYn\qԓ%t\.V+8~M jO!85PA:(~!`Te8 +(JLSԁI{'lޒǃeG09 [u/ML9l_6!+-!FaVAӬn.,;I[ŀ:?uT|KMl xYTrɶZ$4??C0VxyhS}7n.kL$*39c qpױ)͸׶|4RZÎ MGڅNVcZ(c7eE \at֡dNoiwCY*uo\?–lc}78em]ͣF7~hbՠ'Bu?FkUW{F<6e FHYD655 vC![#C[t![*@UH6Iڀ jv:9ٞ{c}D9GEֳ5 15U^[xo"rZej9Hhe ӫ;Azt8 u_ó+ˁ`etk/!n4#_U<;_1 M07Cײr_D5m%'eC3_Kt,>'e Ȓ S~~'DĿ*: xwszWq<}J<$D-M#m?H_\$]NNC2_3{ E(1 .Av&v;w k?Wi}]P|V:yBô5s;+SF?o"s"*UAQ;k 1] Er\{@ vJ4$_Ŭ6k$s?Ň}N;\bU~[n띣uj<tFP7!Փq8Bfu&8<?V; y3u 0ngsvR陎"JLӢtyB&Qcv8ݴc*1򉙒K̕]K|ol112%2nƪXSL OGdqU W˽:F A ![:LEl`1RW3WCĢw?st=9g28do-xECTLd>k[2[09Tm2VLg'C­}^),H S,͍;DSg*.q0;1-Ϸ,Ti&c-UUBNg{y;1i %V꘶}N+3v!V3Go;tF]0H Rn9>^OO.">+Ծj:ZfmTAF z_,:IGޥhxpwtgeޙ -.1yq2'-V40mi#S7l$QSe@NJ kw:&\6xh";*y-Ȁf?u]&g1`N\$9U$a3lL $(ӇQpܧuhꭷE@d  l>kO`mt<Yyis~ ZiLԎvO=-$5U2->I*o8Qj7< 'dfdWq> :NJ-{w<Lz?Gc u塉֏R5*+4aтatC \ xV^FNرð\"F(:>JM {R*-*0+JE kto3Y<a@R\3/, Ss-&H=׀Xg9dh|#n5r.sKv]n|f_JewʹsI)6SX$4[nmdu]՗SJ0YyW#M{P9nxSwsXдB(GtHHNN) BƿZX$g*Mgkos]gϫ'nW p"\" uq޽{L18χ&"UD6ud>d Lr!ux`y㑷`vuU9R~hC)VV}3&4<,dW@br*y'YOThu; UqkHI5uP.eǘ5tUqToXU[ hh;i9GVCY ęk3sx;+-qUkoy+M YQxjZPa,|%D.3I$ʓ+$d7XWs~)dlM"[!1]n]g"#Y== DzI@./NspØtE^]o8n[cbQWO?s0l1H 54~a7QYH,W8,.OPLJe!HN*-;mtHxYZ5݈\Jn÷x]&Kr*>_$3G@q,Rծ ӵR,p$gq.; u\Vf34bt+=[-[!zq\^ַC#;,͊zNIaj4ȕ|{u \}0" IPj:$t$$I'I$I2I$$IӦNI$:dI8N I$H$J)I$TI$铠$I'LRJI$'LI' d$$GXҬvEK2r Q ILTVm$% ȮBrd$L 2tL2tI%)$L'$NN)$e 򒔢SN%,TJr0NRD)N <$%1RN ` ~ &N5IH%.TNӦ8%,|srGdLj'5D~*A%1vT<}nוF4V*A!Yل+JAgf UƦzLN504FyU^;rJx:i^$aH҄cAκ&0%4%!4x$AЖ%BDŽݒZTgRJbJTͺ Hiʉ &()=|%HDbR@TڤkQ*EDLy!6$(TJJJҤ4CT@TS%@a &RD "yQH<$Ҕ<HJI$ pWi&JTH:D$@@L(D/2Te:ph*?2D' RR2pLS4;)|!)cŠsbe#QCxIKT'!8"QBV*ATg3`3+AAyI A҈B HE`" }d5#TP\e&Scs iݨ x1ӑ: k*"Е`m; 3iFQklVZCh@~@ny:3tמP!Yc%6FPm_ЦuiPqڪdkD-)XWYhӴU0 Jԥ "5UV7+Br۔IL%A<""\EaIL PnVeXjIVAh\TUe:#DĔI(v((7pdS:|tv2Bͨ$ʐ{7bݱڮ<#)2 +]0L%!PIK:ILI$I)I$hO $I$I"$I$I)I$I$JRI$$$$I'I%)$LI&I:I)I$dIJI$&NHRI$2tRI$ɓI)I$dIJI$$I)I$dIJI$I$RI$'LI$I$$I$I)I$II&I$RI$I$I$I%)$I$IJI$I$BI$CTC;%I$̑VC'Lc~n,űI\ }u!ůuEk:y)۸[ʤ:yk&;:@̡ƟT?d5qNXa$WB;Eݤ9b,cGRnk^Lޠ5-Ύ oEGIzNqX% %3Y 16v:µEް%sf(UƉvS6Co$3V GbDUTif%uX;v o:;nܨ4Y|$K(IWkDH[)fZ$ʓX+?s"+ܐ;RTr{ }9! )Y{H i.fx[ɉS="|BœiR4_ԅ=2dF8GZ}Z ?XYmD# w?o=$[;Mk1kd[nKl08+>2"! u~PB3,RٵHqv5`Zf;3k94wRʩ̭Np엂J۷ 㲗(o < {I"GdP>`;װ<@Hcn{.sIt N&ۉ5NZVXfT\kaN uq:rdwUr}r@2Es.vTkC0;9lDd<o&! ]Bu^UkӺujۏ҉GVu ΄,Z˶HRnsNrXܐ=VޝϰcKB=DqI`L0 OWRwP=w<2+cǻW9v+Cm:c AWs\Qޞ*N[~o5iQW *6{ۦԺ$Aֱ q;ͤ{E+pwVDŤ+L%f:S遵>XA!ogTq@ab=%mt!.F V ZDx+X:8@qzmX9l3svнkII''Rqר3._!s[@QZ#OFp-C{١$'bא=̓ha [F)&I2JD&IO )t$ҒyKJRI&H(}yoS>AԷp[=Vj!UVq$$_(V`l~UtG>.ï7|wUewPuEU}edj`Ha*tKN-N^QA/g>>2c*IպV:UzJ:x ps=2d;rG`zoQQe,2 ?=EDdҒBVD{]{|9kɩ.ﱯ?yktg-K_c tlԫ&?4$n]jv& jZߋ{OVsKlc,~]pqvR0՗5ûOڹNe`2꯿3|jѹon|7ÅupVͯel-?C2n \d6ɧcn;1Z^d}|]̼z+1΂[#9Ez{dž4"SaRюDC@ݏJD) [.ms6O?O}Vni26 &k+EM&@@i9iBMp;᷂{p@oMjux x-L~ uQuN747bepw F;KVzy]Fcq乌6'UY~a`1)$6!sfW>[םCIW][sf r4 ,`-< _PZUNqpR\Y۷=,u'p\ֈ2e\~;s P e 1W3+%jqx ]{w{UMDqi`~{0ȍ?oc =SKc,}Y'OR)h=)s:ˏT*ovTHwNcgk~Jr wҁ`[sGJx?p1ۏ\8zZ- chOGl:Gj|qZaCêNp`&ckj/>m[]uM\X4 KoIJD58E;w[/-e wUnuj>U|:za8 <*c-.s5!Ƨv]aV}>Z9m=~{k߻*@c?B=Uoxy}`t_d_6N7wRk29 >;Q2\yvnU!;~I{1Y& C_}JޫDț41#F/3w:Kg&>Wo;@mv0굟kuf+ PsIi v?L1K_G/:Ӽ6{]M&0:Rf{g:ݕʁU: se e'p;Ofݾ캇 hPۍ]M" sPz}36Ãk`KYe#M/7ƻ?Q.615@-K7K ~ Nvvv }`,w^ oa#qGxScIfpl;!Z*km o>*kT5踴\#@p@v;8.V(s9 0N?N5AT:}9lߺef`tnqRp{&%/m|Y_g tpP\7Pe>T.e\B-vw&SȮv憷HAeKW߉e9sHu9ђ5 1V:םی$揄UL7Tsxcd>[vkA2c/Qc zf5" D~D˯ 1E?A-%aQX7ۀCMbu9,?v \ Ff,hO!`ws_}yoܨ;2@$ƊՆVi9ԭޑ^scɑUq*cEU\Cx gkq']S̴ts:ApAR7ۑsm.[}Yumst4kZ\hvF,Ԕ\JŎ#*/ ~I}d[wgOL VXJR]Y`q ,B0Z>+ a']MLZtaSV11pD͔$x(}ЩaĨ~km{xkG>k ٶu[!*S#yo$%uR"T*G)-ޙg@դ[@cI q.RxYۏYj?k ^əpVk[ X^<*s=*&g@*0܉!Ie mZRYM IДK6<}&4ܥ<za,Y2P"\$^r[h6j?[sTb?s]W2*HlS[@%h ~n(Һĕ: kăF /\;29-5ZTX,lM̓mbڃJYb* dh}.cbt2lerfStq ܺ 7=(r 'Bgs! ~#පz1*J53``>4 |Gк/>vn,nu$I]*4vTBfLYRCnǯV]1GA黝Z(}0%ypNiGӢ߮Tխi64fdꭷԹOт#\6ȣRښD0aK|$Tsl%OvupsJc&|9C>>prq}7"eD+{wnZm:oRV5m{U!JvkUsӻWRRV{Ӛ,}֡aiXhxAy3-vO:)p`*4dLϚ=W9ǒUP4ruDlܛ-v+hcxכ+D*Y샯A6o=Ҫz{LcU$qD$u!o}[Ʒ }HYsĞBisx2tdXjzLnUE{ۨ!kp^ΪT_:HUzQul?IQm3-a!Ao|K}G4e>V~tX/hY5oio20̯yiuWCUh_*/!EJ>!I/mϠ>8r ;Kej[_$r trZcba'y5o3hBfk1X'ZKIs"=Z݌3Oi߸RWZ2uQz}y3} *,>7u_;k @۫ G N>«kM`-+i 5 84I}]᪍7Fݡ:ʗr= gUXkA:6 PH*G ew 3&ǽn`8QcËP{hOt=DtQUG%չ`&O+6ժՅI X>FvCsC% z9'^T.AA@kfvr#ٽ> ihVCcp5 \5hL  k%UcEe㖴=| <1rN&;MoFĨ{mc{=!b9r:]#P܉qk@H܆"Ә}#GmM̽-cRֽ.eFD@"S[E{I2UiegC C+*u elZ5%n_Pq V{-]^DFe@#IpmyL9&HN:mӬenΥk8tzW~kͭƷhtܨY4Z9YvaǶ{^ gTZNǂi $y$oX,ehu#{6ءq:jU-N 7Jp4UrBc<A8 kR[VNtT dj:xAO({$1|=cqⳆw-Nhk`L- 4t|#D*Ef'i: א8> kBN{adVb:-Aqt)U_/;hWhrY]X铸K+%Ti -.^w[3=\Ooh\\S-%HH[ +eF@uH5x|ğj|T~,z1?M}r\A"A'C0O,x~_Ov982VHR~HHu;2\8D^ϣ+`T=_JQ #I{{'e{8; zoP,hmu NJfЧg9l >)V3Ӯ [ױ\ѥ`z pvP~'6#0TŚKUki>G`mpkh.S@셞tB!B}8T֪6 ;NLq :<4LNm`y*9'` *2Ht8hS`Ή0' = {vzmFYXi) @Q.!;S|\I %^o= V^+nCt:&uUΤI}gpc6;`v=^xkq⇍\ڠ4V>6i?X[?g]hl}˄( A?63..Ύw}%պcݣk3y%7 -NCD)I$RNƉ!I)ƩBd)E2tyoSAԷp[=VUV!q$$_(V?/}l]Zɱ4GޢKJE^EYT`k["D\?JϤ9 :;1u esEk_},к,r*5,Xӵ-W.{3k"AN+Mo8v;Oqs+T@yU~\-VHV1cOˌW&x'w7 .h?{L4ΫNk*sbTv"|(Ec)잼63#q2vRWh~.{73a" j=oHu:ǞtV΁uHҳ!5*N=76bRnȥ_D'){& +Am-WG[ S*0 ]OUk5gqyvĎ4ޠH t }Հ}ǒ {M7X93+B&e' CnMc,ֹy9u?U9ZHZs^F8HT:A0xJLv3k1EC&)K\V㌆VTݣ.O̾Ax?GGn4QC\?:?=G5Eb'Bc_.m}CS1?IS[vaK90fL\<f W5ڛok,:V%u=g- LXߗ\Ņ 7ճVl$~k`*%̴H&ɻ=7r;)6>3Ehiqy]eͶ PێS= QGM+ikO9fFI], T7ԉ'IBR7e ;oWkgb ͑.V8XGrm~3) d!rٍsC;.;dV/>ߴ4$]5.-S@ 654GI[`0L4}y״fg=ҳBK+;5Q=%~VvSMVGw;.F8Q&Z&@`j`QD޻P\ ZE"ur?}T,-&MpG q̏ ¤(MWF+ߵa ŲKcGXyTuĐZZ5䏥kkfeln 3,kXLpK1FgQ/ht#UYX^ŖdG3WGjaXSVbVݼ;Gx*C'1Kyޞ)lՓch$,|#_o4$">>FZISmz65CC⎭Xh=w9TW᰺%܍cnk)5nt=K<}/9?0pue?I=[=4乎<G}_/_c]N0E?<&^ l#diǼ:1i3H2~J6Z\<5-i6FT4'DIX\LAT ԓ9N|c'Rҫ)4ʞ6+h}Yߔ+t'BrIm`>SGEЃ"Nx3 ,JheT|>eTe[sl`‘=''(%Xd&-~)F0ns |?1tۛNsA7؝98ג}Mv4ȫf_Wi>N+ W=K6f\q?Lcs蝱q; {hIRxuU\?N?-uwp۵=0?`t;d0f*fxh@~;.kw ڴEcJaʖNޣg4Ǩ( k!< & p3Vs۷բ۰Xɉ'8Yj-s1WW=6d[v-AO% [OYE~bY ~cfnIbP81TQܦ :pЪuc̺Ǹl`^ja<sn7ڋMO7Zd?@Umn tѵo=Es=Gۏ6Q6S5#~u؝:;^˄mnXW~uYoIjwz/*|X L |d8]3"5T{}EN]oY5Ml,V؂{=As5H&g? r.ޜAUi77s^P8Unk<^ַֽTmL%I'V1!~|C]XdJ t׶[zuDzO=Uʠ}cZ8?HӳX|o#EC?9߽e#9ͣlOGl:57>֏$L ]^KC!ܓ_ gZ^4cI%k]r*͖rOw9jN=NcZAm@n&(UQ{t)i,Q]:t2]U0;_z&7!6p)Tsc:~[#uJ>)o[kchhZqوя+ԓ#*52]8}#^D. tmmZ4_ST# BFnP=UKzZkFn?3]\w0{Xnuڶ8}?{qkt3SHxs/ѺT@UbaѦK::om5_P~ Ζ8I=t瓘jqڟ.e<JmRpV@xM^N)'[[X4 -tc:=V]@~A5-՟֚d{LO4Q>K0?XokX`+ꭌmd6W AUa5ڄܘ8T7;es? 6+m=TliW3:t=Z{䮿uAk,w^cu^d}(%Q#ǴG⾶ٯ~9k*륦%clI{+#=:kg rPje+nWiK`^}c25t 2m{0a=;,Ɖ[!k_Y.?)k)dVt-?SJ{.T1]&= wI/kh_[9 ^ET?"n okRʃ8Mw3_ ~+Y4a+$G8#}[طEBaRaGtZ.kÃO?}kh':-2Lx MXEy/eߝzkŭh bt4Wc( `8!HrzszL|_[N9E~{:ΧOt\;eYt&_Ojv-׍G]uvʳ~[ݶBysaګ;C2 y*˿L:m#t}É~r_^;b0{\{Bpmi›zM6~=;N-Iݎ-9w!:ʼ뛎VMǀ*rxcnZEny ( F.!EINaQv5艄2yԮPu۱ʀ6呛ac qXca.3*J["0:)1jn!Y[Mٕ Dn @H}LX(Vs pٍip+iBԮ۱-tL[ 5q⟤\Ggt5Wh+xW-.gV 6*i{ W0d,|U;+9'U}ط00² !w-{EٍMa)͠hmi;{0ɛX j᎑02 Nd*I*ٸ}Z O SYP_ܦxo&{q`vՒôw:aweqNN+V"xS#{&>+9MZvAmUհ"BU6cN< kP2j&lAιՒ>s̓t䬆5Ryf͏ r]Q˻kA"LF/9gPyqtTz=Mc`ج,K-t+b8 Ey{ΓRt:L75d 2  e0xNqrgOS>+#!hTT^f34 YKkcfOO(.SxѩQR47N;%[h1C4Zew}q+AlO F|7d]IMHOeOןRhD&F,M$6 'P^>$ {‰v"!I2ܧ JmχSC? :B bkQJn(ƪ)Qe@RSl=F܆A)+*&mSl̼rۛBF5M%6AMoiSO)aQ,))*@["Js =1d$:'J[ Jg)7ŠJ[J[JJd6Q )(ʌBe" ALJ NT; )RB@y&OG*Q@Np:' %@LSA))D(L&. H0Ԕ$5Ps21l!?%/ |PDrCea @"a3 TBO)SЂO)P% YYmL- 7/ %3V¢_ V~»k3 ;6/4f(JShptsiY;lyatBK~8 W-[5^wodK^O*CIm!1)PJJpJ( `(‚RRРU] B,ʽCRչl WTB /))ø؆#Ug%;*GC lS{CQZHGE4wUXJdfU2/$+t/d7un 0Tk QXLN E%,&JPR"$II$I%)$I2tRI2I$L$I%)$I$E I$$2JRI$d$$I)$I&I:dI$IJI$&NJRI$2rJRI$t!I$b9I%)$LI$$IN%)$I$IJI$$I)I$I$JRI$$RI$I$I$I%)$I$IJI$I$RI$I$I%*0Oe)$_AlT+$ XbQ? w.^qǗ1f1sl[F*yMyf!!oB&ԏ?C,h'Uq2!T>wAE<:0C/s71^_/\T-m2 |h?-'-:\K硻3E}rϮm2tǛ ȸsW%ZXf9 AQX3i5*{ژ sΪIi,u㭮c^uQo7i1b# ƚ* ف% X0Z@_q:҉ns@L[%VE}'YS^X$pvY)ԸˏxIDp sS%d=7 o+'{ݼԉs-kېXW{$xBjeUY5 ^rkRemc]c:c\o+"cYਾ ['RA3ZvR\ a<(iӞAC ]aK>ZC_m٘FW}Te]}xY'F̶݁vTRGTz8?²'Vk6 CSZ;Zfi"UlǶVm[ȹPҚ=9Ro7zbqaЁI,sehX!'Jkv]]G/VEkc5OS^~ \ {?r:J{K'VTghNV [\A<"{gۭph3&17As82Ǘ ʯAruU%l%{3@hT\Ƹ:r= \#Y˻,aFkT^8\՛3YU-dETK^G=΀@?cX3l} C@gcY;mvwE X[ H/f²߁&W}Rw!n[ud1<U,DVKt>(Pk[*skrJqYC/VE>\*kaX{[i΃iG~\V!dW߲s?p#(z]kM%_+'G34%WӰ&VvMm2ֵIޝ~!dҽxl(=1{vQ?²ޫAphqI h]/g3'Zޣ$~Ȗd ,f?;§{̛]co7.\X繁#+yhحՔ"/&~+PqC"o؋]"y2։Y!RHDBz5N3sp7 o~vLʄNac)BII)I&$(OP2IOR钔ҚԷЃMLU;_2켫U}+TIZcHI/(Vu?/}l][c*?Ҍ}UTmSRL%_ jØ>!iceK;nLL IǷeF(*< eNTu Mʣ@y 0 ?q[cAuRs3[9j?}8xAY6[ituoCo݊wu_WHm|)%5)>%^cg9cÇՐ΢=7i{G-cV 4N?5WU;-0Fߢ2۫5#QT7qiOENC2q;8^:Z;V#o^#?,L_ck'qJfKg!I=@GBCQ@h KєlcFgȏcd|=lɬ @h',\[dkb{FrsVeY~jQt}ԸI_%zEY 9B]dU#C.ˊ(>vON:pkkDO]kpqhN>P~3N iW'SƯt> I;_[5d7% 0 ׈Adb]A;/$_W/eϴr?5U5[:9`kqV`vYp ^jsmGAo:s؇d5ܖow*yԳ2G>+qߌ};K`}ezr,mF;z:GP)tzeߡA m`nS}J̍k?*AOض0~Kc>Îbvem hkk淈s2ꕘ>eދwVkuBf3-O3ṅk1=[+q`,)cŖ0FX2v74rO}N6tН"d(|2-[~w[ۚ۩O&Wkjmv`Q٣MMJǞ鏣. FI^AeAyuzec)RIf!2=rP> J*X};EkCm#_p].5m}p&5]nf,;KIOKL8;jHx;:-˫/'x]GFn+\$۞Fϥ_& WJ/n67a\~~Eq1199ҭ:;Y3kPOun1@Gi ;3n$IwA١; ݕq-C@ q}ٗnQ`9=ZkHTs\q!%WVUd'S4V?>4Ue Z6\tSmo,p1U2A6kǴY"tXu:>%+K&aG @ K[@L/q< ͠*X^xnA-?ha&w?r..!c~c7 Ι [34{'r/pI6B[Iq%5U>1BEGMVX>8?;eh]eEsL1C<7 r& l"=&B٥ 34Tu\]l羐쭢 W!.~vy??K(fumgw@ozwlmqYuitiul T>%=27W3 2} +[}:u#[}ƴ2Ѥ9Jsdx&|c<4 *B+tÑ4c䳩 5d9N?]}CQW=^9t笾Ɔ ѹjEȮg*}P{8r$>Mj)k"豚[,wq+}klUmc^nh]웞iE8O։ntQ$Pq.Ō+ckih*Nn~jN?)V1/.͞ I%}_Tp\,X# }b"4w>LZMy䇑aX_Zɪ]c~f뾏O g6?tmg^>gzfeB]g@9dY'09ͤV C?OrUUcl&}+; #s$(c+zu-F}MX1Y*A.']I ww]m+Z\=\=>}6= 2o{ ~GGƺӗk}GOvl{}Ԝz챷: ꑛ~K{k7Oȷ 7[z=kvD7/f`l^f3Pxp;:Tn e bQ^cݸ}©YkKy?~~X;1 ^mweQIJ[鏢ѭw"[zl8 Tɺ-k?{=>RM2@v@H.s56~sDkNˏjA.󵭐[+4n$H:+ }< !Q;/e8!s7W/mm}U %SKPXsq1汻TGsҒz,^- x!;윷\"D}w#VXm5"OsqILJ]ahl{s_f%"">.8Ueuy mm?AwN!W\,W5Nq:fZG .ܷd9q"?>:腊хxF[om i.a"AiL =QDōwx&5*Y2)Z##-x>R{Xw]*ymُu䏓S3jkr}EԵh~ڙ$qsG"7'=;aj\[>~6x?Htك{ex֏ISn34vɼK3_TA+3emdA<$ o :gnwf^EWOVf;xUrc:{k^cxG[Su݅jCltv 7*bÿŸWRHIM]vH,htwZ$ bzèr\ns.?lg3: omWĬ;{Z(Ο d]\FП9F5 v99My9?Cqȉqٹt(k:{ׄ?c׹](Vu2~eC&lkYscS#Տ^^Sn|Vjk6~`Ѿ.B@<IUNdUgcb(4<@ULmkXG\l/e[ x<!e7 1Z#XoX/@sg`m[1X{:$'ի*^os#o>VOWwPw@+ѣju4{DUtӲYNN-ZwTFef;I p+ .q? hZI~^{7EqV/'O-$ _|۱dIpofi`jeuK\?՛saǕ{PGJxj-&o%5M[-;ki$t%l^`BHu 1ZqdP+ru6pFҟ+wۀ:xwR{.ŀqXNQel dLmZ5+pۨ?E!ka4d3w25XK͓K[ ƧMGub$lj US1qlxaZ@Ψ_K損y{2ko1ޫwae=zmb6L4Un in\]+:w3.h?gfCoIgT~ue`ƚh^HAAtÎD!vع7ȓ_PN4'Kf}Ɠ촬crf4WjO yS~7Q'pΑ^co}Ϭ=6趩k8Ch_:¾Aô?s "69UK˚iSB<.4T2G{[hu%T׺E@ׇ651u ޑgx*# G+ZO 9Ϩ6r`*:S}'Pq}f2\,W! &N?VsO\ӭ^iuO/7T,sV+r.?D<^ik`t_EKc#SpOK Dev\Cw'MYis^,:- 9oޯ{֐$GE:xIxi9\P-w{J' 8X=:k,n $5latY.hܸ%gDk +;ٞCTjkV GjyOCſꑫKM"h)^B8lChfͱ˸˴ r8bxJoxN)P7IJy+nkHlI0kt}'UbH|FUhPuRL4h]:ZmSG=O-7Vܻ+涞#~Zͯik ^6S{{6<wܬS'Hs] ?,84 fj%]7@8\5eX#nhӄ7C1M7F~Gxէ±lc :1vBcTx`Ukǭ}rxjH&e,񀦍K{-}u:j]uLH T)FOd@!na-WFʆ'R>'GV:^krZ,L9'ܡc9$@?b<$Z7xDɲ鯗]?{ø]GIk#%G aL3pȬ.N8H\]3]}hKDSVQbNJGeGJ|PhUeU`-W"zFI~-ދ_2!k?&65roiѦW+nvOVҬi=Ez8OJ#Bwl_q>%QʽXrhT]⹬ܻ>ӠV3=rO =u{8|\~^9~[7"5Sܪ7B3F8Os9ÐxWHYWbޤ\:$r2'T@Qŋ*"i 2cv'u/2Y8Wr.cX #>@%L8f{eXB#i p-" A6ś@gsC μu3s SXIkuXn>Ǖ_BԪV!uViBA{kJ z5Igeպ<[oCj<Kߛv\]]ǟ4*Yܬ'JRrHOUzC7?7U)ʆ.3X*‡xAlq%S ANNNtG%f6L cMIθUAE8J[ &`Nɧ{c+kbJ6J(tS$FlԽGP p7Ժc8)6.g|/h* d T)A)]hn x!N$sʀHV pBJLnTyHAp1|TC~ @ StBvG3!:< Cudk%P`ILuT>ѯxV+@Si\do^ /婶) 2ͧLZ{Tǒs Զ!xKU"6JU\9L?`ʐ`R$&6(n R7 %/)A?М' -,uGZ҂; ))1T++(l06"("R !I0јZEke.L!<8ЉSe\n+,BPbEf# C{f,dOh3,CƳ?ՙeMgh3u&x>@ nQ.Jy.Aoy>\ pWH! 0= =S)  I)BCyBr#ELBN J:TJYVvj\R7O%ҮVQVZ pVml3~T+PMyڬ8@{&舐Ykpt܍JҺ-s 0U*2,2K#0ZTR$RCpPFpC!%.dJJRI$')I$I$JRI$dRNI$I$<$I$:dI2IIJI$I%)$Lt)I$II&L1IJI$!EI2HRI$2t)I$IIJI$L2JRI$PI)I$dI%)$I$IJI$$I)I$I$JRI$I$I$I$$I$I)I$I$HRI$I$I$I$$I$I)I$IIMIJI$*j@W%~@%J*E FLgN8k '$Ҙ*PR򒌦OO)RSJRD[M)Mi 2*W}SJtMxM )ZM)BdRN4R(I'I<$.4IK'O Ғ)$:_JY$tJRI(N ZҚ{O Bi))IJI(I<JRIBI&JRIBPI$IS&I<)JRRBtR %- BtRp!(O )Jy Ja%1I(Dr$&ڦ"%(@BhSJe$--$N4JIJeSSJ!NB> N)Ji9JRS(S-ByILII8 2$)!}zoS$}zoSlk/̲{1VUnI+LlI%(VuP1ߕq}QwPG?(ɏwUKy*ګg*L#W]Z8Ls ՜!p@Q Ïnꥷ15It=90|U.'vWWU,I-P )`rF*]_E|MjͮZ bu+nmɾZVmk_/W3X:O.lZsH۵WꘞeAߟWKhFfD 4 ~SwujsFvQա]:H;J@G !U=Ԇ.{2zEua;9O9wtaH$Wn׸V9.kmͧ%]N5Pg(dĴbSCy- Tbڥw fXj]V }FHwVKiCs~?rVmdV%T5f*=.Ӌ`_OC]OFnV~wZf89Jǿ֝ oK0}AcGevgbi;T(vVYmIFqk>ir ?Պ_CR$n N[0MV?爵Uc5|Owy]TW@xkH'M` ?~w?J70چ>'u/6Ę[̞\_ Lk4b\1V3ečX~E/:LJ'>ǜ|qZx7mkgzuÖb ʞ LyQc.<v·*+P~{]cퟢh^g6&ʼ^ #?j|=yѣ̫X:v<~%UhdY>ߢZ&FNJJ?Nv,o?XeX.j^OZ}VY@ħMG u~a/stC\,Sx+@9oIcNؐT32"(%:mgF×B²pq4$Z?%j-Ⱥk`uyCmq^7iGe k?We&$|P~дh5hl#ߞa݃ byX2congG2qZih8 ssd1-Nf>Cqӵ*\*sEJ_Y|nhO^-vs.o7]Zmx^mXbEH"] y gZV+y6>;Bҫ,u{@zIqN$jmcX]`~HGY$kT] 4wd: I?щԮ״8}w۳CLXєëF61ɾbH%4X7CZrqYk}7+5Asu|!tc!!GWtٌk$4W^ 'լƥR$0+-p8,Ӟޠs-ikKhY,5Cwkv-YpeH~) H)QKWzPs\M5[s.e-n[Cg :~w)tVXhƝ Y'w9k9.qh`ljՈ#hU1Ӫe<7{# wI"_ެ9,+U1Z 嵣c{sQ<5A,evUPoX_\+v\*k>oм3Trqiv{툩xYgmXsqA!z)㙜G\Sc 2'[V^](.킅h=BɍO,mX0x$1>^:61D\!o]vM]lns\"ŝe=/d;iͿՌ=5T1p\l I${ެOaDG/W$Hs*q}L3qh{D#8n#+wسƿ%kKKGbܴs&;Լ,RϰO*kc]Q~|Fy~b7_V0r2+yoy{t,ūc6C`L&ک7vx2_4J2CZZX *%YD 1Ԍ2ʅo s0nwCF-0 L QHl r?F1bkclAɒc;OϿ:Jϴu[M7AdINb ?Y#0̸[A٭_hǯM O)1jUX Ow)O;wJkq|wU|o?Ə*v1 ?V"#p?/K",PeͰAg#?#݌"ʾr?^ӳ[Xٖ;?mCul1xWm_CӨѡ, FV6P:}oO za#-O?^!i^3*Zw湧IQ2,HcuyZAQd(ƾu#Ai8keY y*:Z?:Ho+o3N9Z.ps=^{6KkX/J- *S ^ ?L=5v~ns*Kjt#(?HVHTo{ô{T,Sj{*k +R+hcDš:9yemK?]n=i.ym[P|=Cؚ${+9!LKyUĞ8I1<_w5 8At]'SCNaV Kw,OcnyL.\|\ѷia`ʲ+QEWJϬ;WN&܃VX!#RʧVV$]/ڙ~As%ߞzC6ղ06yYL0WsFsy+q L_f4q.cR D7roOv5㹟,{ljiVob%W uoAzn尹Uc.]OF=xH x!]6k)ϫP>0XIhJaҭ{Z Ho$.O7hT ձu{";@S@{o!ZMMĽ@3"5ЭeX> #@h8(.strX?X-m0{ w{.ieGiZ %iC~s;w9O?>Q.n']Cy?bթ{w4O c/ױ&}cOs)ah F,!_x;t)mY?*C;=GnGlC@YO>:@փ\ |<1klDMرIiQk/'dff}͘\NN[kMhπ*oo(J_x{rIsFdx#|xr/cy:k 9čP @+{?CFM_E"7wO]l΃H w4ss|a@[1(YZ۫|Tn= <*otO$EڸRd2VnuW`#ڭ5T?8yIckD 'gQiga,jP{˚@VF'YఘOҖ?7wRk!q?ZXU丕u[u9jw=ZcfWY5Gˠm6rb> N0b E_kD,PѲ'\!g9ڐlv^exejػ-uWPx`5Qp۠(Ӕ Ժ tTY% "x>kec UIţ֟s `*`H's.]ZG BX0bX 5Bo^p5gwes8Ĵ,&RT_NWy5l˽ |N&_eueߺYn.; %6dPùKH^sZv8l̶Z&K|cqr^ʋk bӲ|䬮Tk L?o }PβuXMNe^ sGiQųM85-7M*,}0vkBk$O`[sX$G0RɁD 2IJj3*7XyEUӲ8b%|<$vWhX!akK%9tv]H z@Ԕ[ ~K(1.fNzY*^KVzO:l]]{c]kkasOZ{%ִhCt 6i@UN܎Ys:6[C >֞֫3-Ogk@۞]O$'P啑L,kx,mAu{*cGd\hDdT6M/h~zHi z[ֽ5es/:&:ޙen0'kQxVLB`vYC>gc9㯒 -$x;_"`P] M⩺Wgdw){-5V\9QMufʈ AFQәS]AaC2l nq N{t:ʭƲZfdj5 ,ccU}y#4ۘA d `ʕp-@Ze6c1f+YGuS+ "esy w6s҇\bƖJE)GV1VGXX8_'t[,~r)^(9]WԖʡH! OLF'R=J}[hI!YSkԟ,@sV_IF/pU*w ) 6_ #}xu fET>FZհN?@-ک C(;+A ܆N m8y<(lM*'pUK(f0X%oCk'_-$y. +{7!0h#>] 7-f^ Zׇ?YS3dHzMΣνidU {"{c*Qz/S<:>n3#EKgwWqCb4\BzfO<splŅf*S/"8s2wy){]>tWY$W kyhQAEhyniNѪoVɡd3MBk՗(RnQ{`@'NiHDnۛ2\u]GlY47!{{TꇐKA綋++V "$8ie&') W?0H *C.ԅs`.{? +h$nd<4 Ф]ì΋nEa\}ZCZg.WNͩտUYiu[X\ 7 II1jI$I$IIe[Ok+/H\ 7;&4,%ꔽhI6~Ӕmnz#?+OpQG*UC4T߲]x'GaN3UoQAIVK+@.T<BiN3>) C]5> BF~ڗ<|Ӝ4V?[S#MOn+3/yJ= n$̟߱[۲}{-C5a}/yaCS%u>^[l0̕*;J >)uLq[,'bWs&`äGK8=Kscj ~i|R[~ Ca]Qo@a}WbP[#f%tfoondOa*tV+ȔV 釺cӋt|Nq{qjeMHR/J IR#j>TEjɶS:WzmRmÏ56`x|NSk*MR4#MWjbdޠ9U&M6B#q׀xF/-S-^J{-ڨ\$[gfr\RH$J`-&'))N&1JJQrJZe`JB М^RBv"&"SHҙ;ZS;VUs.|hcYwW+BAY T V^I/#yFJk=~htn춲`mK0gNvr:[䷩3U%TɄ2e6'TP%)$t$)7$˜Q a E )S L&AIJQ*J.GZZizi꽊E\5rl-l`)A)\ǍPm#[2VuU-!5-Wr:>AkL|;v,[ + !SA·{fU|Q[*a#SiEjD2dLI$dI%)$LtRI$$JRI$d$'LdI$.d&N*RI$$I)I$b'LI$:dI$I%)$L$JRI$$IJI$&NS$$IN%)$Lt)I$dI%)$I2tRI$$JRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$NI$$IZBEJRI$骸 OUrtIxb""ҝ$'(5)bHS**AJI1*)Ft)rS%*DiS A: JS S4))FR@*dSS4T7*p*dyQ:1 )tJI/}$))QO%/)&@]jff+@'V12F)ÍC@!$qZu#u&m:TjFAhG譽L0lDǷ$?ZtvqE֭&VK\d4Qƫҩy?zܰ7P̟r ?P^E4D2@F~HzE v dz[Ȩ7^Hn };\O;7R8#t\0CGuGqڌ;OՙlZq' N۩3z:sϨfK^'!5Xװ~if[>۟5d7^)o8?^僙>]-u8l[p(67/.5uVjet3+e,%oVꮋ ;@AG/#'"H0y evbKG'j΢ek\g+sqaay ?b_- -I.{Y g٫ce<JӺv g]:8yHu\QXE3zm<ŃG*&3f1<'.C~;v ZOJ.֭;^AֺCr j{n.o)7w">}ίHvSGv~E0)uqHa׼j-b8G ̒{T>D,jp? R0?d:sgQ=VUg,ԨZ ]e}5VF{w{sQ5YobvY_YjN݈0G9,jZw#5q.c"h`}luZ51tX֌?9Jx|6w>Kw#} (8{ g:%t>kjn>obmX44v*Ú>3豧o-X[05 N90Yho@1aĆOKoF=AꝴeYcèq๿Gz]CYsF#I?i3qXu$ U.n Wz`t?uEh:Fc7"wIQ;E:=B34k۸Ia>uw۾Fȶ$_Cul;IHWQjUx)Xw`8i"dN fz 8ܱPC5{#N->⅏UyJnf%nO+'VE0@'Nv/O܇V[3 75`"+NJ6ϵݫ*NU/vX~`U;WFet(kxE :ELуc }.GX鴎`dZ^K̼C.u`"atE9g KApE4 ]ղ,dY>%sxTF~?w:sr9Wy$cMOd+jkk+m`$*E kH'nf hk0uGuOetu,[񲃜K@%݆߹7Jp=nMkr(Ym]6hƩ9 |0jIUZc2@qY_*1$nzQAdn}m6 ?F,J1@`;(~ԳŨ=ho>Ϡpk5c}ޜ?z5.w ZuA O Z>x 3Eъ=鼧yP.MWbKu%ߘ_Я s$m+6q!kbtuocglAcgyi5_ߥnGH#W5 sk~- cQcfIsKȆ#| {4m`gu.59cſ]?Wc򰱱/sZevDUsj`h`"'w{tl׉"aEZa7 ycO 2␔`/pG6(6*?c!稜x AYV%b4}?zkr܊ C:~`UlOTI` 4WCFKb슚X/?,s"@*<<,Lf>}YX7^2_sQk??f`5;hq(qy~8$ˬ:x%Mg)մaO~}lmG3tصaV `~li~j>$&锊˪niZ0pcc zoJ\tj*)Qos&Gs7VcV]ooг2; S_m_@/e%7SeuGkwh>#ŀ,kWLVu<~W'mfgR$Xv?9fë;v'?{8`uNjݛ^vy'[\5$뺍Lߙ[UPq|psUhǩ>ʕ vۍ_ I$Uk2k,i@5dUAasL8}{{kQgkmvWhV͗T\.*6H~zkX<8T55ڴӯ.mL/#oIiv|=$k+?,w~p.kجgnC-oW [Hu#TDkUv`:]A(hh$E8T!7ے2d9y).8Hr 1..'~_h#B:%^)pNۂ똠xpf-ZzXƣo*Z%TC6N6gK s?*_FP.n>.[oya2oPvZӺyɏfL`KS ?Dɓ3 [#t5uʴOAzF8`xSцk;MsKD&jnDʃq5A3(ѡu'Iր @;&d!Je *ό2thudcX\񵄑k K{GۼÛ&iXwa;t`C CC!{m48U-=V&2]0c{.ٶmGx qݼqXYe³ؠ|/ SEқUk-+ 0[[I(9~+.y;OQ55 k6{q A@9շ:M<;kmG ][хUmEduB`gsJ AZbBYPw*acf2ʇJb E[$zT_Sz:smѓ.)ϷXZ@kv,olxlcrNfK}:Ϝkj9.dpn '16'R4%w+x5ϑp_nLa4Zȟm>iA>Wͤd-BLq@kcthrp5UV+l5wWt\x0a) ӳQX7H r.auܼR+Z5ä:\ w8+S &7Yh`q '.Ulki&\1l΃ҏR. cGo++kh !D]-qDk!d4"ށV!7ڑK7%܂v{k& Tv6V~UFWX=ZĺF4*T{j=PݸvV(5>W1 *BQ.K0 NF{ȸm[8ub6+ﮪ9F\S#fL\rm=k+X@O_,Q^^J^1F-Y5li#XnCwկ4U%tKL \HUlcs?rN +u8X4^%n^T #) zldHy[XO~yh3ʨlaU4N "CiGuL_Znf=WNŇ\g2q-<rSU9s,5>1s{rm_x\;=7]mW\D!g2BcU\5ֱK[[koU9;*WdXӧ",;ag[;w]+/k+yah%:AWlJ=lW $hw7ߌKl7kj2SZG~˦/%W`6:PhִO*ЩڄNĎ7;^c"0#ylatj q0&L.(uSd溾T 8fFii A*bdոfh<ձ~͓4#WU@{O!sYmY"ɒCdm`n2ΰ>+k'F' 坌ryeEfYWG ~`4p'.oi[ ̕UNI'L%)$LxH$$It$I:d$$I'L$$I2t)I$I'I%)$I:I$$I&NJRI$$$I铤$Hԫ**B*Y e ( Z9QjRZi$r \$IK$I$tLxH'IJLL(N$&NH& A%)1HL'I%))LNphRNJ*MVivfXSvH3(#*%%.~^e025Q>i~*J'%2j@)5I IL.SwH2@jM)P %, ̥)Q'TJ )~N )#T4JbSPpIK*MT9F Њ+й)!@NMj-mIK(6>%LVgL* I(r,fmOXȸj$5mD:^&~SWʸuha0}y2Ouk Rc4Akv D:F⢜Вf'I4I\NA3T 2 ` Ĕ)+5+U,)VYzbnXzW2**P)pUy5%VsκIE!4nFk  ͪW?TJ[!`SAzٸ2ݦdϧowcaEYd[IAB3JrŠR2r(B+J\'Q J)I&I$RI$'LI$I$$I&I$$I$I$:dI$$$I&)AJI$$I)I$II(I$$IN$)$LH$I')$$I'LI$I$$II$I$IJI$$I)I$I$JRI$I$I$:dI$IJI$:JRI$I$I'I2tI$V$j%)$Who>[%E4$pA+d1)Fj+ZqPqIC.L)Jʉt.Q )mLBJfQܜJ2TJiRM )N(LRRB%JTa1 N I,:)Q)4$ӨyLxHI)M)҄%/ $$$RҒIp$Lʔ&JI&O $):d)EK'M.LI$HI)I$7W_غ72~F\co$)ZøRg.Qbh ZZO18奺GY;6ᮞ jH}>AHa`˫Dj2n5hy C~X[(ʻ :m(ٸp`Uz[kƾ,';}g$69\Ώcov%䍄x=U 66AYN=F{9~]a^4 IܬYxhhuDۤxEףgfo|T3sv3s}B,5<'D! ,ed;>sܴClemԭy-a'uˇO4prP $>ַ8 .[:\T-#oVlwzXZG{3 ݈Xٽ-drDYG'܊r̲ӫS2qQA|^SU7`#]*Cm n01120R }r&@:Xx`g歋hhcA*lB;+pNWNOY.d/l@Q94~.Oge{. 9歾omsom9T\4XTWPđkEtZՒx#DG{ZA!8ˡuNxh o. 6tm<6k%aeFc{V׏2m6 $jՉzsolA!u9"ٿFhie>uq1u&) "8xUT[ qUͿ`Qtˣ,MmЁYK\bD0lM,i䐡}Z|QۗW:9dC|Z;Tk3vZ=#mm~B#qV~WW<ħk#̬݉\&Z*a>3e~IovLefu,ư4Ŗ?ly+s-ssUlG-'Z >OSշV!'NnmѾ<<\:nGp!9rFU |/ck4`7@ZwGէm}*v:ם^{Ų vCq%Bi-! muƚ)1tws3ȧkO1iƗv> d2gc-wؔ6ݵꔱfLDn35.J?4ZKOؑVoRh8*Yg>H}C eB٩r }:'BHk%euz|1췭Z[c[uQX9r]cI;Hf]?K gx hŝE_y-jX>uz76y" jW}fl0CC4'_YUnN$ /dusǺ&?SjZKw=1khn`fHFY?yYW2,9W{eu*X=}gw&-s+wc cB]\{-pLh G6;زE羨+hGuY(Wv&ys7N.ç^lO#g]4Z x7՚E/ߚO4ɮPK_1WȰHTM9 8t3cC 'q]Wmf8҂Gw~j/n`4b;lxiIɬGý >"bb Ьkgt>JXدs%w(ˮ>c` q{ $ZaП[5sn~NF#?(}=?Mq GP_WS;*t 9 ^F}㳍ֱ.pѦA( ʦ}=J]MG{ZIdX܆H$<SMoߒs_̥YǵpEd1M4YlsZm#ѬwBTʫ3h]?GGhIQLn&J|bP.?s[Oyt/'@}?II]2tsHmN=@ݭڙ7uu2HN'&Za[?1\Sͦѹ%9u}b iwn;:M1eqi ,C D#r`_7>_3Oq'&~qin t{=}t]s,9@n Tfkau[&VE . qV_\FFsYxv]vM-m}@9?T-#I{|lS2):}n4HѺ{Zb^oǀ䱈8y1*qM] -ĸ?i`e}Zjq~?.U%p3V*c 1&` P,,74ntKҟoK?D=2k6Nys i8n܅FeT?Ҩ9x}g,Xˮѹit~p:\ub64U<Mu.mE12;o#OՊۋUmvٞVntK\Ƕ.q-ռZl:p|\Q:~hULq^tIBd=,EwUiq}r?uVw|:I@ʱxH'D H]cG$'_JOa;ѹAJ PZr,P"O yqȂX/?{iF.m>jP:µl=T͞ Ɵ5!{G %43 +^O iK2//=;Vԅm _"NEU]NgZc+JU;_˃#'u;OZA-rL }siykC1¬[<O"_doHήƳpU{&{li;)A~v=M rNw ;FΌHk|~B;}EK[e#]h?ofS >gښF zyq(:7Xѵ=k\6/sn4V^m>{.ۡ=?FߓhkZXtttWz3Zq`oZ1GmVFOCo̓`fqA8,e;кrhpA/k֝G,WO`u#گh6ꍃ~qHad]גNL,:&%}AL .;H{*jf:飕k;R{IF"`j_p~Thly%c]#̩z -- .+w#Do%07P&'t?o?p2GwjqeK%U6hq}0ijUL`,. F{}Vl_ٗL[΀y|]P"pUYM5~57sX=BH6ˎ-c6Y׬49jL,ΣclY^dB&eM ۸֕pps5Y{F5PR_>#؀ y[9 hcQK k,{DD?ҐwѣNq{Yy{>]u7KdEu+v\+K:dϯ!JZ\\T@jx47A` 9}[CLKeu4Oo!`ukHǨ O3+unmfFcb6}G̓Ƶ(8Ƣy]wA0 mOޑНM̶ 9]-6ӬOU싄Vv  #<2K *ò.NP{}6L^SR,΍QYYS(=GP/]oCU^NPx*W2Tr~+MJv=V=-X*wʝ?QV@dfƈ V | wjU,.]chnZtHQC|hd`]TJ֚q T > RZ3V=FFpz1>*,3[wJu"eb0sMvKl]Ժ${'=ς~)<;2P#U1OG^ǥo:vK|Jh*Ye/.3ʪ?R9Yy]h08kVXBd,Ic_8Y>z[r}a|Ň$>Lwȩ m:(YDiܬWfTbnʳ^n6c%*DPY #:}> +cs$/3ո:_oG#TָIWk]S$.@ؒw?k-5e&4@*?Lʮ>Ec+"lr'+k[u'Ԭ cVY4p=*l\cwލתv=Ѥ,:=ҭbفn(gޠVpЭT0@u?Drh>mV/cqԭˊbeFڐ_DeГAwm<Ɨ$(%"E\/Wc}?we}u`w 2GMs b?V i V[ $!~co! 7,٣G#ȵhHOޕU $Ħ"lh/}\InSiVǔ5>,=[S(Yq='2OWKѱijh'@ھ5+mp ԳX h:PYp:y'0$kk]ZxXlݵ>_IB .Ue u~qAYYpKfL22suÈuܺōNblI' NI$&NBI$I$I$2tI$I%)$I$IJI$ I$I$I&N<$$II I#R4颫JԒC*nP(v1҂RC&feJRK g P$$I IN:)$%)$"(LJRd2oI(IJJSJRR R )ED䨕6POdR", 'j")$(u2nʣDz(uj:#H(㲉E90I,vS)Ĕ4'M))HR1NS$4.qeWPx3kYv=a{J_!*8KUІVQB%I1D(n. %d2@TQ)!I$$&IJI$L2JRI$I$I$:I)I$$I I&N*RI$$IJI$$2JRI$dB RI$2t%)$Lt)I$dJRI$ɓI(2JRI$$2JRI$$IJI$$I)I$II&I$RI$I$I2IIJI$$I)I$I$IRI$I$I'I2tI$IJI$TPQkIJI$8xW[/ QB()%b⦠AAHPQ p]KSnR)vM4М))yFBLRS9N NaFI)ryQ:M EE%. r&#bJyQN D'LRS)JS'M BtIJ$mI:I)Rd'R4 &!(UOXYI?*⩘R{|PzOֿqW$O GAp kۼ ¼li>  T[q?ʨj5e;k{Gc5tj.l}Z#Pv)M $Ϛ/pG{Z8[gGr>?Sq$`?G. Q7OF.={Ai\LS 4%KuAygb1:@6FcgC GU9-:K^vGB7Z,W10\|WG@x)edzLg"Q (qȺl`uZrZN䪹V\H|?%[^^֎8EDӐ ;I]]ݎEʢ&'JJft"usGZ/p#]JupaDIVFv0`@<6grpkD]p|+ޤjI$j\#$xV8z]ͮ J37Z> xN=u >_\BEk;*- g̟Y-dSQw[czs0DvI߁Ckb -:GE=ϔZZ{6׀jc:cfGeɖWZ-lCuSkFc]U3mYj{텮g> +7nKfe# [ >'H\np yP]8Q]kuܖNQ;{b~^^m9߽ޡv;pݻD+ɩ7[n <ƿ.1rA{u 1ex\ܦk;8C1'F5ךuO2yG 30d hieuAQDcG>̧TˋhIPNbo?KVQ^p;DT FPC<Ւ*zr3T_(Zt4vIVad2I1$r55}&am2[1nYV[C_gwU%͙߿On7>K*Mϸ:=ES.8О l…1 7uUUB.[zgt7# [.)LvRE*DqX>m,< Ӌf:ǂl3ԬOMY~'>gSmḋ4NXpnfua.̖wY㵇_֯պ2&O"қ/.fj\?c}ka[2cs_X0ǕUA]4 &+w۫cVO8O$5Ike]&7к=aV۶m8/#fNK݄aqh<>bWk}v1Z](ܪ}RKGmB~`DFث J>jk}q/ƺHu-yUoβb%yY 6XM^ 8lߠjGO^+6ӡhC:QgOoIN4 c>M;YdV1ןpO?}73W9ԳCo<[iG$v$F1j(ju,lΣ^zwSg [!Qb ǰ[cf [nu?B\I  i$Fԉy[qkD6{N,z7he:ij!}M2K>_6}_wj <\2YSs?su?!YH i\Z3ӆZ.{IFwK Dl 5)ZKd?'96[Y$~qZo:V%u5#c{>Օ^usǀ ;촆 :om q{Г+gvL@<oθmAZϹshgf:mT49źv sl{*Yc<9ч{i-ʘa6C.?+Mf}?jau$ˇ3Ħ>KwCyуI5s}?߾} y'ݫk˻SDx4~zX%>Jjԯh##*e`"Ǹ;-^j]ꟳlԩsY17ݐMYLԋZT),=[obֳMn̖ՍcH Ld7At}~_.y&`Ljm屙[rqw8Ci4l_G]xmeGW˯o?sWk4Y kXO $)bl{f|E7K98AdgZqjr'+30z'S{69,ܡ?/5ENsCq)x9d^t0QS?OV/MbdvנC>r;x)mZHש' lq@Hq ;;'W_f,Crƭx6/&Yp|RSu`d6"%&Dp1I59k$za??T](6M`.H!.ڝ56}V#Ȩ5G#F![ >~R&QGWGQAC3po-I9uB[۶ƍk^*ݸu3bѱGk ^5aYqTdbkk_u.Էx nZV?V.&?S# T ]C :۱-DU2CW)>ͧ~z?g׍MƬcϲleZ#Ԩ"Zֶ\Q[ɫgGrxs?4hʯ~\ Ex_H59aPѓsCX=GF .Yh%˃.sj3ɞ4ȡ2%xi@sF~Ym}W^Gq:7cVr@cvӱA6j壒n" ~~ lepAc[[W҆Tخ :ƒOP4;Y< X;FDNh֮Vm@:{mgڳ}7A ڳ3#p(5aN}5XjېЩd!S2 #.-nY̱ƿ^:eu`&CNamپև77W\Oiub;Mg4QUQ :t(2 _X=@` u6knܫk/MkD| n9ltX.Tw$z@4m^v:?,W-6{clri=8<| ]=SRkk0~?  YclmlOk72ёP4|قkѠu}T맨\[{,iw\^`.ٮyY[)8h -eSm64(c݉s,%hVx i/v]_e< ^#4+wU2 ʷqX3?2=T{u>QjEiiAxa 2%S&kKZ`Pl2J{|7!Pa)(OR|Ss׾eX }zm13 }7>GPVwy`6Aa$S..#IFo,.84UlfCY%zk ^|%] }U,i='l Û!Чq%ĴDy(a96䟿MzuOe6Ym;=87nqB< 2RÐGJU,㵲 nkp`j4OS2RO4hZ%sE=V&<u_nIѷrq }J]`=ye4rDYh]Z=Nl!s:[jݿdU68;ia!ܕM&V7ąn>yJ..6D n5Μ+UUc n5K7?vYi1U#s ƢcD7 -Z;:Y;N.E d7ia_av}'$ӭɭhԅ{^3{y[VC0ﯹ>!oQݣHُ4vTV9+\\WO(5 |^cC/t+WhpV>!1ZxT2[ §fY .ɲ (x,N O]-]zOl7,s @lPGh]]ZeQ*u*[˜wRiyK&KI쓮SWQ ʊo "`&8[ݻثk~o@=Ռl`q([pUhÇ2׷˿H_X2<ɗy.͑ .$NwTn , ݯ%Ƹ`ΙYN1|)cZ vQe)KZI6ھ$G/mhUٵ>hxC۰*y]rجAY%|UKEQtKPLR(60~b㼽x[7kZ# fDbGes6\2 ާ%G+s]xUhh#d4s^6[NԺ. 3.=Y.հFYXk*E8l*^)YU#Bٌgc\A?gcc`0ϬMM{HC>ef<_*gf@gq<+VW_ugUQۯ@vD>T~Z"ׁӯVǿkJϔ׼v\"kSчikۡۺ1]Ew'Us5\%h KLS$I$I I$N'AJI$I:dI$2pI'I$)I$I$JRI$:d)I$IIJI$I$RI$:dI$5*UiV.P*nP(Wx YHd%+5+MUjVI`#9HH)'$%)"SJE(NP )dI1)IxIrSBtNR4Jb$JRRSJ` SwI+T )F-Oz;2e:ci䟚[ӕqx0R/&qOKG(Py].?RAC (dZD ]V3#|mOEy5q*]uֶA{w85a !}N%HGw.=?@~+Ƨ|'UpsٵBħc6I?(z4%g&d5>=]QάQX5&o }5IL1,R?cW Nux91q.}Y.~bç?*Yr-xcb=(=1<}w]oI#+M%4B1̛=<(gTmyFZ[ HT4h${c}zmh<U][/eo$:L>zYe9vzc~A7Ao +U~ow~l*|&ftYKb쇗~wO`K]"\LoJ&k<2?nc:Q\xoOWzwQ7;ӰC^iwXm6M&Zӡ[xȤ<}"$y8)e32J+.!:zK6Ve].m/;L~lSY"=Ѭ%rֱY%0wyXgS I5z+36:`GJc>ks 6-4p#Gy~ǴY[I ;Bh+hsI>K3әkO&P9OVòT:8{>78`ÿ.Y9fⷣ{>[6#w5=*1Ǐt *o_MZ:X꯼^󿲴~c.iX>12;KF}7ڮB$5ZxPc㢏IլNq?$jRcc N+O)Դn:lt|&>[y[ `h|U_,`<[i?rq)Mlv:k/8i6IoO,\._W{3Km.ȞP nn˝X6t0yt@H\}^RunS/ 쿊tm[ןS洉N˩̈,8\&^nF{ kNWpE-{k` Y}uMDu_DWlX @5 q WmWZZWziy» OF_jh.,NiYKI T/oh<9UzO;$dWŚ<?*+I\u ֻĺxF<ȩ :}p0::vi CND|=O1􃶪~Ż'լ4MՌ?IՑ+){J:QiZ] 1w13Rv0SȢ]]xk]bI?nƊ4':1^?nwy\kq3q71ہomFfQޏP4FG[aH`h"Z]&?sXiaPY~rcZڛk>+gnkgMV-ov>9F[lm3>6043mVV~p~\՟C:Sca C4u|ũSnadV,ǟ9'tSCᤂ쳺n9}$re5LB)pm$C'˅O2 p G̴Vɘ/6}~*Sz: rIpMg_6V@&TghNa(Aطtiq5X-c ѭ]h<#sbwPѬmg[]Jpk~W+mM- ײkj=?!Léu*:m&ߘ\9ihK6 d~Ϩ>fC\'??pK~)-m-߬,V=uIl9F w lq&\DJw뫓-0?Hho+_W(=ދZF F-ޝԮ)715}"tz;:R=Wwp߁AT| }n FJdo^엌v *"V;Z]Nne9e>4hW3M.qSrP= ~b9ΥwҴMDÑs_O/kȖ@&o+gn^%w;07ղխ^"omGƩ]6@3`~Iԝ[m\tjL"_ k~?TlOp4t[U mhTkFxXrL~nW2h yMk1s8ٹNU继`;Mkcxu->OOp+:i覭Zv+p.C@?ٵ %8/ rJNWgrOwjEess< GlU\LO˩h w[{ֳH#Ynl5zc* T=8~1CD(nRˁ{=FT#ٖ9YǴU:}};g-xFG@ jcrE|VucQwެN5lwt!\Z9"ti ?ijn;\` t)]Nh*y^ƻW42]5r:[*$Z?om6%.~Uףs;XCqQ{<ߟAkt_ ;[RȬHiT1m=i+Xm caC'~I@k}C l`< ZE>>[T:u TcPc&uIclG*/!zYݧA3"ddY$ 5B=rwrA }Ohemhx=ULVFLJ'*h >he3UkgM^+q.Vꟕ#CcI&13~K-uD-> |a":B&d*5t[XoQK(c?@#i$X"\`/QK.Xp.&?~w-nQlc)[73VpU5V"w:Odu9 Đ,f3t ; ;Mcci"ȶnk͙NkkhaSA\|> 3[mXǐ?[,Y 6 6*S]aiRϭaw%+Ej l7B2 {+ŷG)(wI;E?gD[zXh.o:+{J wpeQ°mc* ֈ6Qy2ńvU44ˇ 2ZC:~M,aIh $@>lMQ[J2ABx1S@(wlumkϘ~cL9:~1B͡][tћnWOv].4O_'!Q`:#6^h7G/59;npGp924C`6ʭM{j~ {pƨ"$xJN{O+Fӡ(jnCy5?+ZԱْḝ=Kٙ_I6 uժ U+y-`hܴ;?p+| n;2{C߸| sp]B:EB4?Iajd@~)ȇ&Ôϵhs %<>i<z~;=z6P7:2 :'$Xۯhߎ#s#}˝» ӗѠYqᵇīOhp< (=Lm x/7^I5Ϧ[mx0\̑TIcإSK Cy}ի\_E%G4G/ɋ-M2jv] o:CKqH09O*..s;K jTR ݭ# FuiAeU9ć7(W*/pԝT˷ AB:.LޛVkG;-nmhɨ[!k\W >'׺k~aus{]&Ƒ6r1ppK >6vb]F7;$ytm.Tr2v;\D5V.ytQfS]InQ֪q_h:<|31MotUӾ=G5:WQhax"t ,2~@}$|Qw#d{ s[#y>]hy2U^!H Mfe~ڂt- Eȝ%r؏%ԒTɏ%pXc;,7H{)mUhëH >k*sU{X=3Yud[18 j|Y:e5Z b-elLxOZzN#yDc7I4/F<>!7͏;XK3i;);ĭ ffT>qK \w*=G.gI}nC4fo[X Ǯ{wdG`^gH8"@T豛!dl]kZ4C@pHvpOWro\րcQ+rYcw\sg[ka, Գ34hW{ݲaf]V8BRւC׷'{4qϒ1ltݦ\ lUWs {: o\{C+ݙqN?T 6G :cus>KI֋Zqm[^H -W2 BF+8_Ix ]" (A!cXE. mt\=쬍6yqR~)iWx1)$Y䇑Z{vZ|\cKLB}ﱦA*s-Zϋ[Rz~gq~&S3sظ?- ~67$|41,x[h6EYeY9J%"NN(la;&_\~ʁ3uӬ0鱡R=aVm{ K1~;@W5?5Zt[5FU\l UٸKx@ kr{*C'$ٌݬ'qt OTc:>alD%wqyY'w'RP2l4ps=׼D݈ tw*%/2}sD>9˝H#~.LkWiMM~7Kŧ[6{HW>k* Se&l:xt%ЕŽOk+n5%t sAC4CUSϷ؞HO_+q<!6^Ojd hqHcP,@ә2%{/NhIܫC\O +8J6c җ)"l j.tpR0#yʝ?!ĸ軧Wcwpc5ƭtT!^m1E'LL!ֿꔂZ>\amQ\{A!uk78C+ v< ! 7ݱme"])cK0 >)w;pB 0RCl_w/hHGH6c̏a0{#'U!4Ot`<ב> n0EҺAav:Bos_|nc )HDG .ϩ8w8 xZX4ki< fz^?v(+s#\ t{"YC0Ϙ\Rw&&R4c] C> 鸸ݑGBVٻINavw=p;Oϩ۞ᦿWD1 dԾOBBOgӀ%)<,}Kf9sLZ\V~`>f=e KYWb.'D㟊m1:!'LO\mvZZUy:S&iݓT8RJ*mJFzp%:xO )bSh>%/)68rR1r@% 8QܑxILe1Sږ-pP˒KS(j[e-;z)Զ#iJ[Q/Q$؛V6'حzm!RcD̫ޟoMh"xYުXrFjV<v&G)dn`ŀ1=! 1RcqE6zV<|X<) <E?EC)zRK9J脽@U]/]*S@TRUD%諛[uL^*SK228W}ފ1r/O뤦db_O넔ׄ˜) Sz9J Pz[Rd"SF )qbcb[ [};)o;T=[E%3 0hcp<RORTvUBYH=>)JUSJ^ukhM%R]oBUvT_@#1$V?DCx%ZF®H\%a*QU*U%0a%[n8S+FD @ލ*bHS<( bpmTDRE[H:1DV[@ zJǞT Аjor-*Asq)BP7'ܒA> B)vKrJG>8J$6j[T<+ ef;*m$U:VW}o5OƅPp CVtd&P`QxD%jY9*C4xR*SS Rh!VRUf)Zp*l) z )<&! -MKT_A/@P~) 4Rʗ{'JIP7.K꘭ FNȷ[?u,!]5hc;u`ƤJTI(VunFXh=W _ؽOc+c.Xg0|_UU}@ˠ 89.zvn Oʼ6:퇻ufs~ixA1K[Kcm,~W>F4=CȀmNe8lh w :Xd8u\eFcoB/GZC.^.v:}cަǘՊ];zdp|Qz8nUcw)e!0G;nfop/A8kܯc0kH*Iɳjp+9T ~ax A|ڴD÷k='չ/Zq>=?/e4pYqDֻ۫Bjz 4'K^=,ʘ *,!Di0B~9x4|to&ʴ\*㸴{9tMeɐ$nnC>ZςŲaVeūMk@:eS ?g7,A۪2D8vP#G.3*6pUީ_YkFIX6wY1`Ҫvs5V$+g=,ByVKjy) ]<]jLwb?uSK@7ts?L Xuz2C[ mgU4 JuX 9>M&98O Ǩݑ?Kk 678欎[.$zs$DZuFgݎƓ<^HQc ouSE2k lh\/Q¹ƚ_u9w'iY^5-nÃEi~k`>cpcuNlqcL$Se3kcMVzN ϊjƓ-D(6tG*yyK09 Efu޵,s< +=m-k;ʏV~FO+%x͵Zd߬~YU f,VeVݮ0Y*@.<5tWPi>FO d! D}  ׌ƗX .{&3]Hȡ%=>դ3,vp}S}q1n6,f9Gs`sK4E.}"fPxS:/ݺt^,d2G ?&n_lidJ1n^Mlo'D fm{OUZr= Zu'~1cMl7E]W-7;8qY?7>nUml57sgf~UۣwgZ~u[w07U&MŌyp68U& Lv޷Y@˥2!\m ctYGV_O*N#۔܁t+)fPrDys+&c]<`}v+)ދ4R 0&v8ʮ4I:}/n=ya$\A??=Y2z6UYw}w8UPtz#}Pw eſͩh9/PEUFdPjqH;o؉y՚[&4GD4G,ꮠXm#t@5k@+)XͦK[6}'~P]i;8,9W]V@nis3fF+352.nwZla֏nSzS1(8{VMG-n~ee~QWwsM$pd7-G5p4Ťc;o]=1& _RQs-O.K?=ahqGb;ޯ^qsi_ɾ齲yx&H$42cZƞՔ"VGHeXy*= KikWⷩa9:-ke l-HcXx71YԘ請ӯ,$$wV2KZ\cppXx!E>) Ng*\FiÓ݌;Y`v&'T趷 ǓQ?^0A>epp$V=OOa4;w[:˖~w^xY[?DbAOic/,/s5PajV/QcϤùXf k۪ !v;2q;EM Ɔ5gY.EbZ1#Qu}oMSlDiazB#U %1us1q_K 8~YEXTZ~B,r pЪ}MAdLtS j\_;]UKenA0{jo p"Ï)}9>YcE{봘-AZ/elfcT9;ӕQ ҩ_e=tx쩸ﮠ!IX [vUp;T=taf0^@?r#NR^[\@ M ܐwls>NTcC 75Q9 %ÌvQJb ӴYuGw9i$fu^ZHRl4D:lƇ AX{OmhSn;_vl/uCgUTc f`kϵplAECO:r).!#Ϻ >ޝ7&2I% ܋cmVl`Tl?LȬY5<ƁY-0C=i1qz7Q I:ǂ&'2]٨h\I״k`GrA;\{rUS60h$<ܟo?}+HQ<}rw`Lޣܶ$^/- }q d(U{!{[6{H'čP[$yGQ2IQl4jXy,/bd+}[ǝV)\Hvˡaӂ5^b&X yvz#KtZ mu?DfCkxc=nuu4޷[>weM44NTc܏)UXK":u w4Q>iv= k*$o8˽񣀝NBeu P< pRl[x(<',#l|Uf3J[{osityuh>rQŌak%d]tE贒C/ƥ -u>DInq2~yfs]fp?5j4@gX%aVk *s'9O&q '} ?H5NdRohk"@=YP k 3Q[! ~5XC{NH rFzހc?Z#& L-##RuDײS@? Sm\jSFښ:FX:s$IWvCYlkeu׹.?YܦRlP"cNQ$4CcY?y Qm;VǏ8A*,ruIKL $vRiI%/D%M~eK]D 5`QF{mt6C oa!@9"糏t2k:N -o.!YvC)oݹǿN-x/cpPluwDp;jy6Jʋ!j{IGoPs iLrr$#vvlv:{{D$:om-.Ҥ^)hǞgk-61s hߎZpoaI q?°LL* n{%y;.:Kr=Sajee/ RZ2Vs DŽǻp.P_}y:/5l&aeZƽ3Mۋ'CUm7q! QZ<qC~M`k^D;hcS@l2Hӣ[sx:Td>Jn5v9q0LӦ5ێ 9mP=?8G+5p@uV1"sl?Cv;VAS#vs6Je?HH'#w]khuo/HWDYIk'iHq`ez]}B5@ࢺZi'j#Q/1u{G{,$`D eEai,wҒB#IԢF湬W{H{xEIu#]Эtw;eQý8w dCb~OIWKg;(( XG?4+H/_/ic"d Zqi&&^^ Zi 8Y_h>)zE/EXj%rRS_KV!(Zh,XJA%P`hRlFhz,]8%ZmF_T=t4j[Qa(WPBJ;Rڋ-'BJC-RڮKr4JJv%[.Kr_播%ڬKr$G jmĥ(KIL!%=lGOꄔ=mE z%0Oj[Qe6=>BxO(SܐrJI)7$0 P)&TfSRД'Kzm2$- :JFSƊ) mRILBBЖН%?SYK%G)hKhN'Sz rڝ$OTqrI)m)$nN/AJRK64FPIVb^Jǯ)uZINlM%d> IIVb[VpTफDX2J: C0 RyBܔ{}p&!D0)BP-`))% P!riPILa<'Or[%)IKBP$MɥBR% ҅9JTKrJZBJ'H:8P%- BtÓPILa(RЧ4JJZO 'mOIQqIJ&АY<Gj>HuV*r6%L1Pe;tEca$.P&S1zRKO Pg;OtB%@*L u ʛ0ge IJHJ+xMm~E PSL')m&L}y<-QIR^- k3JI)n ¤RJzNHIL)QNKv|) .2N7; L\J)X<$HIJNJRLI)JIRI$&I%)$%)$(Y$$I$$I$dI:dRI$$IJI$I2tI$$I$I$$I$$I:dAJI$I$)I$I'I%)$LI$$I$I)I$I:I)I$dIJI$I$BI$I$I$I%)$I$IJI$I>&JJRI&N*1V&ID'Pe$p)ۻ- :dkZDSJF̾֘Xt (Wc{&n̶uu}_#X=b adQ =<0+)pD4%`ِg\N qžНH B/fUScbT~_4 v&Ja3u.#1#:d)E"%_QӱݽjdR\.|*X+ofdž u l L8MPd.z[da{{~V6.;>>֎%X 7sX kޅKs0CH[InО];Zw4}u ]*T?M X$ܬ[1 % 1tkְ59^,fLνV}kf6P1[a@-Te2KqCpWH0T;:=-9;qCúk1']|}^fg!UŔ)osGcVkkmh,gOzү5HA3zɿyO2{d~fGUQ:#v8A>@I }]oU`=;v'#XtYv3y-?f~ E[ךY!s=Op%"%>oҏ-HY5pՓ>m\駤]AD.!UgtS;hݾl&ĹDZ8&XДY{/pA58MA7rXe=q8blA?+XԤ5oJc5ʵa{Cgj:,^At{;GQPt}%v hc1 ۮ6Rn0D(/5 9$x'ƿ.pX76-Bt+Y5'nu: ݖ^9MiwfӁp5ߝ3 5LzcĆ?JIh&fx@|Jn'?5W4gN\5zGt4NYfԘon/lsq >m,>-Սjȩ`2Ѹ{x*v}6*(c:_֬Nxř-T,i?Ng]".KU:\wnl ъG`3P5FVg_p0[/ hݓf@4`ԓ}S2 nh|OH=zLZ~ [c$kϚNtYD@e"=Vđ݈DANcEE<(d@$IK/HFM_;BVHi)u \wUntXTڛd 8cF`s+a^`ytI_#Q!@?}Sߟ'0Dpu~NڬxfQzoN7/p?SSk8\!ƋG=5 GJ>TwA׺XUHͷ1|6/\X4C>s?\ֿX/5Mre;3Wr1>'ɮG 7: }`|A'Q@ĉ&9k}^\ᶉ÷]+έY/69-E .Po!|P0kJe0UXwc@ m۝4Bcw`T)ůFosiUe\\9E_hx #MF7.dM:D;=f2LjZ_U0݌Z\<'5V7?9Wk2G2mѦ;X04li {[0JomJi5du0ե2+[&g=KeUL,XZHk$dsͱBnbB_z8.O.7QŰSqOO%W,񉡫JWf?Sn!\­3xZ}[#'FGɫXT2~s]Ool \UWYSͧqv1tޚp!j3(h@sv63:bdB1#T?ip,1>)߄+\}" f ^XzcsUa)z?D,:{Y-kK 8ΰ;fg9gr;.tQd_so US1I̩kM d4}O쩹R!¯k*sM5C>J;.?ѠʽG ƍS*{4,ϯayqf˸5[[C ?Nt#On~=p5)lqN^hyUYs~U\A(sq(׿>>!38#PZVƆ)AX2YnfCf8C%-~5ÉG њQ̿Ӥ`ƈ8vs^K*}$ˀ?)u"2FH48\{z6=Ο{[_ޱi~(6lǸ'|§縻@>?EZ}~ `vN&556\l'nzZ#ͿٍC= cOn,1j.}Rn-sUݹ,#AZ1$ ^ qy3a7ԋ$~-qdMIQJx ďM?=߼:_I9& wgj]3zV[t vSc@ѣZdzYe`S%8nȍ!Qc|X7䑱u>Yw$\q5Ӫig]x S:m;IUpQY';u.8-Q=ٖ:YVm7w]: ŀ}/2%xMkNYH}h<75H5J]m;"1kcZK[G-c:LQH߶;lc@G"3;Y'" hW\}Cs']C*Lw3Zr^ژ 5lbẩ&>A %[l GNLkSKͷ=P`O~g+Ve=u.VZ{Ua}D:IiUMOx(3f){YcGoآsG>KraаL\'{{ƞa @N#[5X.ǹ܋+qM?էp{Uz &I<+4bX~:OP<d `cRTZc_mih3-sA)Aj8V Ϣ}9՟)ݷ*nCt.'Qu'dk`5}=k6aifzdE/RFQhn)ąk3S5r/g8A]òCvRYԨ}NSzqGcDݿE-Ϡd`W _[<Sr?FtiEEpI ;efK -p#s v61 )=)R 'E_3ƴ`kyײDX=؎u\GUn}x#{M/֯C~콃UNpMu ͮ%S|*o'$}ml@ Hjۆ??Wjlm=jR]MNycb[ܧl ckGEAߣvL?EC1i קW6Y;ssNȥ\M&sX mޫQJ;#$,/m`^mngO%F$;'^ŨcKýS<folJ6J'٠ "P%yT;֮S;KB[ߗ+dOm~:m9@jt[ZգzuYV2i0L ׹ ?=lrgGRŗqxc"%P-7d1uSA}Ѥ?p'y]"ѭ t<|j>c!.` ]-5{ٔIwS3]<ݪT? .0z q#RyDWkceEfsuw0H5c׳$(-i,/4eYYs?z7ԥѭeIP?EX.'rsZVswp l`we~kg1E[鹰|g#^G ϏVoB.m~Yzgha\웹ĽUuθ639/&+o#í11KpWYu0L g2X 臕߳wW9_WN(' ~@+sN'-E/v#zAM,5'E]MdzmgX1Nq^X [,+wTd5|pYk bB9;r9w7nӲ8-RW0SqC@H֖N"c䟤|W֜ۻMΝڛTEB$b+\&\[wf$h@au|㲭ƚ1X~J>0Ff98V=8j%4d1!;FEc#wz;G¢Se@ llӾ&|J:bb;Xlv\ d#}'#v*0~HXY4{/'SNk=O\gQ `?Y~b:4;A( \ _H505'oF?9OvvL`Gi"*Ϭ F)QO[u`mPsvp-=0 dP&q$8%;X^tH?ic5\!{C%ѣMVI{ vRv@15Pl77+ecDQNrMt fT`r0Sk?Uk8xLwFxCSƃ^4 ,.IQZmmHꥭ~<hTK!fCe駊 ^F@+éCcčU[n<}YM)[ͦ-*4 yتu` |a< V["7d>M5Q,r3!KvRI17?_ v 3I+<ߢ C_3elZ,p=:&ݣid% AVO H- oNK@^\DUcUeoqS^I!]u;q, -$dv lѺ{N&ӰvP+F>"5.&x f;аS`D+7PuԅEc^ Je5w?lh"YZŴMK1,}ŭ=;ܯX:)lV*quӶVdc F&QŠ=Q@9L{c>|tnѠ:OyS}k3).p;6{Ӡ %z,p< 6wR ѹ!U24r.x$ϵÁOSU 6g_%u@Fa۴B#T1hWc#Qf:x1i]Fy-2n4F?aq`hHRkXu2X4;Oݤ &c_jVCZgt5 `u-M9lL*t=mW$Lku72u#U@4حׂA2 we18 31֗8ece5!JGXvO.ӓz(/vU縓:Aܹ%)Dj:E|33OtƐD~ ,hxcBeıkNԪG XeۃwK^*;w8O I 04Yy.`rbq?$e9U K=ىlvD]S'vʕX@E[ eOhc@ۅ2 ]hL M}PcM֝r5RݍO=Wa yo4IV/Ynhc#Z{^e\5ԒS|U&18@(\>IBL >4Uws+o tpM0Ӣ1c_􂃱t@m5uh8CLL~33 ֵ݄H!?857@A 5I=ʅ̱FT>KQ[Pb|n2L粤ܧ;Y$x<gYR Ђ "3H*d!A.2MV4X8xbV%1Z'EMcCBvZ훃Z=uv$G;}ؙ bJז6~NZWY@s ۸FvF=c@{tPrL82xO*f O3$'47j+(,;:⭖8Bس9պZQfMRI$OQ/Q $IO!$I"DRIJI$DDJRU$GS)*ԒI+^))I$^)n)*ԒI+>^>jI$Y?KrI+BҗO%ZД'IZ]oIV% VdeWz[U BtU7O%ZД'IZR]oIV% VTYU$Z+^^>kBP%kMx*IV% V$l EV% Vw^ (N[KIV$-*Q$JVwoQ/Q%[II%dWN,IV$BrILHJ(V˒T\SǺT% ̄!qJSRU]/Y*S(V%$]?!J[Rڍ)=d)JP#Jy@'BJb%z1IKjP)C/P$)P)%")P)J$)iQܒ<% RL!4BP'UM<$JAHPN:J`Fe4N*2RINSʊI)d))JJY4'INR%FSJJZB)%*RRI)JbSQRI$DLT2tt)I$I&NILI!d$I$I$RI$I$$I'LI$RI$I$LI'LI)I$I$JRI$I&IJI$I$I$I)$I$IJI$I2tI(LI)I$I$JRI$I$I$I$$I&NJRI$:IIJI$%͠2{$RIQu*¢Q⴩+BRL\nc[gǫ amc 0ɦK]WZoPkesYY1Xvb}ԬZzaw!_lוʶEMdWce}em\*8be-A.wW}Y\KD)?Jf\IP3 RO))T'O[BpH) |$I %(R$wO! SH~|SBtALJE6GI4.IKrR &W*RB z;pT%Z#R̄*K>)p9O$K'Q*ԥ*|S.9>үo)L1ȣ< {JS⬺k*p [ bwBSzl)RI%"4B<% 9jZ$J*Z6])vOJNG $:I$ OHS'I$a$M);$I$qG]J|RI$R) d$hRg얉$2JWy)<I$#D4BxKI$Ru"HLD$I%/$|'1z㔉$wLJJX8 JctIK)斳%) 'I:JV<0^BhN y[\o 5%8QT$\MUKyGNGN ώ z CNPܔC46%xTz$i-[׿\՘?շԺ?Ys?-۪?ɷ_(Ku,ɳ('E_ScFh~N9p$餒K(V_ʾ<םG>/A8n}3aO8kꪥuN67[UU03CI;Odu rYAsDk8py|G[$oE2bzlhwv6־L:Q G'%1ʏ%jR .1X~wss1qGE_Xa۹Ѳ VNW]?Yqd@Bgc*To.<Kԝ?+4G歂625ߪѩ+Ŗ/ʫ)uLvoTI.,צGl̏CNgVutBu^8<;J!zX{^hFޮL}m SI .Ω† 1JQ  'UECF'o'Q IVip0_U9'#@E2=r2Kxj}],8~]= O}8pe'W~E3.-X9*ktDԳ!ثĝ{YѣUB)Mû' fda OlG!ᶵjͧtk?DiILl;PX,?H>o;O:J4FC!gƛoÒ]U')͸=Y)48#pZ (bд+vkq0ⳣMeiMO\Y;hٸ\z8sC- peaXVdle%QE/>kzMC_a!KI7#fhn7]-ؕgAÚV} < .%"Ir[ *2Xs {jcVj9Vc>?qs7v?ƗT> =qw0 ch c}?VU s?BY/i{c̗vVlm";!ZGq3঑i;[S>=g}c2q}CV]U[baݖr=ӢYy:pۛ&Tev4[`Ӑ2fY;uu~Cd($uRέj(~C&\bG[C1PMڅkHV>93f6é٣Z ]cduCI]λewNnUmcӴ 1 f\5G9} VƳy0{_[2d.|(+zc]6L <.˫[Ҳ;QGOPy?bik=K7aac @P@:HrE: CFiK2'lCǪcM^(r.jc?¥peZ 9let٨ d$ a]`H*:@e{NLT֞ߑ4tqzi:%1Տ!|}Z2isu܋lC2C#'{E{!g|wZߤNd;'~kF |wS/>n>v]Nߔºl$+dez-ty*6|g)kC;~fR5|YCM?W>WU`I'եǨkw}7gOx?ǰVd{>Bmu"Y]CƝ Ah:1S7DkkmV0Kř#"ż3*}j;wmP ސ?X8=Q-wMX$ſoϴۈ1mxc궭{شz{s*$NYW_K1YGPm19 ;UbfH%NͷD9n?/񮍗d\Ya@"QݣZFvQw;"_q^Z~7շ!S{ei oUYf;JaO]4N <w`ZYMN,Fֵ 28k,,Z6Ua 67 tWΔ虦= g7gfbYec{T TBƯ# K'Eqs4՞=ݲ[3 I; ս}mPPk'棙xƩ߼⭸lg}:y"`˅fssh$~8۵]Z  /gտ[z}!ߑf?wrXyhn3cy?9U7ˉ:1&1ˬRjϴ~s?گݔnyq3-k\:qM/F_ȱ/ 217s1C^h/~js'Ʉ`_Nm~M pТٯ;ta5? Dw\g/jˡNtVD=rRs¤7Xi$o;BΪYHY uA-$NW+ЬE:t[ 0, M}4 v'l+AِG3bȶ\ ۜwD8ڷ)G0Zy's ұ՜^3'_mYv+@Pjʱ7~ƪe->]V8c}d)țxjC0w!P1CF&@ *ԇR\&G&Ѵ&mrÓµ7Ց) c髽'$TDS`,}ȍ&9ո{uA\Gu]xps 5r+_ʐЧ7KkЭ5 |"=͡L5f6}=DAqsInוsJR$U {˪2&KjZ@JJ׌ V3[?5ZCOߊm?H~j䚱-oTh;ob U`CH511Ϛ|m4V5-sy;UWONH1NF J*xc橌"b?63pX$u8l7c4=Y[^w:YV \qb']'6Yֺ eN-FNowf4M):Iqn_C3)P5MGGڪb0k k|Va{wn1FwcVak V)TUph~c"!#-Z֭u;,q1w9{[, Ϟ1ZXN_@Ƴ8>(oW Umqc} Un`˨w D?wr")s LWK-1ܻl@OD˂B|T?y24ܮ5q2U =*jN2%|3a:GUT=H [%9vIuEhVV.1(;s6|Vlb!s,d3emml+9]:]a`]ᣆyB#fӢO<2lᱬc@tppTk67QɿͼRҺCq7=NnM}lĸT2@iO`9 IsG(z~UϤ؟It<`cE,ԟ]V X:O"GtޙcScÓmi@Uj\n2IW1 Zo7 ""IGmnvmoZ׋҅ 1ߠMn>CI&{:-OyY O#u\܌{hTiu]-wg7Td֯kh6UYsu-x,΍FN#D{Ki¥Ɩ'o|M i2Tt ~G*)΋%.v5$๋:߹M>V3:MxՌ?;~rVV5/x N+,޲ÓSDW^A$#a@;Slq<__"3J-O;S=DȮ>a5Z~:-Cl5Q ~hOSNmln5"WY{S\Fb39{P@ohT2s^z@ cHY ̴j}l:Vݴ/< \^|V>-1V˼H 5xo^_.>1CcYATѹHtZEǦ6c&V{/S@I]f{[FVzN[\8piyocO rXuο2i1'Z/r^ EKX ʭƹVNwtk+pt"SKAhyT\jK6&KܺQ,PSܡ,4 >=ף]'M x$-mm<J_VGo,T#|4,j#?d@14[5ˤ |+{} :BtϴO<$4u.|yDfU(6eI: oÐ}׶n8ĭۓ]8sd0;\ DЮt|ށ cwVuؤwf/G 5ޟ1e<NfB/݈O<;i%LEmV7G_Nk.bUkzyIO D!h EϼP&B ^+L񯒼:.l pL ۬ik gS %l;@gW"bY e #ugJ`lG< }JhmJٸGh׍V38\lӷIs'xwcmp|Ռdnզ,;k$%+LTNGSo6hA*6=j<;:q":sSvo]?]P(h/w$T뭖\ugO: Cy5KsTAqhx!\5Q<Ĩ.0kl{FH7XCHiL=Ő_`:+.x+VuX{ZnY}8ď&'uC >AR97u|UҤ? ilUkpuibKḛ;결M7]5U-{}d'NqI-4D,opskM̸Mgpht?; {lZKIv Lʈ'RK4Vp鞆1gx䢳 L4he;ȗGVaR`LCT'4\ѷzu@nԘ$#dah&an9d;ykw}Ge_Uȳw {Zc_njC'(m >'Vj6 [{[<̶Ɵk#MT-nC5pd@j.H{H)`EZUYuum/OƵ52 *e$mI$vUYI ݠ'#ѠAQq[vTdF y'Y #};GN:$;67A1mUӢ]i.t0AN9`Gr3i~Rm9D<נ}j%mi7Ǥ}N-ΤVzya0xHGNx;h@WU:[=Եcf$K S v8UقLf>ڣcfىlZ#17鸼YU|DХsuU!MX$m{eO}UNxEOD:B+h +FKa["4CC#Se찐Io*7aK WNۚ024ٰF+=6ޟi`^ ud15F[2A T־lcM$ο(2׼xRԸjrT-j[RRr-^&iE+RPP7܃ BWjO=q(;oLO B fJMT҄S4D9Hҝ0JP '"TKrTIEJ %>Rke7DۂtTKSSZ x"J9dhړVߒXTȂ4]ZIu wjWt@r&x ڌyWdBxFiV@͡SMΙ "/XSUҐ#3|<\  o*KMmr7 xku :xF7x6ZJot%$8L#xUkx5y8B5NVXd#7_Q̎8Z1T!9I$5L!Ɗ:%LJpB`gT'$FR'mH~i8hN*W80$hI:I)}ÂҗmN.()$ JPxKBI$Rr!4-ґLJ^4)ZpȤnCՇzU<8c^ôxy { A?߯jPfUe[W{uX{Q5jv47[[]!.qUKߢߔ\qO &@k]l+<CN?H׃REsXk&'tsI"_~,vof.L kOdFpf$2hh'ߜ*J;H8X~D)n~G1ruZqjOIh(n]Hb%Lՙ n>$i˟.{ήuIی>ƽQgk;}&#TPd.<%]v3v;*]U4Ӓذ"T+inhZ 2ƆtṕAAo`D8e5Vs67g<Ր?V-<\pOj+,9~MU:`}5HVz[\8>[nmMEvɱ7:|W?!IZ%fEb^.oC;ŶΜ-VU@hݪ߲'| nmVO|ig +sv1D9oK'"çp]@s~nJϤyrinmh՛eN29tf<"UTu3uK kwxWگ{D#2Z`c6/(rln(w^H N)m[d>`+ؑп`{w,^O#,qs[fVoBLldCV3?g9̴Q?Xs∎Um eI~y.Clxf+H$kwQnʹ:f?uM6PɼV|ʞ\5#%XJerKTf'h?^NJ6ۇt8V{b:O޲'k~jv }J߯c~13!Z8zn+wI 5i˟²I]!t>VˎI s+9h'Ll6Yw*[+xλS[Os{*n }ϣ.an Z5.OucFSiik S՘M@UY& =ۅ}^d:ƴv*T,,&~kg v=OQ6coQcn+{kTsI+ ?IihHh[f`wHjp=CoQ]밎mn;kAq1 3ӹ%Cx%"ZN=4tkiSqO?p]٫e\=9^[~?V.FuU]s7qӲΘòj+Xg  ~ $6&@ euXpH;%!4 8[Z8toW"<zꏧfT||cM-'6 vE?X T݌ea`ullY./t;t[=KN(t{؏P|i0>w@YU7F>(tkRJYU9临+BǸt_W=m.\S3j w(%e[XcN&sǀY>yv~id}%$~ѵg'FrzmOHc }`qǢ4j}@}DG78TbmL"h?Jͷk^1 cҥszwF+,>.vcV=LSZ?Q;6 *8p뮟S[mmTϳ7GG]Ә'hg]d/Ҳ{@?9GLJsE;]>mN-.o,FWSxo]Ok!V[b:գUZaYkh5{KX}Б] fo vjG+GcBtK5*]Zuc{9~{PX[SuqHs'ŧ:JtlY$ ,\c|oȳF t 0rQ GwB1bUG[{? ZZDmfjҰO kT:q~י ooby&<2cMYǜ̋0@==bsuY?܇ij63Ajxt.*s։!R_R*@LxՇ}68WK-xX wDm^C @=a[ V\NW~m8k9!:#R K݃XI'_.gQAk-XK1칏s1O, ONʷIcZ @Ws< X=C5x^IcSe.O!l@[_}dʭQ~&^tr\FŹOKY^^@)5khϳuȤ}/&ke4Nd}_V?KsΠLnq=!oT"|ީvae,鸻4Uhf[[~hG8eoWv]M25?+UL@6~qGʺ9OBn]eo@x;&OQxq֢| ůe~0ѫ9)l_[q}i8ׅY`-xyV R - v3@tx L}/"5 ?us?X][ڤ6gw?ZUN2XO;jԉȸ5U8\X0k4Rn;Dc?EXyWZ|Y8,u0=1E ۧ6ІQ emر˚G n|8W &<\}Juūj4Hlkɯo##K 7y$juFn0"l Qh0v5m>Rv,,;1X#:Wα 4hh˩dƶ˜[܆c_1?uINwIѕ[Hx6-~㖛WE.5:@Tszq~;Ə~w?,`6?ze\<5:*54ْ8CZ#Tz72c\&0U|YHAVXY^\LA< #2B*ki-u iTV}9?˝^!g{Lr,cvhv՚~{,h}u?mimc]K15?V|<%cYtU,|҂i#lpnܐ&;9S~^;C  ҶH͘)?"$oeݠ!Tɮ_ke%^@*1[jƶ7`x-^NpsL{wێ+溷<OV 5<̖q1 A BW) ($K'TKѡT!-k<G*dU잘k,~}7`-Ѣ]9.>tʷN;G9Y6 ` HH441ů J XT6tp?}O3{*liʨqK[{ Z0[?5F͏ 䂚+GaW:ܲxWL46*6V5OsFlFAlqG.*ޭ{^N kӿکӘ YZF4 dƲ%! ӷv^Ip. N^M`  \8T[5ӊQ;Uii}աԲ<۩>tl{? nPЭ}q4T֝ZsX~׋oQSm ;Aqůl4\Jôy%NEl5iYʢ {WjT馱^0$4יhƗ HDI0m ."#"aVFZHƼeV x_GyT:5kS+藑oH{-\%de;C^uQ6@%sN ]M/,V#C7Ƨ_;輶ݐ{I :Ys`g$!tw]dՏԮSLJzmEXgULb6%Tc5t\Uf㱧tZ䲶;iϟLCA(9c73מ 74ؒ4z;W: V.+,ymG+4=~^orVffi"¢#`Hb6KO))rKO݊1d%;RƎ,{oc@GEm ikuC>>8h 450a> w#@pHPɪ_tā [n"' *`xPh˴ fUΆ%+km% e > S; n"*qbv?r;r,-ǒ}{Z{q03;;3O*=iN,$OUc` Ā#UVcjhкgp' >jO8L ȭZiݱhwXh5?_ic-v+z_5Nk\:_şvYZw4J. kK:*6j(p$12\]n\rVI-xuw?V9 ,Wsi^Aq`>^ kyBgY+n-2<5&O c.l=X Ioyx$dRn.dj]E04eG4!ǎE A_$l>Ԭǥ5k܆Z..:N҂ۻpk\CRG#D8;̩;]A4 7TŌ#l vE+u蕔>m-`px:k(Oy6dˑMZڛppUFN`nծ1 ޗGẔaIjId43O\Hqp.8A5ݙlZg5L>+lh w:(czqpCڬKLzs&%Chc#4@&Ɲ0#7%;DkKeiu+gh | WH/$5PlLjBaeې+eh-p$̅A$gTqew29|!YtAo='qInRpeٶZ:s,imԍ#="3%W0ָi'RZeY tǸ%;37ctQMY٘8sN|AsGpn=qB8Oߜ45ǒyLv:7:ZO]hGѮ%^=$"Um2Ր㴴}V\o#weLXT'\ v"m=*{I5)ϭq@M8zlϵәZևrHJA044ikk[#h9 CAxD-PFus Pn8A {~sގYkC[$#ݺ,?yҙdJnG-wb> %Cw-k1?Ati؍JmAl>O$k}nq"!LK} ,`&yWYc.ay rMɭOӢ]ЏUK`-rfJYM{ WZlZ~.e"[,:4YobuwӬF[yd/_Z{O-U0>+ʤ@0F8DeGۨҴk-έb&h&?Ն8aϜ%RJM$I=jI$I%)$N:I)I$I$JRI$$$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$%)$LI$$I$tI2I$I$IRI$'IJI$L$I2IIJI$I$RI$'I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$JI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$dI%)$I$IJI$I$RI$)I$I)JRI%)$O)$RI$I%)$RܖRI%-nQI%)$RܖRI%-nQI%)$SܖRI%=nPRI%=nPI%)$Sܖ I%)$Dܖ9JRRI$MnC%)$Dܖ9JRRI$MnPҒI"Kr))I$$J* I*VP|z7 $TKmjI+ҏ遢p/B};1t$bPScw\xZ޷Zpfs-K^ 6xlșX薃ע݆N!"g gUzz蟲gaB~ԾҹAOUv:ELhV6"t#))KW=ߗqRUvz]Tl4'tzӘ]ZW>#RUs>V[䷽p)|RM}Wa/=z qÄYx-T%ꅄ:Hu"߳7ߟ;}?Ն:?"UƧ.Vjp h{͊O޶d,q'§M+?U05Qwv^+X@wKO$SK(gZ MCuGO>Ʌj lWn G@!a!;恪#xT⳧%L~ t][R9mX1X*yc,Ht{W[5GLtgC hE{ed 4R %§oK<7D=S4LBv5mjAK|FJyϲ;15> ~08U݇`<+'Bۛ,Jy1Q'U'(s A$WZ-T(V; .Ee:L#]e>!.F1iY19]&M2 EǦ$jod0-)4)Ԓ 1("KM 5{d>h<y H@S !.5` ߡ}B B6yB#xJ$nB PJK-ZFJM/PTP BJl@.!6J(IM>@ޖ3xSڒzoKԅM!2JN^xAOJ(IIwwL^ B% )8xQJDKtBP RpB[wJAGJDJP h)E(RKG H([̅ Zh!I%/dL)hBp@Ob[BJmoUwJy2(SږԔ%-V.KtBP-)&\8*0ovApoA?%lz*"SsT$JI/(Vuk 6;_\OAqb}La#ܦ`凨u"֖誁lmXБpU;:sE6R5E-ku6'иxvakmMρXkʖ;Gv(mfhcSȴn3J~>#E}{}) #bcmpYMV\.;^Z<*NaZ"Kc4ÄrI .3,~}G>ma?euϹ;pyX_Xܪ,0|>텏V'e=m[`nʿ uYIeng vgOymv쑺 h66˝?tZ1@OȋՄ 6|]B Ы ֞ʜaYe*>_,KZ>6T"j l&Qyc ,NPUZ2zwuc5%·txYPO+A 'CüW>p C|ſkSDi xSatVKH;ʑېݎ&Ũj_ W2{ 9g3*fnT , hSx7sqTmb㹼^dG_K-(ӆ2 Owab^ Չ9^kkPMlm74ѻbh+.7x'j^U| ԯoZ'oKf$|u2PY`$14Iv?kM>#?36S &v'G^Cq go!WgI*Z\>Ʃcr2a8#_O2hhu\@[&Zq׹4#*|30F<'zlFuz6F`,@J:ȯ4 -H_[l1G;11ŽJZ7T5{ز/շQ {qKtz{mv=g]K5k> 6P:s=c<< kp'ԬSicC}PCwAF4^}Ph7T1s<9[1#?'=41 pÖ(w Li{!O2nDkA1GbJNC]*׳_OUNܛ ^T}#\qs 'B Z{V^Yf EeuxQ']77 P a`m*\m>ÇL17m hG.N>᧿t;h5OA.;EXMozn~e{ZOr R3YzιdFW\pJƲ̊hVuV0>2lתo9s0?AdTN$5it,hi%kybmI[5\OktbtM"2=yht-+xwSu{c!% 6ǘD+/u !f΀j2?wl{#Aǀ11DaՁh}p\L]_MlݰqC-ڟۄBai*)4ai^Wٲ @#U,ad%׊z֋1']|s^kFOrU[qnm r[dk_)ySU ]+7eO 5+gu"m+/mw yZ6*=!̀ OXi~ڛ:UGo! ޥAhto䊟Atm_Ef]FX#~!va]8UԭY{UtB֩&`D`HcXkKOaKq6gUYK&ǝS1ΚZO ]:0+sQ۝5K1Vkt;dz>6vs>ۖK[1OVc3#h=:e^x͕pyn 7oP0up;g]1վhj9Gpq}će=sxZ`o ICX (cll'/d[zI{G' '5ؖQqSh\[mw q Rhh].Iַױ|{YEgȖ1 8h;6J8Eq7"TX3)n4^րֆ#V=8~A_*a;r1L@WRs$4V;9@ϴ!vrFE?<4GSneCaV-[~+a赊zu|9+xcc4O}P2,4 hFQ'G:)4 xC[Ss `vkcn"\]?9r>kwѭ,ne X0'`?-U:g82vEjaiw6@[@We۫+:7>1 Tؓv2!;s7_c$)s`ѱ&-n/?.n7NgWnfx2Aq>m=,{#%zj &T{]' ivGVΤ2?%P`)$5My7uL=R ʄA;F]M,kA`w4QceΡZHA^ޤCw NK9NխcӴju.S~LK~Jͪa<[~5VƃBhtw.G_ r 8?JNcv 7>t$7% l5wH:ow;Zwk7|ָָy{UNmesr_,vz-`sp EA2NDKTRppTv{A}IhʝxQ+fۏ63ss{VK7O ou'OzcA܅͟a"{ b$8dH[WIX)oq1V3?'&J kwnwEj=h9oXUd1o t0]jjJxI=ׂ:-oko˕C8^isꩲ[e} LBٚ ՙ"Є0DNd%l긖ݝIXـCH+c>T׊LT,T%"7mj'a!7!ӤjlQeދm ,;b~boxʻdUSIBh'PrD*vKFջsd¦3'_l5oQ"3vK~J 1x1us/9])=T.Ѵ/V:sS,kL : lL5wJ>id׹CcCU&% c%o1`D%g=L:IU .k%eVǰ_X̹4wFY7 ƻ Dpqݖ@-_PsNC}ԀxUqv;Fj2khf{*G E`{l-G7&GM`TXYKd(qLGP/%]H4/]3(coGvN9s=Bj vܒ'N ["A}#aG[G&P" Im.^G=sUi&ǫ3)|h(%n..Q[hk>0;cJck:/k1 NAuac$Mt#p.'׍]7oغHm'OgJó#$m%Gкt{f!Vۜݻ@o`?#@ VhDrk=Xo=)tdopǫWB<ubfNEЙV="MDO(3T\fDƜ. bpi䬓ֲ=Aޫ^X}nTq1Ǖsn>_j;k:f|@Ih6}aiiр0?҇VanE$+o7U |,ngb2jݒ/-{yvUl&CwwXlvh$;,:79 ڳxv͎TMzuVݯ(`c꫕ >vFa map{uh$pqp'j7μ=ꦺ`y#2;ךZOYF7 iY1=:OK-}HΓ <լ|y-o (e3cVn*yطY4 DW#i<ɱF7F]o'o}gw]u8C+3)m >eT'"2ҍkǵqG1g|BSwMGOY@z%q- u)D6^/}ETٜAe4Օo$4x{Z.鸠Ay~hd))n]Fwb\-)Cacu\v+ uቄFߣ%u7Pi7WFv=ͺ!۽W6iڏO#)i#+8lnv[~fZ}(@KUGxl;ի ì;~*Ma㵕~躶@-㽵f8 Iaç*`U5'MӢ亗N5 n,[zQq: <~SIpZͧ AbA-F$OuC}\=:c΋/kjMW~]o#p#ZesLITqN,k7Hةg.:?ӬưcHY:%uc4Gm|Ua-L+_20;*˳^baI?&+C텕)'9?Ud#tLz`h쭴3ER,,8;.2 D& )}v6f^meGdG7JMxL+/\l=B=׀rݣZ**ϰGh7D`DG Ƴmt;U8{cvڋ.*v;,-И>i$7IHVuiwees\r8?u5nuuGsM$.1:i!^c+ 2id2t AI&djգא7N񼳿n1 @ve0~@Ze]ʰ5Zv2eg{} ɲ$h49tV2Iu-:HR>H+;7;fp;|tLvw{{GiiiWBx}Nn-;ZQz[`ZjCL}d]{k~j8aWT0Y#ˬb<= >Q$NNg0[[qU9ĝijNm`H3[5gA(9jL|r{v@۶{J!!$=9Љ وjM-"G ;#+s/ 4Tc/Ks` ;YZ4 (A5k[ji$8׏g+>lDZ͂CxXnNGґU- 4Ϯt KEwvEU J^g+c,s:rN=p6I8͟keӹW2; Ѯ- a%CH+)^Fx7\;14p8Us!Đ;ꬹ݇~.-w?CxL鸄m:Rf%X%$u뭐oC}2CU;2sKၠ< mJw V+hqLƉW|C9pv@Ƞ5LLf-1\]fSi1ZֆÓj}po:;Y\ljq}Ek=F4m;Hhe.w@Ei1gH_uԪ:ڇQ.E#_zc` f+l0eE;\[I`;\yOV\hNX 兞CvU{ @D!ٻ"Q[Xi g@O77ekc"N\={=оs5I?5^]6mNܦ 8 IB;\v wֻ}'let x.mֳM9OTMvӽȵVut?d>0R(n?y.S-