gExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:32:05 6 &.(6)HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ƖD*^?t&7%KzlМV ӡjXT@5\Dާܽ3=K{ݳll]UڟUk z8fIY]op6{: 5 7 i#e =6~\WzwLY`k /wnRas\Kwp.*&HLXPFpi> D?2f[ ZBJk]SSpFRs#I?ʒ7O) ~"&?iM 8%2I&%1IJ\rXUxk\'07}b5 l/|JD{*9W꾊sOڵWiڂLTQR'ЈZ})~T9SۛhC[wHf5qI>*`;ܑKhe_>x!9@9`( C"Hmu{ָL.ivAh%FL|$ְߌ?"!V+eߐSINcM]Z^'Xw1dm8+oZui[Ps@1'z~n[ߖ_[Q"odX[0Gd[WǠ0~QJ>n-ciYF;=ǔGֵ2غY|oWw~+~o{R}8 ?}kllUZZ?b=&GΤ~ '?=ee}up4VֲIKX SIHbR-u$UOc+euOS:mzwWa;cGfߦ}nܒ~/S8=;7_u_lX+s+R?NOEjAnuHmz̚w9p .2{}$vR*di<ȗTy7nw%U}V\yй+YNc6IK8PX=M nXsI>C\m-߂Jn$bliPg@ȵ;X]Ƴ{=jø˘bdC]VEC7OclG΄=4kbL} ׶)ddៗHg1 -S;yvY&7 CwFev쩥 qrwۉkodŠViN1im -.([a-?[k 31Z[KIƀ$& >/dCG<<I7RǸvU>,.c]6Voc7=&ԹS[T{kk_^jkwӫ2lے2.0]}yQ3~bf]kl¶ƛ_$^[56k0 ,:VfgIĮ]ǝ{6VK\Eޭn؁O׵u5{#KzΨKE{vQ:K?}C!4=C׃nj\ ;J%eTCo}jO$-p?AZ65u%;Uxߕ_V~v)8轏˙ 1P|(dqm6ifΫLPz,sO+\nq o 7=.'` c[͍o? Cꪷ< ^<5H|ڞy26^ci hpVljh.cԄ,t󘡷`iǨ?ZN?-?v4{ip#>5$Of]}ԹΩ8֍7{Ů6TK^cӳm o#a?ɗj7lty6Xݍ—;|V\`Ws" ƙn3[65[v7Ppk!F'7mQ'ǸT{?O"&0 =ZQ9mXN-A:΂N5*ؿl{A.xcC~v}B2ng.cl:hEԾ嚬5F=m[W@{OM}yYwu$2+v85Yp M'X^ƴ}[8k\>++u7Y?髵U8f&C<v#]oUQGXU}iic?S`=Zo֎G}Zr0 `V9{K]kwX|O~r+ahEaFoM .ޥӪ;smoV7۲_bUlV>ZV?^T1uX>|Umxx':8ei%9&aHα,|oQc&a {ElIK|iv~L>G?wwZC۶`w-_ /uu%?qUͳC?33tz]pkG m.wzo羻ԃ! m~vͮ'6u[[JIE}n5~wCm~(s}klevSZ79m}GﱁלV4i>z_Wϓz,Ozy4}Y Y'4>E:>Uo7Z֚)9W0k>Io`l;}?(@~kO*"B#?Qf'"(#Ӎ?}G빟*S>mr̯ 液c5YK\*|é?;kM8l'n ~Ծ8;] 8X$Grb6{ry|gUYEcl;_dn2aw2eT 2C|Nd'?//fh[Lvi+]:aY ZI?BOԎYx4ytܺ?-e9#&kY8wT-c}{SF,*%α4k`iFq{a/r,[=*fwS`|hZ讖]C.Iպ{'xcW^i-tn^KhO˞7Ե@굱](s]u4W]d1nIEQKKithN,=@"KS0)E#5C}-pst?*b"Yao p1?%9}_lçw5>MʭVqi{IO7gޢX9}1cSu=Wޛr_Z5SO\r}2.n`3]wͶm]cfF7bxkh{C=):yߴj+R]?W@ǹc.zph#O}kޛ*ksq~L7*\ O 222=!qi`deNO\Ngg`2+fr&˽Am51ۣv,]|d]?O:s:fԲ+X,m,$uӣ}My8w/[}fϨ~mq.Fjv@c(k*{kKZִmu{ZjmƪFGȭ%f̤.}VwS߂qh@1H'JOV_Q3nsc{_ܴc%<4 se6tr=YvGX<~ZVcͦd{q#JU'X|YP"$2+>*.nBlgg8v|'Yn{-vZ'񓃵#vHYf.w/#v󝯙F;O>?܍x+T-OҎ?ܜ7')Rw%2r?EqR2?ܢZwRk @#:]4rc;R x AQeY`Of4r)wA;?5**u/k1,c68-sҥ?zPʹSkXEmg, .8%ܓ\3 ſ_gݐsIV͢,sƾ#xw Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU 6workbase_foto-19 6 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong 6slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong 6urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM E) Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ƖD*^?t&7%KzlМV ӡjXT@5\Dާܽ3=K{ݳll]UڟUk z8fIY]op6{: 5 7 i#e =6~\WzwLY`k /wnRas\Kwp.*&HLXPFpi> D?2f[ ZBJk]SSpFRs#I?ʒ7O) ~"&?iM 8%2I&%1IJ\rXUxk\'07}b5 l/|JD{*9W꾊sOڵWiڂLTQR'ЈZ})~T9SۛhC[wHf5qI>*`;ܑKhe_>x!9@9`( C"Hmu{ָL.ivAh%FL|$ְߌ?"!V+eߐSINcM]Z^'Xw1dm8+oZui[Ps@1'z~n[ߖ_[Q"odX[0Gd[WǠ0~QJ>n-ciYF;=ǔGֵ2غY|oWw~+~o{R}8 ?}kllUZZ?b=&GΤ~ '?=ee}up4VֲIKX SIHbR-u$UOc+euOS:mzwWa;cGfߦ}nܒ~/S8=;7_u_lX+s+R?NOEjAnuHmz̚w9p .2{}$vR*di<ȗTy7nw%U}V\yй+YNc6IK8PX=M nXsI>C\m-߂Jn$bliPg@ȵ;X]Ƴ{=jø˘bdC]VEC7OclG΄=4kbL} ׶)ddៗHg1 -S;yvY&7 CwFev쩥 qrwۉkodŠViN1im -.([a-?[k 31Z[KIƀ$& >/dCG<<I7RǸvU>,.c]6Voc7=&ԹS[T{kk_^jkwӫ2lے2.0]}yQ3~bf]kl¶ƛ_$^[56k0 ,:VfgIĮ]ǝ{6VK\Eޭn؁O׵u5{#KzΨKE{vQ:K?}C!4=C׃nj\ ;J%eTCo}jO$-p?AZ65u%;Uxߕ_V~v)8轏˙ 1P|(dqm6ifΫLPz,sO+\nq o 7=.'` c[͍o? Cꪷ< ^<5H|ڞy26^ci hpVljh.cԄ,t󘡷`iǨ?ZN?-?v4{ip#>5$Of]}ԹΩ8֍7{Ů6TK^cӳm o#a?ɗj7lty6Xݍ—;|V\`Ws" ƙn3[65[v7Ppk!F'7mQ'ǸT{?O"&0 =ZQ9mXN-A:΂N5*ؿl{A.xcC~v}B2ng.cl:hEԾ嚬5F=m[W@{OM}yYwu$2+v85Yp M'X^ƴ}[8k\>++u7Y?髵U8f&C<v#]oUQGXU}iic?S`=Zo֎G}Zr0 `V9{K]kwX|O~r+ahEaFoM .ޥӪ;smoV7۲_bUlV>ZV?^T1uX>|Umxx':8ei%9&aHα,|oQc&a {ElIK|iv~L>G?wwZC۶`w-_ /uu%?qUͳC?33tz]pkG m.wzo羻ԃ! m~vͮ'6u[[JIE}n5~wCm~(s}klevSZ79m}GﱁלV4i>z_Wϓz,Ozy4}Y Y'4>E:>Uo7Z֚)9W0k>Io`l;}?(@~kO*"B#?Qf'"(#Ӎ?}G빟*S>mr̯ 液c5YK\*|é?;kM8l'n ~Ծ8;] 8X$Grb6{ry|gUYEcl;_dn2aw2eT 2C|Nd'?//fh[Lvi+]:aY ZI?BOԎYx4ytܺ?-e9#&kY8wT-c}{SF,*%α4k`iFq{a/r,[=*fwS`|hZ讖]C.Iպ{'xcW^i-tn^KhO˞7Ե@굱](s]u4W]d1nIEQKKithN,=@"KS0)E#5C}-pst?*b"Yao p1?%9}_lçw5>MʭVqi{IO7gޢX9}1cSu=Wޛr_Z5SO\r}2.n`3]wͶm]cfF7bxkh{C=):yߴj+R]?W@ǹc.zph#O}kޛ*ksq~L7*\ O 222=!qi`deNO\Ngg`2+fr&˽Am51ۣv,]|d]?O:s:fԲ+X,m,$uӣ}My8w/[}fϨ~mq.Fjv@c(k*{kKZִmu{ZjmƪFGȭ%f̤.}VwS߂qh@1H'JOV_Q3nsc{_ܴc%<4 se6tr=YvGX<~ZVcͦd{q#JU'X|YP"$2+>*.nBlgg8v|'Yn{-vZ'񓃵#vHYf.w/#v󝯙F;O>?܍x+T-OҎ?ܜ7')Rw%2r?EqR2?ܢZwRk @#:]4rc;R x AQeY`Of4r)wA;?5**u/k1,c68-sҥ?zPʹSkXEmg, .8%ܓ\3 ſ_gݐsIV͢,sƾ#xw8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$o>RI$BwR,}v_u1[c)quRI%~◡g+oȥXJK7I.7г] ?uq]8c+oE/p:V\|?|TIq︥Y?[c)ҷR$K,}/BwWeYJK7"7o?U)$\og)z~pzV_1x:I$ ?uqKг]ҷRoȥJI$Y^︮7"8=g+oE.>o>RI$BwR,}v?1?[c)quRI%z~◡g+oȥYJK7I.;г] ?uq]8=g+oE/pzV\|?|TIqޅ︥Y?[c)ҷR$K,}/BwWcYJK7"7o?U)$\wg)z~pzV_1x:I$ ?uqKг]ҷRoȥJI$Y^︮7"8=g+oE.>o>RI$BwR,}v?1?[c)quRI%z~◡g+oȥYJK7I.;г] ?uq]8=g+oE/pzV\|?|TIqޅ︥Y?[c)ҷR$K,}/BwWcYJK7"7o?U)$\wg)z~pzV_1x:I$ ?uqKг]ҷSҷR$K,}/BwWcYJK7"7o?U)$\wg)z~pzV_1x:I$ ?uqKг]ҷR oȥJI$Y^︮.7"8=g+oE.>o>RI$BwR,}v1?[c)quRI%~◡g+oȥYJK7I.?г] ?uq]8]g+oE/pzV\|?|TIq︥Y??[c)ҷR$K,}/BwWaYJK7"7o?U)$\g)z~pzV_1x:I$ ?uqKг]ҷR oȥJI$Y^︮.7"8]g+oE.>o>RI$BwR,}vu1J7"7o?U)$\_g)z~!0:t [c+GQX ) sg>RI,Ԭk |z~◡g+Y4hD/'!Iru춝>~vx4/,}/BwW`Є~f4$cx? IruurhVY侅︥Y4x4$y6x?:i\ӺP9Gz~◡g+l愿6wB_?ꧤI`>uLcpBwR,}zמKeoEPoȦc>wRAs^uF\wg)z~pV_u1x:I$ ?uqKг]ҷR oȥJI$Y^︮7"8=g+oE.>o>RI$BwR,}v1?[c)quRI%~◡g+oȥYJK7I.?г] ?uq]8]g+oE/pV\|?|TIq︥Y??[c)ҷR$K,}/BwWaYJK.7"7o?U)$\g)z~pV_u1x:I$ ?uqKг]ҷRoȥJI$Y^︮.7"8]g+oE.>o>RI$BwR,}v?1?[c)quRI%z~◡g+oȥYJK7I.;г] ?uq]8=g+oE/pzV\|?|TIqޅ︥Y?[c)ҷR$K,}/BwWcYJK7"7o?U)$\wg)z~pzV_1x:I$ ?uqKг]ҷRoȥJI$Y^︮7"8=g+oE.>o>RI$BwR,}v?1?[c)quRI%z~◡g+oȥYJK7I.;г] ?uq]8=g+oE/pzV\|?|TIqޅ︥Y?[c)ҷR$K,}/BwWcYJK7"7o?U)$\wg)z~pzV%_7"7o?U)$.+г] ?uq^Ϯ}I}F>E!yO?U.p0u.~/,}/BwWWr'pwu|Ço>u^m˫P` ȡS窸coExg)z~⽙o(~pܿpOoO$o>RI$BwR,}v?1?[c)quRI%z~◡g+oȥYJK7I.;г] ?uq]8=g+oE/pzV\|?|TIqޅ︥Y?[c)ҷR$K,}/BwWcYJK7"7o?U)$\wg)z~pzV_1x:I$ ?uqKг]ҷRoȥJI$Y^︮7"8=g+oE.>o>RI$BwR,}v?1?[c)quRI%z~◡g+oȧoȥJI$Y^︮7"8g+oE.>o>RI$BwR,}v_1?[c)quRI%~◡g+oȥXJK7I.7г] ?uq]8c+oE/p:V\|?|TIq︥Y[c)7"7o?U)$\gg)z~??ҷS7"7o?U)$\_g)z~_?ҷRc+oE.>o>Iq^︥YWJN>18x:JI2= ?uqKг]Ͼ7">u1xx:xJ&JW Y^︮}uo1VHK7iJWY^︮|uo1VHK7+,}/BwW}=F7R,Qq\g)z~7RW#oE.>o>% -p︥YUHK{_1x:K47z~◡g+W#oE/7R,PS\g)z~7SϞ7"7o?W d+,}/BwWy>zF_oȥY$)J ?uqKг]Ϯ7"c)qtpI4+,}/BwWu>F_oȥºI)\/g)z~⻟տ7R}_+oE.>o>I\7g)z~⻏ҷR_+oE.>o>I\?g)z~⻏ҷR_+oE.>o>]$.г] ?uq][c)ί7"7o?W &Ip︥YWJK~1x:WI2K,}/BwWo?zV_oȥºI\Gg)z~ҷR_+oE.>o>L= ?uqKг]ί7"~u1x:WI2K,}/BwWq?:V_oȥºI\?g)z~_?ҷTί7"7o?W $p︥YWJK~u1x:J&Ipޅ︥YVJK}1x:xJ&Ipޅ︥YVJK}o1x:8WI4+,}/BwWu>F_oȥºI)\/g)z~⻯տ7R][+oE.>o>I)\/g)z~⻯տ7R][#oE.>o>M)J} ?uqKг]Ϯ7"c)qupiJW Y^︮}uo1VJK7iJW Y^︮}o1VJK7tJR_BwR,}w_oȥ>V\|?|\+R~◡g+}[+oE/ҷR]$Ҕг] ?uq][c)WJK7tJK,}/BwWs>V_oȥWI2K,}/BwWs>F_oȥWI2K,}/BwWs>V_oȥWI2K,}/BwWs>V_oȥWI2K,}/BwWs>V_oȥWI2K,}/BwWs>V_oȥWI2K,}/BwWs>VoҷR+%~◡g+}_+oE/ҷR+%z~◡g+}_+oE/ҷR+%z~◡g+_+oE?[c)qtpL ?uqKг]ί7"[c)qupL ?uqKг]ί7"[c)qupL ?uqKг]܏_+oE7[c)qupL ?uqKг]ί7"~u1x:xJ&Ipޅ︥Y?WJK~u1x:J&Ip︥Y?WJK~u1x:8J&Ip︦5=KHί7"_2zay{q2ytg g4/O2)t$$WI$?o]bX~U-?ZO׏|C$S$I$I$JRI$I&IJI$I$RI$I$I$I%)$I$IJI$L$I$'IJI$$$I2I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$%)$N$RI$$JRI$I$I&I$I$I%)$I$IJI$I$RI$I$I$I%)$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$L%)$I$IJI$I$RI$L%)$I$IJI$E-ChyJI$L [@]} h Tn~t \cW/gVQeF9\ǔf) 8 WChRSdRh@&@M[a=(8SJ.ԢYr*Tc!0HK"bWXnfUN%A@1@ I:I!I$I$JRI$I&IJI$I$I:I$I$:I)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$I)I$I$I'I2I)I$t'IJI$$2JRI$tRI$LJRI$$IJI$I$RI$I$I$I%)$I;L$$K[ͅb !gaY]~$AcHVlWjEռ!JQ?Y=I.~kz֜R8^}k `@*LGdB-zU- *Ms-WXL +b B(&*;P s*[=B ۩lWVS$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2I)I$t$I'I$RI$I$I$NI$2tI$I$$NpI' A0R)dI8R !L$$d$$II %,I$'R$II&LIJI$&N$)$L:dI$d$$I&I$I$%))II$&AJI$I)LI'ҒdI<)IJI$$*Y$$2E,I%) %.I' %,I'I2HI$PS'IJI$II:t$$II$TI:I&NI$JY$I$RI$N%)$I$IJI$I$RI$I$I2I $$铤&NdIJI$I$RI$I$I$LI'I$RI$I2JRI$IIJI$'M RI$$JRI$t$$I$I)I$I$IJI$I$RI$I)IJI$I$)I$tI%)$In{ֿSժqm4I.$V.I/?o]bX~Ubxˤ>I.q$V)$I$IJI$L2JRI$I$I$I$$I$I)I$I$JRI$:dRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I2I$I$2I)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$dBI$$JRI$I$I$$)I$II%)$I$IJI$I$)I$d&IJI$I$RI$I$I:d$$Ju T,;T1XJRI&q+uOr3c BAlGXNŋaWa+:ע)O*Eg * BhT!DD`C R% AZI.X-Ap4jUpWh`-]W[2fUczm[+ ymh I2u $I&NHRI$I$I$I$$INJRI$I$I$I$$I&NJRI$I$I$I$$I$I)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I$I$2I)I$t'IJI$$I)I$I$JRI$$IJI$I$RI$I$I$I%)$I$IJI$(v-YV;L̄,Px(62t;1WzU AkfQ# ̺7izOX~ú`Uܭ?P#EO;屎jĤt-lGP )I$ڰNDԒ*n`BpQtK[#uT!Xs-X76 r[ CEE~YX-F I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'I$I$I%)$I$IJI$N:JRI$tIJI$N8I*I$0R )I$8 aD)I8R IJLI)H"&N(NR$II)$&I$)tI$RRNd2HRtLI$$ȩI$IL$I2H)I$IRI$$JRI'I$IJI$I2tI$$I'I2I)I$IIJI$I)I$I$I:d&NI$2A%)$NE:JRI$)L%)$I:dRI$2I)I$t'IK$2I$*RI$I$I$I$$I$I)I$I$JRt$:H)tI2I$I$I$$I$RI%)$I$IJI$L$I$IJI$ $JRI$$RI$I$I$I%)$I$JRI$E$JRI$E)LRRI$RI$I$I2IIJI$[p?=_j;re$KI$K?o]-?Z?o]-?ZO׏|C$I%mrI$I2JRI$I$I$I$$I$I)I$I$JRI$I$I&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I2I)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$dRI$$JRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:CR%$$OqGlʍ-Fn(YJ3,%fu5l#4(0"L+q n%Uk( (8J- LSW:*vVm* PU2B`RaRwl+{9m,*R]>Fo+}P4d$b$I&N%)$I:dRI$I%)$NdRI$I%)$NI$$I&I:JRI$I&IJI$$I:I$I&NI)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I&IJI$I)I$I$JRI$I$I'I2I)I$I$I'LI)I$tI%)$I$IJI$W_|WmrA!J i4WoЯՑE74w:l2֜AeeޯC S[K]LЕlT=_ k4؏U~90SKX;@'2Xh@*$\4 U =WA`XE2N3FBt-WKV9I;)ZI$I2I)I$tI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I2tI$I%)$I$IJI$I$RI$$JRI$I$I$I$$I$I)I$t铤$I' I*I$  RdR A0RI$p`$I$H& JY$'NtT$$2JRI$2t)tI2d2J]$L:dI$bdI2d*RtM)) $I&I$I$$II$)d$2IJJRI$I)IJI$$I:IIJI$$I:IIJI$I)I$t$I'I$R'I$IK$IӦO))I$I$I')I$t)%)$NiI)$NdR'I:I$I:dI$I$I%)$I$IJI$I$I$I)$I$IJI$I$RI$I$I$I%)$I$IJI$'LJRI$tRI$'LI$I$$I$E%)$I$IJI$I$RI$'LI'I$RI$'ka-Ou?Z7ܿcAI$I%qb$?o]-?Z?o]-?ZO׏|C$I%mrI$'LI$I$$I$I)I$I$JRI$I$I$:dI$I%)$I$IJI$I$RI$I$I$$I$I$$I$I)I$tLI'I2I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$II%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IPB5$$HL]NӨt}[jn.wߺ鰹rYVoq7D*Hn*XZ;yFJ'ՄWh1ŠR i\״P N%IQ[)lvVPP]RrޓF${ݹg#?s MQwٱ"t$RI$I$I$I$$I$I)I$I$JRI$I$I'LI)I$I$I'LI)I$I'LI$I$$II$I2IIJI$I$JI$I$I$IJI$I$RI$I$I$I$$I:dRI$N%)$I$RI$I$I$I%)$I$$I$I)I$Jurv$KQl4\cBvbtCÔn搚(wӬU8YՅB||67qc+ݍ9UxQ%$MN#%Sr5 Œ: ̅ Iŗ!jC5ңKnweQka;UZ #d()]tI$I:I$I$IRI$$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ILI'I$RI$I$I$I%)$N2tI BI*I$Q a,I' aD)T' A0R %INpNI$' $I$S'LI&L2J]$LTSI tɊt)$LJddT铤*()I$II%)$I2I$$I&I$I$IIJI$I$RI$I2JRI$$$$I$I)I$t'IJI$I2tI$I%)$I:dRI$S$IL%)2tN$I$:tI8N%)$Nd%)$NI$$I$I)I$t$I$2tTI$LI$I2 Y:d$HI$I$JRI$I$I$I $I$I)I$I$JRI$I$I&I$)I$dI&)$I$I$$I$I)I$I$JRI$I$I$:I)I$A$I)I$KwOV'kTn_v1줒Ip$tI?o]-?Z?o]-?ZO׏|C$I%mrI$'LI$I$$I$I)I$I$JRI$dRI$铦IJI$I$RI$I$I$I%)$I$IJI$LI)I$I$JRI$I$I$2I)I$tIJI$$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I!I$I$JRI$I$I&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IJ%=I*LKkWB՝ҪkE|cDI.V\ͧU-5Ho*d85 *MP(0КWB4Bo(D2SR$ j;F@s}R)4 oӵELG^^dLRP2tI$I I$I$RI$I$I:dRI$I$I$I%)$I$IJI$I$RI$I$I:d$I$I)I$I$JRI$I$I$dRI$$IRI$I$I$I$$I$I!I$I$IRI$I$I$I$$I$I)I$I$JRI$I$I$2I)I$t'IJI$I$RI%W^T6p|vTa`Ro j[WnJ }_mJu;8Z(NXݯ!zwYp^oͶ+PJ=W)SkF+ jNb P&*Wxlr;8BԥՙPIZE#EAHhR 3j)ChFngU+V'Rjw+oT*.!*j)$HRI$I$I$dI:I:JRI$I$I$:dI:I$I$I$$I$I)I$I$JRI$I$I'I$RI$I$I$$I'N:JRI$pA%)$R A0R %IR a@)IH)JɊtAH& A,)tI$EHI$D'L2bI$)I$TJQ))I'I1N$I')RI$$%.I$IRI$I%)$I$$$I$I)I$I$JRI$I$I$I$$I$:JRI$I$I'I2I)I$t$I'N%)$Nd)I$I$JRI$I$I' )I$I$R'L:dRI$$JRI$t$$IӨIJI$:JRI$I$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&NJRI$:d)I$IIJI$H$%)$I2t)I$I'LI$I$$I$I)I$KwOV'kTn_v1줒Ip$tI?o]-?Z?o]-?ZO׏|C$'LRI$I$I$I$$I$I)I$I$JRI$dRI$I$I$I%)$I$IJI$I$)I$I$JRI$I$I$I$$I$I!I$I$JRI$I$TI$I$$I$I)I$I$HRI$I$I$I$$I$I)I$d铤$I$I)I$d$I$I$$I$dI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Nh_ItX==u9JpҒ?btKVWMOK`luW ї &-ݵk.\VwV6iXYTŎ/> Xb]`XǕnJT!=m(]Yk  oksJ! =Xp"\KW5.B ч6r /Õ}tT=((e9EI[~'e PGrba-pG*|#uYDhou·QvꣂtWBI$I$I$RI$$$J*I$I$I$$I&NJRI$I$I$I)I$I$JRI$I$I$2I)I$t$$IL%)$L2tI$铤$I 8IJI$Q a$2tAL(0:e BI*)AH( ))I)I$b:d铦**J%%):dbI$Jr)$LTJQ))tI1LbI$IRII%)$LI$$I$dI$I%)$I$IJI$I$RI$I$I$I$)$H$I%I$I$JRI$I$I$I$$I$I)I$tI%)$NdRI$IJI$:JRI$$RI$t$N:I$IL%)$N:I)I$I$$I'LJRI$t$$II$I$I%)$H:JRI$dIJI$I)I$I$%)$NI$$INJRI$:I$$II:JRI$:dRI$I%)$H$I)I$I'IJI$$2JRI$Sլ%ZU9ۗ݌h;)$\:I$]$_?o]-?Z?o]-?ZO׏|C$'LRI$I$I$I$$I$I)I$I$%)$I$IJI$I$RI$I$I$I%)$I2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$d$I$:I)I$I$JRI$dIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$VO.p ԆAiH8ik.+lxWӔ΅l``RB7.}c6\>FƐ|׻бG ]h*V&fYOQ5 Fd9Ty]T<FrYU30$x+Fƞ˔@*IWU{x(㫽 dUegVEDYL*bsATvqsdĭZosT Wqrؕcv\Ts麉J΋6z\{ q._ƈ$J5I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$铤$I$:JRI$I$I$:dI$I%)$I$IJI$I$RI$I%)$Nd)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I' _͕H+}!J'%rSh-o]?Փ*L{vKam,C!t Vj$UbRg)!%A. oo5-P)VWQ`E`]ʮwIv8W |($dI'LI)I$tI%)$I$IJI$'L%)$I$IJI$'I$I$I%)$I$IJI$I$RI$I$I:dIJI$N:JRI$I$I$2tI8N$$R aD)5%,I) JRd锂Q a$:bB*XNS$I$I2bIJN:b))I'LTJrRB'LS%)$%D)JRI$2t)I$dLI$I$)I$IIJI$I$RI$I$I$I%)$I$IJI$I$RI$dHRI$$I*I$I$RI$I$I$NI&I$RI$&NI$2tI$$I'N:JRI$I'IJI$I$R'I$I%,I'N$I:I$I$I$$II$I$I%)$Nd)I$I&NI$dRI$I%)$NI$$I%)$I:IRI$NI$I$$I&NJRI$$$$I$dI:I$IN%)$N$RI$'kaOu?Z7ܿcAI$I%mb$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$I$I)I$dI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I2I)I$t'IJI$I$RI$I$I$'IJI$I$)I$I$JRI$t$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$S &))I$#.sxV6WQN$lXP}-"Q[ujaqlz >w`'౳Tu"Л]s\}"g~sea|GWB}Z' ou[ۊOKm>rVII$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$dI%)$I$$IN%)$I:I$$I$I)I$INI$I$$I$I)I$I$IRI$I$I$U5s蔂B\w]'s\Lu&=ѻ%W=!Z /oVqBhXT2TڄQ[%AVV7;j[pUzYC~WA>%W~BL$I$$RI$I2JRI$2IRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$NI&NI)I$I'IJI$0R %I$S L$I%0BIK$JAL(0V)r邒*Y2I$:dI2b1IJN:LSI'LTJQ)!I'Q*%H铨:dI$$'L2dRI$T$$II$I$I$)$I$IJI$I$JI$I$I$I%)$I$I I$I$RI$I$I$I%)$I$IJI$N:JRI$$IJI$:JRI$IIJI$I$RI$&NI$2I)I$tI%)2tL%)$NdRI$$JRI$I$I$2tI$$I''IJI$I2RI'N$I$I)I$t$I'LI)I$I$I'I2tI2I$$I$IJI$dI$IJI$NI)I$INI$0=_k n{ֿNwcI$I+kI$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$IJI$I$)I$I$JRI$I$I$I$$I$dI$I%)$I$IJI$I$BI$I$I$I%)$L$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I%)$LJRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I&IJI$I)I$I$JRI$I$I$I$$I'LJRI$$RI$I%)$I$IJI$I$RI$I$I$I$$NJJI Qr]Lu~RܬYX?E][xB!Z QgVP(BDoVh {9C )ؠЌVv\ܮ?~Tt_h,t-]$L$I:I$I$I$$I$I)I$I$%)$N$)I$I$JRI$I$I$I$$I$I)I$I$JRI$$RI$I%)$I:d)I$pBI*I$P%,I) JY$*AL( VQ) 'IK$dJ]$&)铨"RR'Q)rPBbS)I'LS))I$d$'L2I&IJI$$$I$I)I$I$HRI$I$I$I$$I$I)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I$I$IRI$I$I$I%)$I:d)I$I$JRI$t$$II$I:I$:I$tI$I$I'I2tI$'IJI$I$RI$I$I$I%)$NJRI$N)IJI$dIJI$I)I$I$IJI$I)I%)$I:IRI$I$I:I&IJI$I$I$IJI$I)I$dIJI$Ou?Z[?Sn?ƃI%äJI%?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$I&N%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$JI$I$I$I$)$I$IJI$I$RI$I$I$LI'I2I)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$$$I$I)I$I$%)$I$IJI$I$RI$~UO)($d~W5o+RܠṋE]KxB!X^6ߤb}5o+xB[RӪ8T3ĶGg(8f򳺇\}ʄ-'LI$I$I$IJI$:JRI$I&IJI$&IJI$N$I:I$I$I$$I$I)I$I$JRI$tIJI$I2tI$I%)$I:d)I$pBI*I$#TIK$JaH( VHS a@)T1NS 0NL$RI1LS))I' %E9LN'Q*%HI$SD'I$2rI$:bI$&N%)$I2t)I$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'LJRI$2t)I$I'IJI$I$RI$I$I$铤$I$I)I$t铤$I$I)dI:I$I$I)I$I$%)$I"I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$RI$II$RI$&I%)$I$IJI$)$R )I$I$JRI$2t)I$I$JRI$I$I$'ka-Ou?Z7ܿcAI$I%mb$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$IJI$I$)I$I$JRI$I$I$I$$I&NJRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$IJI$$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$%)$Nd)I$I$JRI$I$I$2I)I$I$JRI$I$$I$I)I$I$JRI$t$$IL%)$LI$$II$I ~]7n metUx)(#__`|WRF إTxT髸* ©o**(V(@#7,~Esr P]lVI$I$I$I:dIJI$I$RI$铤I$:dI$I%)$I$IJI$N$I:I$I$I)I$I$JRI$I$I'I2I)I$t铤$IQ MI*I$˜P mIK$JaH( HS a@)Ħ)bNL2dIK:eTJJ]$Q*%HtJR*%.I(9Q))tI2dRI$ɓ)tI$$I&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$IH$TI$I$$I$I)I$I$JRI$I$I$I$$I$tI2IIJI$'L$$II$I$IJI$I)I$tI%,I$2I)I$tI%)$NdRI$&I%)$N$RI$铤I$d)I$I$IJI$I$RI$I%)$I:dRI$$I$JRI$A$RI$I$I$LI'I%)$I I)I$tJRI$n`{ֿRժqm4I.$V.I/?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$IJI$L2JRI$I$I$I$$I$I)I$I$JRI$dIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$'LJRI$$RI$$I'LI)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$II&NI)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$2JRI$I$I'I$)I$tI%)$H+u}UW?LVEHs}%}T1P7]e}`d|VG-R^9ޯb' @ GJCpp_W*9ZxSA&);9UΊ9YE`]E`]ʀ*$I-]$I$IJI$I$RI$JRI$dRI$I$I$NI$I$$IJRI$IA%)$NI$$I$I)I$I$JRI$I$I'N'IJI$0IRI$ڠڒI$Q A$I"€SLSM$:JY2rdIJI$RRN bTJJdI(TJ]$Q)rRR$dJJRtLI)I$d$$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:dI 2tI$I$$I$IJI$I$RI$I$I$I%)$I:dRI$&I%)$NI$$IL%)$I$IJI$N:JRI$$IJL$I$I$$IJI$I$RI$I$I:IIJI$$I$IJI$N:JRI$I&IJI$dI:I$I$I$$I' I)I$tdRI$t$$II$I$I%)$I$IJI$I$RI$'kaOu?Z7ܿcAI$I%mb$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$IJI$$I)I$I$JRI$I$I$I$$I$I)I$dI%)$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I:I$I$:I)I$dI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$tI$I%)$L$RI$I$I%nT ??LV=Iu?U~\ǹ@u-e@PW EDzX_) ʍU՟B "XeMnr±_+7? P]l|*8*CI$ZI$I$I$I$$I$$I$$I$I$$I'LJRI$t$$ILJRI$H$%)$I$IJI$I$RI$I$I$铤$I'L%)$N`JI% RR$S L$'LT˜P aS'L'LJY$I$IJI$("RR$@"RR$&Q)ʉA I$TJJ]$LS')JRt$dI$$$I$dI:I$II$I:I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$IRI$I$I$I$$I$I)I$I$JRI$I$I$$RI$&NI$IRI$)I$t'IJI$I$R$I'IJI$I$RI$I$I$I%)$I"I)I$I$JRI$I'IJI$I$RI$'I%)$I$IJI$I$RI$I$I:dIJI$N$I:IRI$I2JRI$$IJI$I2tI%ZXEn{ֿNwcI$I+kI$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$I%)$I$$$I$I)I$I$JRI$I$I$I$$I%)$I$IJI$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$dI:dIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$I$JRI$$$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I2I)I$tIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:dIJI$I$RI$I$I$I%)$I$IJI$I$)I$dI&N$I$IJI$I$)I$I$JRI$V*ZoGHRb1XKJWT{ RcܠnZ# Z(Iy3EKD|*՚D7g%~ P%nQqΊ\+5 VoP`],yP<+R]i$KWI$I$RI$I$I$I%)$I$$$II$I$I%)$I$IJI$I$)I$I$JRI$I$I$I$$I$I)I$II%)$I:e I' AD)IL)5D)%,I)0IY1N0*XNS)I,dLH)tID2RRd@"RR'Q*%HNTTIJI$&)b2tɓIJI$%)&I I$d$I$)IJI$NI)I$I$JRI$I$I$I$$I$:JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I'I$RI$I$I:d$$IIJI$L%)$I$IJL$I$I$$RI$I$I$I%)$I$IJI$I$RI$I$I$I$$I$JRI$I$I$2I)I$t'IJI$I$RI$I$I$JRRI$钔RI$&NRI$I$I p=_k-Ou?Z7ܿcAI$I%mb$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$LI'I2I)I$I$JRI$I$I$I$$I$I)I$dI%)$I$IJI$I$BI$I$I$I%)$I$$$ILJRI$$RI$LJRI$I$I$I$$I$I)I$I$I$I$$I$$I$I%)$L$RI$'I%)$Lt)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$$)I$dIJI$NdI$I%)$NdRI$I%)$I:d)I$I$JRI$I$I$I$$I$dI:I&IJI$dI:d$$I&NJRI$$IJI$:JRI$I$I$I$$I$I)I$II$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IL%)$Lt)I$I$I$I$$I$I)I$I'IJI$I$)I$tI%)$H+_9VE$&)鷺ߪg'reK#m[ 5t]-G< ZT%gޯp1ubiYJCwVu#VnOC趡;7 \ \Ρ»8XVQuWU<5q $Ib$I$IRI$iN%)$Nd!I$I&NI$I$$I$I%I$I$%)$I$IJI$'L%)$I$IJI$I$RI$I%)$I$$I2pI) IRdڦRRI% BRJ(L(5L"%EH$I%,I&I$R&N5N' %DN:Q*ED'LDI2b1IJN:ddI2I$I$dBI$$$Id)I$I$%)$I:I$$I$I)I$d$I$I$$I$I)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I$I$I$$I'I$I$IJI$:JRI$I$I'I$RI$$JRI$I$I:dI$I:I$I$d)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2tI$'IJI$I2tI$'IJI$)NI& I%)$I:d%)$I"tI%ZX+{OVs/vRI$tI[XI$?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$IJI$$I)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$BI$I$I$I%)$I2t)I$I'IJI$$2JRI$t$$I$JRI$I$I$I$$I$tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$2JRI$IIJI$I$I:I$I&I$I$I%)$N$RI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$NI)I$I$%)$I:dRI$&I%)$I$IJI$I$RI$&I%)$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$&NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$tRI$'LI$IRI$LI'I2tI$LI' ˿*V_H$)7t黬s~.8?̩qDw]b}c>օh[^cj$>ZWW +7'~HV=PT[WjV_Pa,+yP|+ ڂI$I$I$I2tI I$I$$$I$I I$I$RI$I$I$I%)$I$IJI$N:JRI$I$I$I$$I$I)I$tI%)$I:d)I$R !L$&NH)(5$$e R )It)JD$I%,I&)$JRtQ*%Hp:LA uTIJI$%EH$I2JRt&N$II$I$$I$I$$I'L%)$I2t)I$t'IJI$I$RI$'I%)$I$IJI$I$RI$I$I$I$$I$$I$I%)$N$RI$I$I$IJI$$I:I$I'QNI'I$RI$NI$2tI$I%)2tN$I$$$$II$I$I%)$L$)I$t$$II$I$I%)$I$IJI$N$I$I%)$I$IJI$NI)I$I$JRI$I$I$RI2JRI$'M RI${OVV'kTn_v1줒Iq $tI?o]-?Z?o]-?ZO׏|C$I%mrI$I$I$$I$I$$I$I)I$I$JRI$I$I$:I)I$dIJI$I$RI$I$I$I%)$I$IJI$$2JRI$tRI$$JRI$I$I$I$$I$I)I$I$JRI$tRI$I$I$I$$I$IJI$I$RI$I$I$I$)$I$IJI$$$INJRI$$$IN%)$I$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$N:JRI$$IJI$:JRI$$IJI$I$)I$dI%)$I$IJI$I$RI$I$I$铤$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'I2JRI$$RI$I2JRI$2tRI$$JRI$t$$I*̕͟Y60R M:n>2—TEuзV_[Dž^cj$~g-Dʵ_ YJCuEf}%YI j imcpʭ4VieΣó ¸($I,RI$I$I$dI:dIJI$:JRI$:I$$I$I)I$I$JRI$I$TI$I$$II$I$I%)$I$IJI$:JRI$QR )I$pBI*I$mDmD )IS %d:b0*X"SE%,I$$%.I&Q*EDӦNTJQ()t铦*%9LRBNTTIJI$&N%):I&L2JRI$2tBI$$JRI$:d)I$tI%)$LI$$I$I)I$t'IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I:dRI$$JRI$$RI$I$I:t$$IL%)$I$IK$I$I)I$t$$ILJRI$2I$$I$JRI$tRI$I2JRI$2I$$II$I$I%)$I$IJI$I$RI$H$$II$I$I%)$I I)I$KwOV'kTn_v1줒Iq $tI?o]m?Z?o]m?ZO׏|C$I%mrI$I$I$$I$I$$I$I)I$I$JRI$d$$II%)$I$IJI$I$RI$I$I$I%)$I2t)I$I$%)$I$$$I$I)I$I$JRI$I$I$I$$I$I)I$tI%)$I$I*I$I$RI$I$I$I%)$I$IJI$I$BI$'I%)$I2tRI$$JRI$d$$I&I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I$I%)$I$IJI$I$I$I%)$Nd)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$I'I$RI$$JRI$I'IJI$I$RI$$%)$LI$$IʳoVo*t?u}Z]տK"~ }sY~VWX<*cK4ĕ>Z8| UU*|$RϹi; ?[yB 2?ViVYxXv: T)¸a(:KI$I$RI$'I%)$LIRI$'LI'I$)I$yI2tI$I$$I$IJI$I$)I$I&)I$I$JRI$tRI$'LI'N I' a@))00I)0IY1N *X"SE%,I&LS))tH&*%Hp8P*%Ht:LTJH]$Jb))I$d$L2dE%)$I$I I$&N%)$I:d)I$I$I$t)I$I$JRI$I$I'I2I)I$tI%)$I$IJI$I$RI$I$I$I$$I$IJI$I$RI$I$I$I%)$I$IJI$I:dI$RI$tRI$I$I:I$I'L%)$I$IJI$$I)I$$I%,II$R$$I%,I$I$$tI$I$I$I$I$$I'LI'I2tI$I%)$I$IJI$I$RI$I%)$I$IJI$N$I:Sլ%ZU9ۗ݌h;)$\BI$]$_?o]-?Z?o]-?ZO׏|C$I%mrI$I$I2I$I$I$$I$I)I$I$JRI$dIJI$I$RI$I$I$)$$I$I!I$I$%)$I:IRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$d)RI$NJRI$dIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I:I&IJI$:JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'IJI$$2JRI$tIJI$I$RI$'LI'I2tI&_Uʳ$&7u9]տq}].="&sY>-¯jxURoZ,֖'#i*i$R+.老VeMP%Ks4QU9Y=Gg+o,D𭪘|+J $KWI$I$RI$I%)$I$IJI$:JRI$$$$I$dI:I$TI$I$$I'L%)$M I%)$I$IJI$I$RI$$JRI$p8IJI$P a$2tMD L$&NH)J˜P a1LS)E$R$d9LI$*%H铨TJ ]:d%D2t@%)$QLTJJ]$IJI$$I!I$I:I)I$dI%)$I:dRI$I%)$I2t)I$I'IJI$'I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$2JRI$$:JRI$I$I%)'IJI$I$RI$$I'I2tI$I%)$I$IJL$I$II$IK'L$I%,II$R$$I%,I$I$$I$tI2I$I'I2I)I$tI%)$I$IJI$I2tI$I%)$I$IJI$['kTn_v1줒Iq $tI?o]-?Z?o]m?ZO׏|C$I%mrI$I$I2I$I$I$$I$I)I$I$JRI$$IJI$I$RI$I$I$I$)$I$IJI$I$RI$I$I2I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$tI%)$I$I*I$I$RI$I$I$I%)$I$IJI$I$BI$I$I$'IJI$I%)$Lt)I$I$JRI$2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$I$I)I$I$JRI$I$I$I$$I$I)I$I'IJI$I$RI$I$I$$I'I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$I$%)$NI$$I$I)I$II&NI)I$MY7f I M:n]o]Rآ+w9[#lkU­j$kK [B,V,"Y~δ{, "YQ(bP)Ѫ<ijԸXvrDN[iE$IjI$I$I$I%)$I$IJI$I$I$铤$I$I)I$I$IRI$I$I$2I%I$t'IJI$I$RI$I$I$IJI$%)$S A@))F0:e0I*L2S L")r8I$R$bLPR$TJQ))t铨TJ]:d%D2tD)RI$)$I$'LI&I$BI$$JRI$I$I$:I)I$I$JRI$d$$I$I)I$I$JRI$tIJI$I$RI$I$I$I%)$I$IJI$I$JI$I$I$I%)$I$IJI$I$RI$I$I:I$I$I)I$I'IJI$I$RI$$JRI$I$I'I2I)I$tI)$H$HI$I&NI$I$$I$I)I$I$JY:I$:I)I$I$JRII$$I$I)II$I$I$I$I$I$I$$I:'kTn_v1줒Iq $tI?o]m?Z?o]-?ZO׏|C$I%mrI$I2JRI$I$I$I$$I$I)I$I$JRI$I&IJI$I$RI$I$I$I$)$I$IJI$I$RI$$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$t'IJI$I$RI$I$I$I%)$I$IJI$I$BI$I$I$$I$I$$I$$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$IJI$I2JRI$$JRI$$IJI$I$RI$I$I$I%)$I$$$II$I$I%)$I$IJI$I$RI$I$I:I$I&N%)$N:dI:dIJI$f U Q9Y Kcpw};T(%cs%}bs WKHNp>1xAUe*Yo ㏵g}ΰwggd*fV?QXrij $p*؜+ )$KWI$I$RI$I$I$I%)$I$IJI$I)I$I$%)$NI$$I$I%I$I$JRI$I$I'I2tI$I%)$I:dRI$d%)$R a@))00:e I*LS*aH( N$E,I&L1AKJ%DN:Q)bN:Q%9Q))II1LLI&L$I$9I%)$L:dI$$$I'L%)$I2tRI$I$I:dIJI$I$RI$I$I$I%)$I$IJI$NJRI$:I$$I$I)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I'L%)$I$$I$I)I$I$JRI$"I)I$I$JRI$I$I$2I)I$t'AJI$I2tTI$$I'I2I)I$I$I$I$$II$I$'IJI$'L%)$I$IJI$I$R'I$I%,t$I)I$K{ֿSn?ƃI%$JI%?o]-?Z?o]m?ZO׏|C$I%mrI$I2JRI$I$I$I$$I$I)I$I$JRI$dRI$I$I$I$)$I$IJI$I$)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$RI$I$I2I$I$I$$I$dI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$ILJRI$$$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$JI$$II$I$$RI$I$I$铤$I$I)I$I$JRI$I$I$S'I%)$L$RI$I$I$$I'I$RI$I$I$I%)$I$IJI$I$RI$I$I;yVrUʱI Q(VKy]B7.Rb\#O5䵏 VKV(g3WƒyV yV I->ZV}^;8E(VBcUU~V7QXmuT(°pI-RI$I$I$I$$I$I)I$I$JRI$I$I'I$RI$I2JRI$2tRI$I$I$I%)$I:I$$I$I)I$I$JRI$H( I' a@)"5L(5L$&NH)J'L€SLNI"I$ɓ.I(T J]:e%T \$J%1R*$.d%2r%)$Lt)tI1QRLI&I$BI$$JRI$I$I$:I)I$I$JRI$:I$$I$tI2I$I'L2JRI$I$I'I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$I*I$I$RI$I$I$I%)$NI$$II$I$I%)$I$IJI$I)I$I$JRI$I$I$IRI$$JRI$I$I$HI$I$JRI$I$I$I$$I'LJRI$tRI$'IJI$I$RI$I$I$I%)2t[?OVOSժqm4I$I+kI$?o]-?Z?o]m?ZO׏|C$I%mrI$$JRI$I$I$I$$I$I)I$I$%)$N$RI$I$I$I$)$I$IJI$L2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'L$I$JRI$I$I$I$$I$I)I$I$JRI$IIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$L2JRI$I$I$I$$I$I)I$I$JRI$t$$I$I)I$I$JRI$$$$ILJRI$$IJI$I$)I$t$I$I$$ILJRI$$RI$I$I$$I'I2I)I$t'IJI$I$RI$NI$I$$I$dI:IIJI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&N:JRI$I$I$I$$Iʱ9Ga9RQ}%?. Iw;~ L{E~:eatGpX^(IpY+5T6vrCfϢ]Ef*]&tS~VUj*7+,W򶺒*s*'VRI$I$I$$I$I)I$I$JRI$I$I$I$$I'LJRI$$IJI$I$)I$tI%)$I$$II$I$铤$I$I)I$pTJRI$R %ISjP a%)2taH(0T:e0ELJd2tI"I:dʊ RtT J]:LSI$TJH]$Q)r%)$LLI$&N%)$I$I I$$I)I$I$JRI$I$I$I$$INI$2I)I$I$JRI$$$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$I*I$I$RI$I$I$I%)$I$IJI$I$RI$NI'I2I)I$tLI'I$RI$JRRI$&I%)$I$IJI$I$RI$I%)$NL%)$LtRI$'IJI$I$RI$I$I$I%)$I:dRI$I$I:I$I$:I)I$I$JRI$'kTn_v1줒LI[XI$?o]m?Z?o]m?ZO׏|C$I2I$I$JRI$I$I$I$$I$I)I$dIJI$I$RI$I$I$I$)$I$IJI$$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$&I%)$NdRI$NI&I$RI$I%)$NdRI$&I%)$NdRI$&I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:IIJI$I)I$I&JRRI$$JRI$I$I$I$$I$I)I$I$JRI$I$I'g*_ 9V3?I!J#%g]EaW}oKb\J13­g*WKIh⅜ϤV' Y*Y$R老+1Iܡ[+Bò}oN'RXlu%T .'G@()$KWI$I$RI$I$I$I%)$I$IJI$I$RI$I%)$Nd)I$d$I$I$$ILJRI$$RI$I$I$I%)$N8IJI$P a$2taL(5L$&NH)J R L"Ħ)b$"Nb1IJN:P*e@)&NTJQ(!tID"RR$LIJI$dI$2t)I$I$$)$I$IJI$I$)I$yI2I)I$t$I'I$RI$I2JRI$$IJI$I$RI$I%)$Nd)I$I$%)$NI$$I$$I$IJI$I)I$I$JRI$I$I$I$$I$I%I$I$JRI$t$$II$I$I%)$Nd)I$I$JRI$I$I$I$$I$:JRI$I$I$JRI$I$I$I$$I'L%)$HI$I:I$I$I$$I$I)I$t$I'I$RI$I%)$IoOu?Z[?OVs/vRI$I[XI?o]m?Z?o]m?ZO׏|C$I%mrI$I$I$I%)$I$IJI$I$)I$I$JRI$I$I$I$$I$I)I$IIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$LtRI$'I%)$Lt)I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Nd)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&NJRI$tRI$$RIJI$:JRI$I$I$I$$I$:JRI$*Yaʒdѿop%;~ H|doZZWR_kpX.%|,PKS9VG 9VJI +1Ij]VSܡZP0߬U^U6jKܭX@E裦I$ZI$I$I$IRI$K(%RI$Li $RI$锽2!-U)$A^EI )zeBRU)$BRQd'ITIaMhJ$H; [ 2dJI$vhM *I!BPT%$)$M )T$HI)ڒI(2JRI$I$I$I$$I&NJRI$:I$$I$I)I$I$JRI$I$I&NI)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$$$IL%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ $I'I$RI$I$I2tIJI$I$)I$I$I)>oD$lʒeW} 0߂dO_ծSh;^aʽPW+KίqxPo*GVg*FI!=AdyP# E-W0̕ WpL>V3[OT(}aW*d$$IL%)$I$IJI$'I2JRI$$$$II$I$I%)$I$IJI$I$RI$I%)$NdJI$'IJI$I$RI$I%)$NRI%0BI*L2QQ:JA( VLS(H(09LI$N:d:IJN8LT Q()p0NTJQ()tID"RR$d&IJNI'LRRI$$HRI$2t)I$I$%)$Nd)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$ILJRI$)LJRI$)L%)$I$IJI$I$RI$I$I:d$I$I%)$NdRI$&I%)$Nd)I$I&NI$I$$I$I)I$I$JRI$$$$ILJRI$$RI$I$I$I%)$I$IJI$$I$IJI$N$I:IIJI$:JRI$IIJI$:JRI$I$I$II$2I)I$rIRI${ֿSn?ƃI%ĤJ$K?o]m?Z?o]m?ZO׏|C$I%mrI$I$I$I%)$I$IJI$$I)I$I$JRI$I$I$I$$I$I)I$dI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I2I)I$t$I$I$$I$I)I$I$JRI$I$I$G(*u)%I 5UrNTl**:I$f1I#JR$IJRRI$S%))I$yLJIRI$:))I$yI2RI'4IM:*RI'I4I<)IJI$$RI$;+ܫ$JwIV =ѩ$)$D.N ^mI$3rLI$dRI$I$I:I$I$I$$I$I)I$I$JRI$I$I$I)I$I&I%)$Nd)I$I$JRI$I&IJI$$I:I$I&N:JRI$I$I$I$$I$I)I$I$JRI$$IJI$I$RI$I$I$I%)$I$$IN%)$I$$$I$I)I$I$JRI$d$$II%)$I$IJI$;_(z)Dr9YU} 0߀^W=$~DZDW\眺}`?r^aʽXWfVuZxV \!$#ڱawPrj4Q{VVj.krV;[WʅzO*AXLI$I$I$JRI$II$I%)$I$IJI$$I$&IJI$I$I$IJI$I)I$I$JRI$t$$ILJRI$:tI8R *A%)$R a@)S mCIK$JaL(0LS*aM a%2QN$RI%()IdD"T ]:d銉NTJJ]$LT Q()tI2bLRR$ILI$:dI$&IJI$I$RI$I%)$I:dRI$dRI$&I%)$N:dI$IJI$$I:IIJI$dI:IIJI$I)I$I$JRI$I$I$2I)I$t$I'I2I)I$tJRRI$L%)$I$IJI$"RRI$:*A%)$NI$$I$I)I$I$JRI$I$TI$I$$I$I)I$I'LI$I$$I$I)I$iO)$I'I2I%I$t$I'I2pI$I$$I$I)I$tBI)I$tI%)$I$I%tOu?Zt;OVs/vRI$I[XI?o]m?Z?o]m?ZO׏|C$I%mrI$I$I$LI'LI)I$I$JRI$I$I$I$$I$$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IIJI$iE8:$KB!F\ħ 93U+FpZ$PjYUZH I$t: I$I$$II$I$LI&)$S$$I'LI'I$%I$p0NI$I$$I&I$I$IJRI$P:$$RIWFTIW;$)$@rMS! ԔI$IJI$I$RI$I%)$I:dRI$I%)$N$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$NdRI$$JRI$I$I$I$$I'L%)$I$IJI$I$RI$I$I$IJI$:JRI$I$I$I$$I&N%)$N$RI$I$I$I%)$Rc;>!RIDrVm?L/AzR߂>^?oK>hX*+UR%ȯY,nUʼѢW*8Bi 5sOsMB2xtEh:cd5K>-վXmuV!WLaYUz~i$I%I$I2I)I$I$JRI$yLJRI$)LJRI$$$$ILJRI$$$$II2JRI$)LJRI$dRI$&I%)$Nd)I$I$I'R !H$$JAL( TI)60I$P a,LT˜P AR*%:E$*RI$S&!.I(TJ d2uTʉ )I'P**ED$IbAKI'LI&LJtВI&I$RI$'JRI$I$I$I%)$I$$I$%)$I2xO )I$tҒI&I<%%)$L}-)I$dO$J)'ڟiIJI$RRS))I$J[J[JJRI$KiKaIJI$RRRRRI%[ [ JRI$)lIJI$žĽ4IA%?M?dDJ&I "I$I }$$ICJ=$ⴒIB}4$L$R&JP(Ei)t$ B/ԔIBVI2R B7*IK)U(V}$ޚJ]$Ғ m*Ǧ*IKSJ>`֗$)J-Ϧ֒$)J$I&M*–­zj)dҒ–¬5j%.%GrQؒRR_)2IIKRSze/L[lIL)Pze/L;ؒJR)J镻ݿWkflZ>u/Z7ܿcAٔ7)4I%mc$I?o]m?Z?o]m?ZO׏|C$I%mrI$LJRI$2I$$I$I)I$I&I%)$NdBI$I$I$I%)$I$IJI$I$)I$t$I$I$$I$I)I$I$%)$NdRI$&I%)$NdRI$&I%)$I$IJI$I$RI$I$I$I%)$VpU: jKEEDV{+B`T -,LzQX@RI$ I$t)RI$$JRI$I$I&)I%)$I$I I$LIH)(%I$t$I$dRI$.N$)$UlAJ%D$I$CU4$J0TI*I$IBI$I$I$I%)$I$IJI$I$RI$I2JRI$$$$II$I$I%)$I$IJI$I$RI$I$I$I%)$LtRI$I$I$I%)$I$$$IJRI$I% )I$I'I%)$I$JRI$$$$IO BJRI$$$$IO BIRI$$$$I$I2I(IJI$$IE%(KjJRI$ԡ$)$QIKj[RJI$Xd!TQ:D+G%IDrVuL/BM/]RI$>`ԶRI$>mm *dv%j[RM.d%jPtI b}$$$-"[RR&I b[QaD%.d{Rډ-)I$ԶO%)$!Kj&RR&N-{SIJI$Oj})I&ICj[Q!4$LԡNI2uO T$$e mE KbJ]$JMK"TT:WETPYYx&c}04߂[k]:3շ*+NUmK寉ǯTj\ENUM)2ϵc8{Q,sB㢐F}+"5ϸbu[]Yⱋ5PO_VUl1VT M*e B$*a>6%)$Pbm)I&I (DAI+$NQ}%.iIW-Kj9GDIBS(I2H{ [ $$LŨ4$H{SS>LJ50थ$JMrJRRdAZMr ))D$THRc!CSaE+9DB3Z *`]ΔgTNA"R+  .eM%0#\%A' (88ISHA&pH"SCܑ))dP'*$%*$JX'I:D&ɷ$({ܒI"@H"ILBTR'IL(NJRࠞRI%0($$JE($HKQpIJI$O ;RRI%"ے)PRI%0S*RI$ PID IJI$JR8bA)d$TTRM) mQMj"$JeQMe7RR&!RRmJ )R5*()I-!$AR^EJI6(AQN*))tw%NpC5ILPܞS7hJJRp ѢB$IJQ%HB SJJdNJu(IJI$L5LW))I(%<#6邕)R\r BI)%$"䷪UL&sJI)J䃕bK`$9JJ '“Z )T5LIAQ hOݚR$LJ9!;,pDg@% (VeVƓ#DDU=Zt97tWL@GJڔ;3SFg X*vc͆%M< !jkVn鬺;a;ږ J`x+3 6IUm9ox`wqMJkc#\>DbQpP6r2K~ѹ/?DB49smĵÈ(n$.F0{weTfP?ll+67 ]Ԙ,W8ΛiHg m=@F(q uK$:[ ଷ. ΰi\v~r=WDpSB>U?GT1qi+6 ll>lhCv-:պ4L*N{ 'GPF ^uF~E .ns@k}9rbWIf8UM"Z,2.+#~ClVۄĞ6(H.Ӟˌ%3N>-mFؖiPܔ^II%:r^JRլD-V07Q/Slc%DA*v^~I+liI%?o]m?Z?o]Xj?^?9KIb[I$EU)$BIO餪RI$#zizi*I P餪RI$ B?I$%^J$HRI/M%RI$ mV=$$JI$}mV}$ޒJ$)UYU.dVRUI?tJJ–gKITI)U%ZU.iJU]>¬IzI*I4*–kM餚]$Ҕجi4KRU%X؟ITIU%Yؒt$Kb6ĕK$ lG؛hI4IAؖmmITI$[`:8TxH() D;9Q3)VdB*+, T Tc]$DhRScT I$xDؖĕJI$$MlITIQZM%RI$Mʼn$RI$ B& ĕJI$4#lM$Ha[OM)$J-d&ڒWI2t=B% )I$_ @VUII$%&r$J MR=9%I$1L`R)%I$e(JBI%pRI$I)I$d)I$PI4% IJI$&N$$IBe IJI$n THIJI$ LB@$$Iژ$IӨJRI)PH$$Ja$I<$R )I$F IK%= RI&C؛j2bI2Hp$R$ԶI()$%>$I$)JRR'K`M%)IJI$ 2RI'- )jNIBx )RI$&!(J JRI$bH))I$d<&-IJI$e iShIKNSJJRI$TuA'*N}`Zjk1?8>+Ѻm)TEqsUU)c]\lQʨIZE*VERU)n/V1>} ^9Q&}5 0ϹsSak^J%@??'JTe$INRCR !I6DtN\\BI)HHD%,I((ʑj[R0"Z#ZJ]$JJ!bRR&BhSڣ)dQ)O.d`2!=pBJRIIM mj RI$Jơa"Gj%mI$  L)jpbPBNr NХ AHPD!A@'iEiUVnGsPb(U`"W1 @ Saa҄JZ$ PV"*njp!%$H4D!"8T IOdRJP-d!lLZB`R&I 1MD)IDLkV4H)* B+S7<%Jg)J&1RF]D%Je-0#ZBMnJRBeOzqbJe)&ڛj!R!zzJg-!mQӶIL&.J!?֟zb䔴ОmAL0(/IK&-B ' ILe)R!Uĩڊa6e%)>i H@ܖ P B<w%#(Ep@.)nIL!(Sۂr@ja-pgpH9${S#9dILRHRsA1)m))@'I)RHF h{%)e ;&E==GtC g d6ߚ~*?h̪fN " 6}֗BmLZT]l54D;$vkh:hvUI5,5#nef= %dy݉`n>V@N8˶V)k*VVK8J&Y(ŭT+<[7j+sIDn}ԷxTEA!f*alBM !+)̖YAi켦- 1\7$\Z&GD4O.ׄMS-S TUX `LX'M*̼-:!Z j9LH@ ʠn%"/%: z [#Ps.^H7n@ `aզaXNeA9Q nAU:Vdz%-)ɮoF>ޤ,hhw! D")(^ ˨C% %kktqv9RSFv9$jHT ^{Sm@ VMSnR=BPnO &#ڛbHCbԭ۾uZǕG'kSOn_v1b%B%4)pI$I$?o]תXaW}Uj?^?9룻ꩉNy\礗+k)JI(H'O))RC 0)%/)JhI7zaKriIKRoL%RR)I%-JSJJT)m-<))Rm(I$I$$JRI$$$IBI$I$hNJRI$hO $R-M%)$I)O1j RI'JRH5>TI(*{SM)JtTI$RLP'NI2J( lAK)AbbĔI$!ʹU}",SPzENfUHEEQɳՕ+6r$I]j(5xRdpЙ8A*I$ڔRI$>У))$LB DI2p thI8D)I$v:! )IBz9;R:`J{lEK%S-]کeWI2uQN6;dI$ЬCT\ CpId铧`NBL {e%)$(MlIK$(J6'M)J M餥M)J&oM1%.iJPDR&OM-)tJHp {ؒI2IHlH%.dS?I4(ޚoM%R&IBGU.IxKj褊]$Ҕ)*R$]$ҔqRL$M)J @"zjA)tɥ)C RڒI2uR S I*I1)BR&҂b(<RM("0) )ܣ)M/M$BP'#L6J4ƴ]6nJTa)I$qgS()I$0r[8TIJIڊL5%)1N1ȁ-iEkRKaL 5eG,B cњQ֢B<#I>ЅQG(R*HvAAI (VS $!"ԳiDkSj Pr J (aL!ZӔR2H%;QBJg)@'Q HSP&RRE8QNI%.I(I%)$LrJRb"J%:I)hO QHOd2Z9pQ:' 8PH쥴RRI)I8M )ILTHRLS<)RI)kGp `){Ѣi(e!w`+ S$w7eVL*m6uzc'Txe'IUwQFZ |J!Y1HVGK$H@6Ҕ_I<*agQ:J#TL~Nɱq2TtW_t`55JBA: ;*%!e$<-jqğbeV$tYy:aԺBq j]6?ZdsUc9%![*䅔ήDiUK3>K aLD$K+B$p{*{,dBU2]uZ鍬Λcn3Z%D#'6O lmG A~fxMusE\ f Psi|颤NsOܵ5@:IٻkGvV=pF^7LqD5 {Xɧ7Oʷ蟣~*cCZG'̥6W]6]PV}_e ~#z5FkOuRK%Ih Vhdhn#г#p_S6hVC?Ic^ScZỉ0ՄK膃lVե.(Y1 c]À4j耲imEy{k؎I>I:n()O;m9g֥ONV~OHckȭH y*?$>C$i`8hst 5N"w@ƭZl"YHq׏5זZ`ԝ<PhJMFHЦ֝!.SX7!ٚ+lpJkqmIDyù@]PCΒ\dwF$a ]m5àu4^ӠDce)SF<9N 9:n&^Y`-N|TsC@+"T!4x#24(7iwn[N|Pqgi)06 Otۢ%uWl;@cE\Zְ1{iW݆ `T(j$cd:O^o6 9W 4!Wsd^`h(޳hVl쥠9|Vq˱c 4x!?0w<ڮe{W@qcn ͛wsU `߯*`#NSX/ʇ#Ѫm T+òKīxt["4Z OlѪGP~D7hfSpXtWPΞڵH_HnHdvKWQ;wV5r[BFr _ý:Bz[VdI F}MJoRC8#Y2>0`F]>h=uk[uF+,5"3#Pc65VzP̪YX}N:.tv@^f<$XqF%\x0_yB!@@;vp "&@QC=ՀHQΤ9|+`d52 lHPc\`Zd.en,hJ`{Cde)IrN2rp AHAZX[T{ֿNwcӲLLSpI$I$?o]׏VX~Uwl?ZO׏|IE˟'V׬ICjP $J&EڢZN)JJ{R$Ҕ' J]$ҒdpR&0 P I%tҒeKjI)yJS$>%/)JdmKj))2JSO)JI^SJI(H5JSJH^RН(N)$B'%DS<&)IK'I$:d)I:I)I$D&)JRI$S)j \$:iR-BJRI$9JT!8dRҘ$JRSAS *!W+-l}چySiYY Uo%UQsݚt:HVtU*NIQ؜5:)RIQؖ9JQR)I$"ă I)t$Xb)%.d6&ڦ\RRdTM6BI"5{aARsRҚSE6nvIE-%%)$D ,U) $kNRZI-h]T[NV6䔤Vw oIK$$}-WޖIVwۂ6IVwWz[R'IY6Wz})dۂ$N6pUޒI:JKzJY$+7%,t}N<bm)dI+;[­"IV oT*$+^^Uw'IV% V@ r[RЙI%gxKr>:t/QVܜ91I2#brD(N8Kz })hM IB64ILa-I)oPڔ$(NBhIKBP$M'O>m))P$0jb ZNTe)NZS$$RKbJRtҔrbbJ]$ҞTw1bqZJRI$)zizi)I$Q=4ޚJRI$JAȆ$$X*Zp5|'q5|,/[^~ ΰoz6c%ug|J XmԑIjPcPV9*V \'$f}W3謡WpòT)rI%dωYKt ⡁;WH R)*OHM!$2I2H[ b<I2u1Ol(3 )R<% b&))I$r&I$+⒦JT)&#RaR1xLR򔦄3iRӋ%(6+Kb%-)JxJR BĒ)(F m fSQsT C FzZkEkX\riRF> ɤjUTٖGs 0=ݓidcFVkj/(8qqywQ57RH(I) $Ea5S :#yUJ4Z a=TPHsmW_$Lfg+rǰ90BͶ< NK=ju# ߔnu]a(kBǶEn!&8Z[f%M[6Þ4Dc2Pg4Y9ǀLwY9O6X7`[l7tL-Who>>Wjj]c$O[UQ谗jyT*ԑNx\J|J2!ֻ^ӣ׀pqT,6<AXj]JΒhLc7j8^D%E\E[%o*:Ѹn 湼\HzoG6,ᩄA Ih v5A/n=fCXtlW5kZo4<,'D_-lXƍ6KZك^SN!H ؟t;^ Am{Ah?HΌ$:?+^Gw q~w5*|n̵Ֆ kq 0es(txI#S߶X4-!A[vr]X/ad\얶`c3N$Z̢:A^U^YkSXF`eUZ3[U 3DVG'u YN K /^޴"#zDN>ǶX[`Cܝt+tRu*_9+]7L {qW/L4 ?>kVXN{"ͻV#z3XAq㲲0[G)ͦO`*ޛEMP?hq%`}4@Y4H4rtkRutNik%FNe(iW-kFuJr h템VyRJo ʝ " *K-l M}88Y_j3 @ L5yg"T?8BD榺\e.'}J@PKpVtQ2ڋi`vA"K8TI#L#mY˃y*km\AfkY^[(QU"5Q ]ݺÅltFKKvr4Ujý0qЈ(j5b5!zXKߧ aާ0Pʈ k^8j֖$(U\ [ Zi㢓jci"%Sf䇸Yє!v4p"\-c!e^܌S鸉~諻XqDR Z-4!8&Zx;n$ ^ׇJ/;ãP4Ïܘ.pT+%ܤM*,y}LWPN@q<Kn}n2I XepI  憴i*nZq#D9@uu tMsn#^c:Rl>j= ; ܸd-ԘU< 9y0eEvʃ S:!! O?Vy£Ekf·^~C`Rp׻f4wޟMTsENs[ͶG\8Csˬhi[Ip*`@tQi #[y>+d-tpUϧ/IZL<)0r#Rc4HW\*C}2Ejp $vL#M."t$IL:S^Ev~iUlݮ#*m{kpc#vxL4 L-ڧdsvmܠ:Z  A❐:(?NSj[,R IuhDX%0Ͱ ۴s$꘷F@HI2ЅZJִ}dK'@F<#D th)߁e_MBѐ6vYV DRkBΪm(pOc> jh{̼Q﹢h #<<0TX꿪+ۖ֝NJ2\E`􆵾A.t̿Nv 4N4=ddZfIV&U;^G0?sGwQ SeXm:Q|KgZ1hhew)P%cʝ wZ4QΡs $7NҀXF8 (DhFl )$6=Կ_k/hZ_j;rٙN9SI%mI$?o]qUjhqza=Rσ?ZO׏|IAU'R!4+kԒiI R:JR%,xJےRJܘI(O BRO Bte)IK$%)JTw%)!hNxN)%t)JR)JHY$)JiM)%,xIJRM)JJY$'I4IR*)))d'RN))dI:J2$%$QĢNyHR'INS$I:Ji(II,tR'I9*2dtRMIT:J8C)Rd'$.I js[)r(N՚\Vd,N< S&NdI$$I(ʉ%NI2uSIR$JrȩI$bSJrRRNYF:1tIK!8&*2I$(M)%)$Qr:r"JN: ʤ9WBKBI$g .RI$ 0JLB8JRLB=I(S$.I!J6%)$CЋ $Ha:$I(4$$J '0JRI$pI(D"(IA(RJRBI%M iBJRI$>=I*I$6$!8!%)$(ؤO!%)$BږMIK$0Q $$HaL5J!)AJI$ɶH)t$5L12[R)I(R؛b[.I+JR% mO6)BPj}%*R(RږoIJ(JZЧ RJĨʜ&ڋ'}TTrR-BPD2mJH %CL^pSxNZ6)<#R%0)R‰! D:JB qKqI uNf%R띕]֎  U“M_ @/8y#Dvdx\/Y?wĮNL+WV*RuuiеY-aOW*VaD%lϢ=S0{Vmcܢš0w e$h=5E<6=삱q$W mV> J BP%3boPؖĔ$$>rRI-%8bHRI$SʖĽ4IGr}4ⴔ%)OR钔Gz}KKIJI)JTw)izi)I%)J(%)$%nScAK`)I&&X<4c iV&!"A%@OK`5m lI=u :Ǚ;d7.̀ytYW\] q$F̜q遼թ)Qu&5$SCZ׷5yB׆CSyȭ]:ɳvƴ8yUg{J*w$U2ӴClwߐUWf^6ƅYZe݉)1 $h,niѡH$$.84[جÛT ̀潰ѩW*Z5aDyL~úx vi= 2|)^\'OLVm ϑKNpi*7l#;LY3oEZ @FL' $tB s3_f9w6[.-p[Ck/XOa0`J B!< yBL0K[g[Fc k}Yն܋ UX@!h㽔stFp;Aed S%ۤ-swD ّw4In-+[SI.t@,;AwD6$+OZ$P_SY>V4?]PZeYmzB~RkŠv(I#PHfV >;*7X Xnke b4 j0TOS}B+ꘈ%#"`!ja=2*n| KDz|I>aZ$I3uL'um@ c(܈HYzH+I_FƴKGKOogd>ט)RtH5;;QM2 ')hʮCkA3%΄4R+Y.h'DY >jݧw(fQt!jhsZФ$HOb5 {WswK3i7;^[d~*O lc%3yqFR,4DTʨgIM`|kklIOjR☓&!*B]]E]cS5Tpir,Te?&T8EiH28CUhmbIշX\@ rV~[vѩ:hMRN'LgRhNV;;ַnṲ%1l)y2B|@:Rݨl%L]GTcZI%E̹U ChWXOhL<0u>i _aVC~<q'}Ʌr3h%&gm<ƂT<-_1/UI^#3P_ꠂ[ƙoWqG9/w2Բ U[-$äFZp`հCZm'WBβ i/-Q%IkN @Z7;<袆=J̽^f8@.qV#$\' F9 ѴJާ7s欶D[uʘv~nKvNJ)._>(B^vneG@uYBcCJB=u`+# F|hfeTef6%g_zQ%@5Q)[yw(ɔn]ho*dhՎ`Fձ>@e:[&4` bg A[RI)C' EJL)&= $*(oM%):iJPQSZoM%.iJPʌM7I4(@Ej^ ]$қr GzI%J;܁H2IGrR9jP&I$ɔd铦L JRI$' HS>⒖NJi@CRTIXjuBuU! 5|'w S7b}^qo/GOZ6dW]]\XwST[*,կǵbc9mʰzyVHcVu_IhpHl:蝩3{xlO˂DIYDqYJK``V|O9 HPI$,tA E%,tniRINBpBI)I%!%,tw% h))d 0d% %*[Ӈʋ*3%M8Fjܛ‘05D>ERgDh"M)sxDCs2Jz4J7?l)d&sqG8/htp mv4>#6/6 j{SdY[B>'d[;=*5. y .3KKЮcCQ!R6ʴNJoOpEgdG :fvdjjkQ+<'[l?aEd*Ͳ?9Pw'A 5'^Gd7F;PC @N]fu8U!?i.MW3{,h2ֲI#U|PRSmrwNh!&Ʉ1H3w]T\[*a;q>[q'L$6IѨ.Niy1-* 'aTk.q?ݳ\?xUaѧ3cM/' c}OPr>w:6없=HP pE/Ov1\#fcӫ\SgZD;.p@9 <2çM/9!T! 4 Z C|B̤kԡ)q" \M8 G^bs[YȴtLm@c"TCvJwdxVppB3Iv@[5֝! '-U|[>AQdٌ#$ʈh 5GU|2˭8N^i`pqVF.glħO`UJDB°-A]툲yK,V JK_p-i;ฟi݁ZnR3Y^M 3Zk%^~nh;"N;Q5r'}ƴK$@jj[]d5,gA'B[[  Hr vYkbg@+c:G'ΘsN㨅nA40msP}6s!ɭ<M4D3B /Y\nu<+ tp4;sa܅+FA#rS1(n᷅A,׻Z;hRǻӳ>V,5xNҢ#ThnwD S@xkveA^4;׋T>U6=BH˼}MֵmoׅrC,G[1\dzc@9>iOaS'Z ԙ7S-Rp5#Pn{[Tǹ#9wu8v<9N aKMy) ,ӱH2}un A)ۺ$):PocM\ZɃ #h>26 ;YԘ6@$TKtH2j.,V\ U3e`Zݱsc/!ppkrÉi3Smk;q&8i"t)o6oֶ (_I8MvrڍBw:"}L@OchmCm 8T:yaAi'⫿.;WY4's01 v\%E?ٗ;('wFk{9a5;+2Yjq.Ll9* ;!}-.#! k%f3;~1渟iNFe8*?H>)L$Cqﮉ1ipi2&!縁`A<5jVۺ}mُp'@ x+ (7׻k Ze;}IH*n*qg4K:AG.dԻ6xG N뾹 E4]$f7 ƍ=VnvU{!3-LcPL{rzG(/ƐO̗ˏE:+='z#7;B{,iL{&{WDd'E'W:O+~R>+]x7Iβ@[/di;#sɓ ]wVӱl2.\jx .GFsw 9 y+$2xsi;@]mӫ➪x+'@SS| k)lt9<@e"%囏kiAw3YG6GsVtz:vJϬnxC|YGFDsN/|nsƇS߫wR@uάC8L׏ixVu[lacj NX= DKHtNe\m^cRI;ݪJ7O:x" ʺ7< =}:H>j5.Al̪uVP>kh(V߻^5;Fҵ[Ә<9TaM{ʫ.h>e.v:n=na0U])Uu E|3kDJ r1Id}zFڥvDs=X=W>(~"tNgʽ8S"SVx¦jvdy@=EDG͒0[hĨG軅;a/[CL %K<ϫ}{O("]0bBZEuRɒJa/`Kx!Ѽ8 ioC9m#ɍPͥ f#5)@H{L GMύ2k3T>< Ej,RCc o՜G{?N,GK,y*n+Pіuqt*9M肚ڎDEߢg5žz [$4 ::M-ըTݖk6t T %m<:gl ޽d7<[x [v5ѬJ5IDcM-`!f _kF,y\2mF5NܨJnCŇ= +*6ӸG'Tk'T-$܀{1]+8Z~ : Ū+#w0>2.MuTk-3mf_vXV2j#h1h]yJn>F"G sJ*w%E$/EkTݿWkggQժqm4Kf[2WJDI?o]VX~Uw[?uc.;yRPw+$<+KԒIJt<"I$ɓ)I$b<% )tJR%(M )tJR$R$IJB*Ru$<$M)JLBhA ԔE  IJI)JTS)KbJRI%(UBPHbFrWmj H!# J *k6AE+@1NB rJ Y:da<' $$P'I%)$Q-QڦL$J]$I)$'hS!EE%)$A**O 0I$BtI #g+C$Y:JN:"J`X풯$IC(`#$:d%3䔤I[B$J{B[B$HBA{IJI$6؇'RI(R؟bEJI(J45U/Q%)$(RؖQ7P" l~^JRIBP"Ї6$% e %I`KbIJI(J&, >M$%)BJ[B[BRI$Ph@R$$28<Q?P BKIK$E4JCrm)dBP!8 J2$NAܖ4)HAܖ8J mEɷ$0)'Gޖ nIL iB>-%1T(V=DE_r[S mSJb|&ܒBxRJ4SJY$)IAK$2PM2*RI$/M%))yJS%Fe-R&IbbRI2JT7UK} ZcQO0WO*U:oH^s߈^=c~2w ުO[baRtukV+,ZD) 6[gtY%,{U S]“]iA=E,>P:)p\Qd=5YK`V\! &,M"$ImL[)&ܒI(KjriIJI$0jЦ:$$%ŽS;rR*ԒbR=4M[D {)^ ~I!ti)5D?ޝ<=c% y ֥Lƒ N=2Z@Cv|P{o1h#(S#ۡ ֎O6JP $d6S[ݠyZxL6ze6:~lj#{ 5T3s[v'B ='[-CICR:u֞M]JXSa)Xj`%Mߚlm&ߺΦCN*Έ 1epc{GϧBegsHCz#"÷L<*'F1*wUp`*.x>AQ\  5׸)qr#[)Q,YWke{ c}W{?j6 o+Rf,:Fĕb1@1` .p٧Md$x}ƗrWwT)KZ-s3m*1\), lJ9_Q6lj6ȅa*z[ਞCM9‹ed3ӻbX4{µz{ufO|^,p5^X M2]P4 IҥgM\߼ǂ. HVԚ@ ~X=fitY'Jô+OjEjѣx(6B^#QGѵbī98[z!:W晝U;U{p$rFB2P4_)<X@&OSU.?[vyZ.Ud4n`9(V2DCVx'@!A9P1ě'̬sWH /}Qc:D_elt^[&u;(0BY1NC-On!§tq+.;p nmJз}@}*N떸A:(۝_%ak**$CΞ@;3ϫQ ϒǑvL UX5eA>2sҥjhjF'$nPȤK> `*m+R`NJxc>agB O (8'nA0A$Z{ZX%Uh'AjMj+Ȣ6VZᨘP㪵ͺFKtvo۵ -3(.fF(-+Cnyiwջ~oe_=Rޜ߬H3iQ.g[1D :/IyVIVGhjGiU6%YgM"'}q:72ɑ"mq&9.L]&?Ac$;oBcG|F=5 A=Up N䛕g8r=z <S ];:V6Y"nحYN;`wE^3[."W4_4&HTu^&L&mVA]]Xx x$IWG}ֲw%ô˼.|󧂞ǻU$9XcR1AYdd+5adX$Պ Ǥ셵^@SיW<3!JR0 ^W+!Q GҺ7]!m->*gt*gM5N-U̝*]}_x-k+alIt8%mj7!i(M ;̄5Q[g-F_~|KT:ޤJL`O3Lɔ&r `DFC n;t5  7 2+bƺf[qn!TsF'eeܭ*w`8jѢCd!c!涂\5칳R9Ig;(FI6%TSN2֞]zЂcTꏟaW_)!d}C ZD&}'[>vUSԬecO,SLl7&J;(2\819#)ꎧA%FV͔R'HC{LHc0@*>)1```?i$+g!Cu*Ce! ;F=[$I(( J[aU09B3PNi&\斺'ҙ${[ tkf*{2e;$a)|q]/Dx) ;vUqѵOSaa:v q HRXZ6pE! s,(n{ܕpaFB;JqJY0aIe`UcdQ2׍!\ wtP" %D78TRN_t);)31IsJ> '%2)|Cжl?3DLjٖ;}6!Qj~C\ %df\6DJp}&a>cn&Jo-r_/ŗ6Jߤyql7:;BEM1t荇Ys[=?7¹ 0F3lKd7i m\d556!fw<~֒tdu;`4W/;[jz @,:Gh@\D:kocEPI)I EжSة(V(xخlE9PMǀ'X\:AsTg#F7N\$ cư3s ߺ'W[*~oQGj};SJR?WkdlZ>u/Z7ܿc[-IeII$I%?o]VX~Uwl?ZO׏|SQrI [^$I2E$I$%))I$t2RIbR%,tI%*I$JiH$)Q%,tҔ)t)$)2t)J*Rd)&JSJJRI$2iJPRI$&%)$I$Ҕ$JI&Ĥ$tJpRR'IM% $O BJ;ܒI:Jz$>䔲IRLSJJY$yPJRRN$![RBxJuVTZrI HBw(ЄkL+6TƒQT]֍,tM5sH5>ThJ%)E I6Զ)$%mR*RM>ԥ R))J' NBvr%D bUTfI'ڔ$*RIYgV[eQIiRtՌA%]z\e$&NAFln$.jxLB*]$@ږҍ>ĔI)@ږҏ/M%.d6H%.d!-{R&JP6b[R&IUM#ZJ]$ҚUh)AV=4ޚJdd7ĔI)@ҏR&m(*ɭ7t%*Q4J]$Ғ-O餥M)*J[UR&baG R )t&\0pФI4_)dV餦RMU *AXpYR-ʾgb}RR)U4V6*RIMR_)zeYڔ%JI-RޒIX%ܖ)JUcRoIY &%%ܖ4=%a2T܆VRII7% %[M+III7'܅)*^S$4EI$dҒKrH^&. %TA%4A M)FTIDڛbJRtҔySږTPRCȻRڂI2IQʧ~Z7U"jLzJ}D/8?Ϸcʁ':;>/=λSU; j$7WTXamB)Sʰ)!-ҏ0@Y%VmgU(“n0젖~Cu.J2%fU^eU!YC%-I %mIKRQM&$F )t$[mu)6EI:yuSxScpc o#7Gr?yN&5NGhR4HZv OIt hji;WS\6@⚰$j  >\ZNkcP['O 5bnxnk: y¥}^gDwf\ 6L5[ln*D6;aczzU9SF]\ޮkyd@nq6CGީ CguG>FRŧpjn#w 䃋]v]C F9%>f|0+GSnkd\t ]yR\wiΏeXshZ¿ gAG@@b B5),$N:gD~^Ukq۴%l,6{'&VAVkC}㵃̗qIDL~@ݿ!h`ꏭ, ;k D~H ~ksZ~z-NSNA gxTy=P0w286:}x[ ?Edߒ;٣yF=4j rQSXk5*8kr'I-eŶ驇in̅a[LڦzIW|T%4]T-v:$VtnZ4*F+ +m ԀW[k;UnaJcc'A#rNSB}q;3i]VmlABՑk4g&/ԻݽÈM kճ& gboxFs }Jj %bBaǜlBD×өRk_Vl鄝~s@1՞S!j3xkj%47YD@WfPc:VgndkOU([ +خ6`1-k>39sUW\@#PQ R$ .ohgYD+AXDbńW@\SrEfWbժ8ZcaR ;~[U٭ǭG\YΤJ5P'8Vx>OYV#ws⪜Xl"Pz;P]d$a\8S)2_G}ŤΥ*Ѱ`ig4 )ˬr3POP1;+[g4Cڅ?>'D~s8rAj70 jK,[GZnݯUgf<̂tAtuq[S(i|V3ՌvoZkt='tReoxnyAW3 Iu)ztpE.vpdu'mGf#m*b'V}TXElӲsEg߽+u 'ؕ:=ߚ%D[gFI!n4S[ԩ_{բoS{T-ٝUqa =9܀GokL&vM}diݷpIQuª˻p-Hm UyC l9Auٕ P&A>)kSd]p}4Q/wa)$3nԠUEmqo\gRwGΫӡ'溌%U&)Q~6KLl?rp__uD)΄;dGwa4f[Dc-񬨷#uB:kT_5PA*-? 0l4>\oS2cnWgୌf6Rc[N%}^hd&eI;&|;0 Q~ԴZjtN`nipЈSQxBt!R~ 2V\9 @y>Jý.xMQXxC]g)ЃT{-FѢc < РLR~RZĞ4Q{ɽp>*V[P0\߽6v.Ӻqg6d 㶊5ǁ%/Ayzq)ߑX@NCJOtF F<@+`p vD.UO;M)qu ӠU총!L`;"WxW ʢzG U6#O_!_Zs@xr]ZmW)鵳ӲT%S`DyV#D|gG'ۤmIjàh֐{2uSǡtTڽܟ'uK!bR†3ny&3> [uWGKZ\՘/q<,g^dTN&C73/H5'Kc~ nOHF!׸ICc7'caj8Hl"5(WG(vg:xYyy*xB${Bf41-@.!?qÀ#Yp$];⏝~G I셛cj j.֒gE<\\KUWl:`."wܢ kH@ٍn>oxx H&~I wZV ?Hx~N^Z2/Z%jWZU9ۗ݌h́Da(Dp $$_?o]׃Ujhqw^?k?y?xˮ直I1XrT¶&$)JڒJR%-lIJI4*TSŒJR!(IKIJiR$RJT%$.iJP˜bWI6҅ b[S$w%()"M$2I6!xS؟bI]$ۓJ%SILQiKj6ԶI(R-Rڒ$)JvڒJR)JňИRQ>]( )*2lKb,$IJ({؉BRICb}IKR{hJ[`BiyO*:mhJRZ+UPAL JQRɴr叟a$ڈUQ*tIld"*HV7 bS)%I(Rj*{RJtИFLQ(铦JS҂I'%6ĨIBt7vBRJ(S7SJr]$Eܜ9r\'Lʮ)XqP$):I"\"ʍh%bICa1SQrJRI$)JiJPR$)FSJ*RPJ[P%)$SܘHIJTӂ:JrTAJQR'L)&%E%)$)R)%,tL'PNI<$ܢ\I:Jd%GrbRR'KryPI:J[&)d$r@!$IL RRBtARB8))hM IB Ic Bd`AJRSBe=()%1I2 @0)BhRGriE,a(O 9r[IM()hJ"RܠJiI BPJiPP)nO*0)$1r*$0OrR)Jc :e9I0RI%*2!FJI<)NB )IdM"BxH.Qޜ6ĔoKzbA)I%)J=P_L|;5YkGGf/%_ tO_@?Ϸ='|Bj>SCl/=_;Ϣ~yRqo[Ruuan}1ܠV¯JAJͧ-<+>(_›/0젒n 溑\:Ԭ]%G+ )a TQa$)$KrS*$JY:IlLݐ|NUXwGLt'HDun#Yɫ(4$y'U6^sILZxNJQ&-:XyZf{wFlߤF@IS RLP{Μ&i k“,(}R.`9"y'\ :0~ FI$LO]DU osMxK7<2VtYRxMt[lhG0COe~F=ZoHmxI8\kgig{ɗ=jy:YFt&5rAƣh3efZH<9s##_W#uW>i+3q)k˝GĤv{#6΀mlMS1 n<=˭I=PuUa;=DPHZ8VTiħԻWs |B;Jй `:y&VIw OTkY8n$q Eӧ ի:J_IHԛ\1miybJ@:c+cUH*y!$q]c1#w`VVWV;N,e¸ޒdWw4po%Rl7t1ۚIV~Li2?U䠳d6IЂO &0g jlO귀GޛUḦLvUŖw'qs&{&44n]u y N`Hl wy'5DWD=!!]n@ z0Cbᗂ(^.>eOȒYn#9Nչ^wH:J>x,e;);:mT[pSXu05S9}̏reЅ&}-Df:<*;y~ŵf2lv@& &@pLAZc *LMЏGxTpÕ$X}!KLrk LߋdaP9ꄾżn%Dʬ -h‡.H^6e=+Gmo2HJΘ< i1ˣpW\hPuo }T=' B I0D}YqlK_˓Nq9 710'.i0, AIw'w5xsO꿉GژJG ψDsC)lj1q 1DVsm ڬӊgb!I*~ܖt+~Zn%Vf{ۣ w)oxc$HS4\4M΍" ُlWc6yNSj[I?~SwUOSsv-S䣊 MQ7㚻VXAd?;wrr}2ir`z.DhއwUY :Pnhg>ǼDP$̭ {d{[jk5!@g5KDv|*4pF`RՁ}0~XN_Y ?lqxN{.By-4q UiW8OeAB 2@u%H9,`Q'ʟg gOA-f36<cE\W-MSoO6>+@h)ZŠ Zhz 0TNNj3/tE˻ͳ?M"i0Jv``-GfgW>%729U=)&;4!4\vt h<+RMs)åglqC9$Q.g#G: v}]yd+mw/pvV>Ht Հy~ccrMuC78:kL"y0S/rM5k!@AP7:Fc<]C70{ʲ2] }PᵨEΟP-)zg~s 4=DUK8W9Qf)b$] `dՔ3YI*$HWUH<da\.[4l;̊ΤݓT `*B{b5R_yU;,8`-.@憩ƏvsK%I庎UH1}%n`P}(Y)p⫛O^(aptp.p)} HRF j"3ISOBR9i}>Б3Qm?Uw`H:"B.=]LV59ܒSz1=!UU7P~ /(u dFu!R7Ovc=#TIޑEG4 D ma$(Ԙ|=bxK?4cdw XoO7ktSV4СJىp1\FD=$+z}l3:=?i3q)qW+{KLqvo MO om$|~{U eA'ޕ\@Q˜ 2]i=ߔa{^`VC)'jM$佭q8M_P}@\74]\X4U-pЙBǩ:"瘘D'l@K3#;瀁e%xK/s̉UkV}.ȑG{I/;N5'ZKK[3 wtdܓøuV=s`n(["lx"py:!mxNfAӬ!O:p2 NeMP=羠(4NԧZOs=fCġT"VxTAJ $e_'kd-ZL^_Sn?ƉljI[cfI/?o]ׁUjhqw^Vxˮ直%NrrdҞB)>䔴4C/M%1IJBaGrbRRP))BO )T%)I+&RR=ɥ%1(EܟxAP B.)JJc B%ۓnB%1J]69M))% I"Kz(hJ6 M(!mmN&D4RRڝ$]oCI%--SޛzI)hO $-0 JT% $-2JT% Sޖ)AIKBP%=oQ"(NmKjJZ'ޛzm4 <$!8iIJН%6Y 8D$-nAɭX@ͥbgrKd(5MUNS)3I% d Rr>x @I,4$<"Q $rIN )L@䤒I$HP-E*L3(L9LjB+R:d0M))IIEQ FTRRI$J $ HoI*N:r[!4$$I˓nKjmI$rR𒔒I$)BPI)JR$IJRܠJRI$)(RI$䨒 RI$rH)I$ĦJRI$৕RI%)OA4)C Y$"JR*Y$Rҙ<$$J@ )I$*@AO%,$&䃐NRД'I9KpB SBe2䷨AHXPOD5>ҒPR&ܑiM%- )O)1)6ԔtҔJJ]$ҞS)<IM)[RB$)L@$JyM*@\JBt[nM JZ}())hN(N6ҒI<$Jd$tRTZJ#_ %R(LB5,kRVO\ϒH;0)T(#C>+Ѩ!yG3 ?ꁲ}^}?wz @uG|SXZUr f.?eGN? QrΫ-  PbG lCFvPgbiV:~X풳T n!fU|VB -;, .JSBxBk;jv(T Qodh? :d "1%3aV$i짼<#_N7ncJ]2I) 6Q)sK6k@ 9 rPqCW;Z\W%ն:!KF>>I1.^\3ⅅf=Uޕ7h+ k{aqr/IGjlλq!ju,m?e K &z0% +#uv Qq< `9Z+ 8IThnCV_u*12"!2͊/ckk\}sX:"P} .BU|kTt8܏;(ql M01k<@}6y@96& #V8 >(ueg'bP8heqZ*)ze ¥ICɸO*2MC*\Y K+LL,qvGUfP^e^y$viӂ}=L@(`VhgdɱACnZ"a!ܯP0?AhV[~!B:y#Ǽ^d AJ.slh l{΀hQ<$mA-QhtC%:HgihWhqȖHF7:A#%SDtG Fhۓ4LS!yMjԅm򅦑R8 SW ~){` &IQ!HWt(4J/n:?-}*¦q\u)K4P7@yUn;;o#R\g\vjfTwWUƘQ9gCINԚ!G4Sgod+:{7(4+c2N}iϲ.q%W,l'9Q"#}jtJ25"<鯖残CDx&wSgtZYLu gv*%'R"kYmbQKc^9̯ICn{-WY\n4tPs`#&9m!sl,yQni`!LR{-J1?˅*zg p<5Iu.PꞠ@MǷW c{ BlZt.bcW`S}?w(yH'R=pjO;:us@u ;mThf(Kx{$3@V_I{I6dX6[w8ΫfiU6YlpxiGۻ)=YgG4 A 8K$:KH0ۙc (VK)%CLƅH撴OF o*])i$Z~jyASG/2MǠi3Y2BΖ:Ƽ 1<+6$,譳H||1׺C&R9zm pZׂ_QoF*2$<>8{Uk 붙C/QQ#hƩWvUABУz +cdx,F\fUu;Gt?@H^78{4?#3oL*I2Vu CB!ĕf{ ܃΁(#)_ReȳA%&g!lY.I(K|V)=fu>KBqy r7/xIWWGMw$M'Ԓ'PmLjk5|$i:<ɑ \E}P^=mlc+ {%8ͩ է+J3r('wl 08Y>[[ stp]M-R*{8hi0UQ֕LAtac8yCf-Ĭ`Tpk kѼ<uj+9Ǒ[NJ2KwwKx&5Av产EEǚ&I`4[Ǯ4Ypqq<4W; 'ralw }$rݏPh$wRmV"OcbR=NjVl$90ү k!+BZ4Sv.O:vZZF֠Y^N<(V^~k$=Z {%35&h䕥V{gu1 W>E$ >H$87luPa[eҺPKQ*uv9Uch IhIScTj^_u~Lj%XLVՇu^#J@gnu/l{Ԫt3c8HpS yI cIPޑ hG+{4GդC]~h=ѾVANt%KP‚UҝH:G- !'sLʶqorUC)[ԭRxHbtAoKkeNYA^KALzgq-liʹHf몸-kh(!L4i3>IFW*q 9KrJY$"nOI:H9O%,tM*2 Y$)rTIRFS$NI%,tNN}%)EK$%( iM()diEK$%9M*2RR'INSIG))&V Z*H=%,Jm能>%(JtRH9%1LT(G-nIL5IJmAܖ2%ąBےS”']>>8Jw)JRSO P"O!SILa2%-)ԡ(FK(IL!<)BP\P't KKCR((LNJR9@)BJRI$ a8rJRd"J[ފJVwZ>wU}(D4O_ =WB΍!hV1-o??W]:+*6* ݁Tz,sq̅酵•*@&rY,WYr8EbO dw+};Vgx\Q>+G$?8D#)oJeE;e%)$E;D(n j<%؞9)-Z)-Nu CXA~TFw!;] < $JQp{w=>^)wₔ :r0F ;)Iq(ڗI2baW-0:O/jfƉZ$RQ[9kZt'UU>KG 0wG.u;"N\ђ.[TXH_8VGEVT-:uvq^Djյek}IVKw> Y%a}7tvs8HxTy e>`]k!%b\ghu{7Y=Bʹ:U&{+9"Uj*8 uuzV4 'cK ,Mdp"k_4U<ĕqU,r93_ y~+v S>vK|U&l] {ldkuc@ s"1vK6p̏Zo/A+!cGep5D{$:xY&F7P7vK5u7!eZ\{6xSCЬLV jtKa:B,+4R]#ErYxC[ 8tpT]牅_nD](s27T}o-V각`?TV~.t#UVZQ[ĕ̆W^ ]Lޢu;YM9&+2as01=2 ,.\ҳ2+V΢4G] (u|!Ҩ+UODTb;ܭbܼ>fVGЏn VTVy⑸6:'txb' sGfvcGBfnB6(eFH}ݤY| =7tī@<&[m2vk}!'Bͮ$$@gt Dк;B5ջs3@P}f=B{i<[dJF=+Nw;w>ʫ44ƫxD*=8zui&,=]=]*q*<9Wct`aN=CYޮѢ>HИR@+l#EoZLuFLai+H7p#F.fA,aj#/-2R<u! 6MFZ7٠:𯶪&>J&p U;,) 'Gr-^Ectk*& CaXc)0-VOdQׄҕT;iѢ쌆@;UY&9]Wcx#PU+:M- V%',U4Zw粤6 RG L(OZ9y%֧˝@aRHƝNlh0t7i+/G'*&4|d9"`YuouG'zp|VqI1ѲYosݷ4ζNS!FSx$X$:WCGG#w);V< OՂGh\ ~NSCzHſӯq=n"HTF o4KG-V!|Rs,vK)B=XF$!t,šqU{ZIxԀU.aiO%-|-LBU]?#ў;5 x:QOB=eB̧KOVI"< u=ű{k.akm-PZx=!yB;:i aځD8–P"!ÕE:̀A[mC^'&kK7*N(ip[S2yM> t2֝8r,[Ҵ.uc ٲdI٨:Dy\NIiN 4!T$~lxPTѵrxU`lOaĩ .)n$BoJ)|9@BJ6qPDȇ8uX zZܤ77 r$Ou kHMcۣLβTk$ت5HT=BH< D\ I lh&c$V5P-x񮩱M-Vւ@AL'ߟ%0rAiDƽa$AW]VH#E]Es\wpn'GTnEԓ8BDn$7nCUJ38 WPeCw{3.씞B) #ṈsU 38TXIHi. HyEd(ZL8FN>Lk Z l `fuM D5Tm32nR{2ʶmBޠ0u۷kD K )i\NH& 9h4qXϊhop -N*䇹SZYcݯpq`iwXX `rfytQѰ*?gC$HV錚fpq>4zn`pOUud8kxBjsX&G*)28KDӔo]b|6(M~Hoi{1T[C8Ug`R*i;1wh^GV3)XCF<~| t$N{I(Ԝ@tEWcd ^O БGe#hqpBvE50n㬟#mhkTh>U}s݄U70:J3fA cOUDL˲{RQo:yh'g3Gs{ɰCZBN 5E70q?x[f܊L X y'x`Nw k*:~M%h.En᪲,q&|K'@Q*,sTKhe.40tV+m;=[Y8I33A:&u#@;U4;y P:qkcRfAR=3 R49uL+$2l'ڢ,nR<*E۹vN̶[taP!L<-6\'I*uS٠)nGo3UlccuxE9{i-'PE)&]l $Z{l+uP`;Z900qg0oE>HAv`Q%*DT[N`>ЭYUPƴfpZFB#qH{H[c Js<osa@3\@)7pۭC]2~qBZ_VԫBH]VӻSi}* N0iXUa&mRuWnK)x;ҵYs5V4G`lGH;DF8'gOɷ֑^F~(2!&亓:ec]MLgGU_v$JR-lKM"JR% %6҂)JP)13LH*&V%\ X2RY&mRQjejZڒ銻hH'Ar$hJPR %HRI$1O EJI$$-)I$ ;Q!4"$I0j:!4jBIRd鐬rXI $S)BbRI@I$MCjIJLHID)J Rd鐞 & EKH;m*ĔUb[RI5>p-%.$ҫh֣$ӨR֩lFmj[R&V,MY,KbJ]%O*–cb[R&WRجzi4I4 [%J-Ľ4$Ҕ)ʲ+ iRIGr[M6kM$I&UږgKIKQUV}$¤%O(!i)I&W *a¥1R ])M) ؏%餖RnKrµ1RJe)JrbҟiVI$TSJmDlԠiIIeT*N>^=g-N%gʮD#*t5 OtⲤ 䐺II];:PN1o`yEhv2BSN-0W/^1AD/vjL.#>E -c!UǕ{3ς2^)ϊ[HPѫen&ST% e\:ҽȘM.݊`6z.]5*Mڋg*=3!B[㽌ڒJhs1;ɯ$x.BsB')d?\yK-XOZ}:5,v֖JQjXu .i[; \B(FCh Mcڼ*a w];s, q~i#V:EP(4+&qm4dRYFfV W~>O*ٵDHl[ӢoPLO1+ hv !Nn3L3CO 5㹧E@T8R9mC0$hIi Y&A$PoyqTsUЫ+z`- y+:4g+K=+1hzE$[CHl,TRF`㪧qv=O$썼U4rSd*kHmhcXW2}F &̆0 P NƂ&9]P| #lL? ң꟒[Ԁ'UF!+I >@$>h} }FhCYh@LtSG=keSdUwg[KcxCu$o-R=:5!dL{*w.n0(ǦaVm%HxUOSw'pf]Z2e:{DLNq #TF;N -oZFZ?٘ۆZokd'W齭I@Ka{ġ`- qKrG9x%ZT44N)2*EtUMjCkb<3"Ws(MӸjF.ڏf鵲x V pv\yfɺF!HI( \bu}v]fC[*/}ru fSm<(-}M6Ueݓ6"z( \P-> 7 C=P>Pjy:&nEhҊXZd;GUNXY> Vp<{*&#e}IBY<%#ڻ*f&?yJ T(d4_ё';°k)Q){W#[{RMC7"]jhSB7Ɖ0] c>>^d"Ył+AD!&Dzw< ^nEpu+2s5;3aSu@DBWN{Ā4L<6%<纱PsԕT~{,@rD-VtJCy . 4*xi ,e-VXRnSwGr;,Qjh/[!*i!!3(U;m08{ia=n(dabu$ L6JSqݮpx&fdLs4MVQ:ku rC~bm)ei2g7$)Yc+Y;~y MɎJwϤVhȸH+TW :V=:J]vEk+!BƢ3gsCWyW ~P^y}к/;>WvpXǺ-n8+t t WryTk_Qjy&r8*];W3 T -ʲn;B(fv+@|T}dDXpSJB\"z!5uN9tj V ۩Rms`55HpS;h>V@hw}B 8D$4 I㶅Nn'e~C_8~S4!J׆Iwu^ٍh:t6KO*3פk]a McfO!ݠ(c:uIP9; {' 8te1.xR nãlrOƂ_j_eŮ dZRT'$h~s*=ZnY.e`oǏp`:8Y8Q䧫>̙B2;:{Ԟ,pQ8ӫTg)}Z.N# XfϑP!_+4j ?zV_}/eH3n"_Vޱ~TN'P-- StsƜ}ctS]w eB9Yg$AO$UD%jLWql"0q1y|_Ht6w)c[,Yj б#DCw$?"~YvEӲdnk"tYg<, SjFΏوyvdUi7=7(Q=-75Z,a%;CSv2d&%7\&FUTE8"G*˳*"W^ƴo$Uv236諻_L0wDR~ 4p!! 3yBnm!2#@ v7$?@wtgRU#dg^ K{?E\FvP@Κ??rUZ,i>J[Q5hUZe}s({98C2I G%J97G)2kF5ÄχQY.f/wt=Yrj&6XL¶[vDZVcnk!ܪl>:'hDa |!^sN_g0n% Z6b0oq1vi^$"*RW^t >{HؕPZ71'CH>+$\cq'\j;Nr,qDoMk]:fhO3;[~sμ7@|NK8ŏ)Et4t=Kxh r{OV6V|Êb(e 杺`򍍃nDA]%7*ub;zChE~k6\6ܘ2?Q.>?cIjEhc%ژR.p>' .e`ˈ pC}Ha{eEm# 0ϸ$uMaej.XDV3V/I'X '%wZahfdm%]D2bA~j]U慅 $Z}*ZT];[ɩVA/\;v)gd+=Y`B2?2/"jė)V]KlD zlXm)chJrEm $q!&mxi0\lޙŔ\OS<@"Y-Oe'1)^*+]U&kTB#JE%QqggC`2Z+ڪuN[*dE j1{ڌk<4^ ?^#- YVZH9Z5 <X I%2ĉ$?o]׏ZX~Ux?k?y?xˮ直%Q[^I'N))dnKrJY$)&QܔtRIFSJJRI$)JiIJI$JRRI%"R%)$NP$)$"%*I'SO)!dI:Id)CथN$(rN*N*ISܖ-S꒖I:HnP$% Sޖ4JZ"MCTRRД'Iz}IRД'IOz[I%- Btw"֫ VjhQr +ʽRS&ՑUr &2tNVeV$A I1Rb1E$J%TDTO)Pڜ5" I$TKSH)$Ljmɷ$I-ɷ $IQavIPByL J]$!FIK'L&8LBJ]$$&-)t$D5LIJI$CT+T&N6iE I:I(M%)IK$$e)IK$$& Y:I'JI,I% tI1jhRJRIB”'IQ OHRI% '%I)$P؊JI$"I IJIjm$'LŨI2J)mH"dP O d(I'I V&NRږ@*2 E!DRd&8JB$%A)tɥ4mJKKRS$JR BЂ$RQJIJI$aH )tҒeJ.iJP<)BI)tJHd$Bm)IQ*jbJRt%)0JRIJiB%)S,L+IK(UJf?,EGf/;8 /:)3Pʸ\4V# u/:Ez6hK|?GvGơ\a[,S[B%(C"&OrP:5UΤ`5S0!iF!iM;(n K? KO+8NqY沫$7)t$P%²xRCBVdOq[,f&e\\y2Y""Vx-?*³]b>uو5\ah8 ۶ E)%$k:s GeP渎!XKbA ȔG><#]%,v/h;:*p59d|#YCn_`fˁ"t\`i撗(6wW2Et7տC:Kt ?=6i' ӫrXk&\DR:QlSt5z:UF&ȬXAWVZĈWEu>0@0k'4>_ɔ8]@X -$*o%-|5|7RyyƘvA<Si64j15 LukOiZ (=2t!m>/a21/!/v;~r\>}XeV>Kn]FFl'bTk4XxNy:kPΜ·1z#E0],Ҩk<]Njs~F**5[u@btO٬hl x*vLDr JUA KA>AQ P"VƩcOW^ߥ2Ȅ%$G##Әr;* tjAW.sIUHn$ދ0o {Bţ,4B*,j-,)U\`; uʇT&ӸFnƪ4Lf[ Unfka cO'ٸAOl βcWsM $rSTm4xhDihq%-k5QNPO;]-h/MpZ|Uw摠0s\iHbFF9~̦cU.~]cOZ%NƎ!Q6:{$JM^4.43]',O+RKS^IT{BEk"US?j{4]VP%L|Upxۢi"wdؔx).ӭi,{*W;Auϰ)c?!.oGhŸe\+AUUx'/074Y:'4}nS7_J8sϵ;EI+BC$rjfV y㸘<1"O~%Yk@C?c؀'fhK@ Z!*mqvV pY\R=P6!G:yˀ('-Ӣg+dHW: p+(4\Ѷ^tirS 5F.|57r|Vx%G &-Ie&Tvno^K*23;E@ H\ hxTXWTࣱ@;*} `% ^e7WwMõh`73> -Tݎ ܰ;g`<' =BG ?kahlԷ&T7 GtϒgK^ÀL0 8an\1^#XM2<~0{ZhvwY/d*:, V\#RjӡRFxΒG.=^NO2,!t vZ:*$i*a;ڀ.'ϔ'Ȃth1%L(th,y-qn>=1Tu˝;--h;pvC> NOc$ƷU:Vq$*; mqԞ}Q=Ѽ(9)X`7vjN&PU% SZ%=|v}"{WcwyQ8Ẏ'4ԁRs}cXvg:"N( .pCh"Fk];5 )U鼗?DpaCyy6(LFҌTl8\i˿p?r]UAK-hDhT\~3*0FZ^ {jBI0 *ݶOa2u*s 6{!@- ({|QZEiݱC׻qIմ>p[=(@*uX`Ƴħ8D|ˬ{5 M)c7Y0uqsy] :[{;cZ6! 4Bb3x8f3B$#]|KuZU#ǟM5 mQ{\+Skv8,JCPׅk fйVnI~!!t]HSELM/.GXj9t7ʃfu\_]J[2FxqYqyQ/I|}Q=D*-o>X?kR1a^}[FOcOV4@ےRJڟr[R)JM-nKrJT)$Զܖ䔩JR-mKr[R)JũmH6䔤>ԶޟzJRIBPԶޖJKB[oI I(I8 Gz[RNSoKzJY$v6 *JP4YwW8T V ; U@f"-Fc)q> t:,gSeR4U00VPd*cj#X!W{dG%ޱV*T<~´KfeWM!L@죜FܼwnYeVFNucHdTYYyy>׃|5E.DFY{2۵h +mMBz[L -D;P[]6\F+E2`mJ [df8pv6zc+#!7 ]%k!堆3mF @+;ݻ`rl#uGv: Ï \$ Q˦ճRd*mqUΡāɃ P54!@hv=i zOn蛵PDZX]`!u *{Zk$61䞻`&szuԕN`:dr )*44sNdKȀ5Q1.{˪&<>.tk 2(kdyPh 5Kcv t٘uYPysZNecf`zCQ1_(R`S_"UW='DtxT줍eFK2Htðl~Ԯlm F-6V15XCuWZn-xnuda;ia0I gs\x_Smj;;^Uh:_#(:GWb k%im/-ǀ̌[x1e *×Nf,?L<(y^cqIZ+8I܆%V W>¿n)hx*4Z V"^&e6V9UR?]SCFp3ΗhTiױZw {5 7W#cIjtb{۫J2mxXWZIʳzc;٫J̺V:N>f͓Ygˀ'~c#p:j`4VO wFȨF>`̲yZ$$xn)_xd؂AWΩo :s/oW=WQʐIP\Q*HG-Ixl Bcm`@W}U!lpr}R@(ySU:X)ШX_R`q9@&0%(gu8Ǚo9;&NT TYT0YD8hΌ^EQYa UU$'=@P_e t`F8t Ys6]=7,FTQ~1^p3"5M9!MZADPaS#5:w*{gV:}OO&õG.f6\#[;98]Q(氭Ɪ*2ř];Nq̭Wb~ P%3'p%PNx$՚ /œG+7V0 *&ws>w Ī֐$ʗ/igAOm$DL|v=~hV >oVL (\t(6dy{=ŪHfkM5_NkH{XRýWAOvOޣrm+q=W  5{O8[rzmo DZ:;EU[k8JƐy3s&CDs8_d{E0}&Md4&IT+7In(;1= ;'ʱ\m wZӠ*Ѧ;]#Y(ͭmv`pR˯l a8BwSc$L=pѼ.v9\SZ@Y0SSs X'ijY yG-bA$nI{=,ϦyZ ( Y}ڔ([2N)_o#Ѐ%;<ڬ;+vѪRִIY=[Q=װx@d%[=gXtP`Fl΁`n0qYY$S6Xyq>j!)kK WW_uEhi_x>k< (/%2O({%IH9HU1 r8b[SLJJT)(H1lR#QլQZU9ۗ݌hʕ&Q*U$V٤K?o]ןZX~U}w[?y?Xˮ益)I\J{RڭRI)CIOb[R&A$MM)JZKjJ]$Ҕj{R IK6%%.iJPNڒI4(pR]$M) P6Ĕ:KTRRR& -Q6'ؒ$)JEږĔ%JPuJ 6Ķ$I(R6lILQFQv%$.iJPdb})tJRhFؖĔI)A$}$M)J PQ%%.iJPv}RJ& [J6R&iJ%$.iJSTuN89fu-'Xϒ% ¦I$ƺI$aV0vxZ/ QRLr[ږI$z[-M%*ʖa4"(NP:J{z0RI%?Q#b'IHY&Q@IJН2ܡMQ؂ $m>ĔoN^Ķ$$II&!:HӇ!jJJc BdnTJb IaGz%A-I LF$N&O )d',N,@O(hM Fޗ)- BtJyIKBP$]JpQRВt%S:HBZRܒФ&i)J c>$U!j%-QSVTU[TXKjJȵ?SI vI%gKURSBJذ)T$&V}@P&+R=ELB1rrrJG B$(pR 1Q!(VWz[R-mEYoP*ɷVj[Q(VG zmZQ!(VUw$\&ڋ +>OSqME-Bꄽ@z>lKj4% ߨ$KiE[K6HB%Ą-ɷ$R$&$(nL\2R=nI $$@S̡4=UФ[%Yk!&W)%%89ҙϕaNZZԫٗide!5`keUU@)`CTG(v*y i}%3sNW͓mm};Nj{JEe$$eߐNg?zoQ R&u캝$b曯Ӥb{ˁOLWh n#`g86?Y .ؕwnwNhnj x`4"7$ũQ_U})į9V^ h]- ihGoK`|Vsn.KKtG=1Q+HVkRG޵5^L|eW:ɀTHJ$ydŻd0aR:s HK>\k+^蓢{$6mU1(իOK\V5 p;.ٝYRcDRC\G@2J#-pP-'BP誓~ɢ\*&tNc,qa@(z NBڃӲ[}:0ψo(5dΣ7R69yQfK}u>$I:bcC)9&uDZD;mj oy>J>j3\0k4ƠS6ʧg ${B;{*m~e.-{BgZV΃#Rn{uWQ&II.à.oS#A-lfq#Q D}G(haAZ*b#9& ؆oW 1 XN{@G@(:xT UKk UK}j7{<#? SxH%aY֡dϴ6Ux7pF Jj$춴{FG]葢Uhph+"ӺR:\*?N&I ].ɝO!J"'kO sMRޜ. ˰Jjs@}r#OuXi~qn(oϽei7| ;pknZǥ‰ Yh{wI.p3/h 2Up èZ10si`Xα=qf2l  \ Zr+N)2_` b#0!7Mx ƊF -e.V{t'EQYKWvV\]s]+q: CbA1%xXȰptS֍!힅}MLp}Bz*6G*5FiΊm;t:+tj ?SrVa=Q=Q "Hay~J q?-g017;ܮ9OVV;$y]`dGg`wYN4Q-Ut ^{Z=&IkHat8:BVT~E+l|CSyTmpI^Z~5@F/ÖDWbc4Yw}Sa&W(r&uuqEUlA+;1= Goէ0K^5t'9x'D8{W{Fҫ$cQHtZq,閸to9FWBHÔOcq0CjO3atq 81>Jlz!O-gK~h>d<41ZYo6kw%s;qcu+/t{&8&h HPaOVBTY`ݚ4oM뮪qXXmm e0c+~#Q޻\|n0IL{ᗸXqu'*:EMבN]{(U%x?rl@Nбk5tAd5^lI+-ĒI?o^Uj?o]sUj׏|SQ<2SJdҭc 'IJR JRRД'IOrbTe2JZIԥ)QI%- Bt<$ R yILa(RM RSJJZ$w%R(IriP%1I(SĨJRxO )J}rRRКSܐr))% I"nKr$˒ܡ)$(N9H% R.N %- Bte)P%- Bt'܇)JJZ)Krܒ:HnPҒ:HC<(NJJJZeЂ(r^%#JRlMYl R$(rU}+[ g)J*%=LR)8j%Z$TRfu|1(I/Va[lq[\6C +Շ0"9Urm\XqmEͤ)  VqTpBwP !5HP҄bb P9N D K 0D֩ 'ca@_=JߔUms sZI@;K1_69wQl騙q^,̹L?cm&B{u8{Z}},AeRGo%n8GCɩߢYY is>j59Y2XԳ}i#+y5L}'i6DCat.kOV}vkQ_DnoMV-o`z9ĺ\Š~bz2 Ώ?H2EXZf7}};0v(vH۲iqssb,py0=#{!Y>:+YUA -1 0 WөZr@qRnpW]°ml=·Hv^I̗}ɺ1k$x UmάW̴A?^ #Xà1x`ㇲTgby** x ڌ=gHΪΠHGkx$~b. [\櫙lkk&i$ p7'Uܕ}3Unqi "79f%aߍȪp{ȸtvWV;Ze RٴOtNGE_&W*?mU stKgB7^I̶N#Z1뵅8lEuF;ku[p|ӯ=;-ˬMA,<_HΆ!;Ҽk6Ɗ@!ēP vIU $TFߚUvJl"N93@ ?/IcKW1 /EG˔'?5SkYykGmVΆQ+ü$%z&`bu8=Ǿa3u Ў Pw1$I[ y"GtFZfF,ywP)btXE<o&znk݂z4so}@oi:}Odͼ\Ÿ~%!:-"%>Hk`fڮ 9Pmiʺۻ&Y*m.xRmŒ a'd˵ByaDy0X_uZ4U[/5+NVCVa#М%jç015 XUč\-\u<Z6yU.nS3Hs®c0>R6gK;,Xw|THF+`#U^ $ hFn31 0yGuD(:L(O:uu]#]-y, {y%@-xsI@={A!3 )Z6LBn:};L!Svc=کBP͐ hm(pm:þ⫷<FٸW@EeY2hd*EB$%,Rꗊ97*-ɿimUy}8Y&4 zƣ**$μhSq6Z&Jѯ0ȘGm@l ˲7A9t"tU+W'N۸W?o¤1G#{ #jшjRGXB] <07RO-f_$OOMBtFN(v4EȹžSa,wmAQ;[Qp֒"aA 4k+Mǒ79c;BPkeZǚA'Oh*M*nDLѸoUMY;! z1J7;A"w)U`vV tBʼTnEیvYXdFSv,J2{ $HU1uΞ A[r wu ݎpFհmR5:æ;ɝrZ-{Wl C}G8_yc~1; Cqv@Ï2'*:x&69w^NQK| 'dxm^ lۍ;^یֻWLLL{o{=[ -7"4i^nj>Yvm>$u]b̾cQ2qp=uRʴhJ]w>)Vj X9?`D!ֳRu+^T+QulJ:M3<)ח\]lCW,';D\4:v7J zB! `*!@Pހ:(c5Aǝ&EsA#5RRaB Lrak Јm;ˋxPFM>8 JjsNYpBZu(cH깻g%A Jit[$;dt(6]_')V~^ic@g*X΀ՆK5:ɜ]{#40kʣ@oNܞ@:29 lK. Mp鍳-l Vh8 lv6 DG^O!@@Y罢+o33m93]tWluo?H/Sm4+iLAӻA֟`Z'&ݍ(Hjjk}mBYǴ0J}~UApR4w+J R;R:jjMmڷgO6s8Y{@ۆA|h٘W 3֏gVܶkJΰӭm08G @|ԚƨKwP.phl>ĐL~+#$Vm5Y{^Ը:yW˽ݓ;Z-l~*t{!b w^ˤlڪ}DmC!=A韘vΪn`urvd⮁|b \ y[1oc~H񪞑 qO]LpGde )[X̧ppI[o!;>փQ {nz\ԩ>< ZC. 8Xq>̬'i^AZ{KpwW 2QeFq0Qרi+/ ysu0!_{'qUEǘ!?JoVwK32Cv踫"tC)W!NIR賖W աfzGgd4Udu["9SoTp 3jF1.H3(w$ہgꞫ7yhSB:\՝IQcdU"!CwJ峼vòv!ٓI+1E).С12$"W ]7)ht*_sYrFu p+׬HLÐu[fr*CY$|m~p\NQ ;vTlꅮ}\5hj^a¼:~ ¨r,<3@QuXs_ոFxë 1ߩjfF-7g^ӫJ٩_VhRZګRD3Э-s}e?@ bNW @w^\[?6,zǂ辨$ѱƭn]ռj`D$KQ줒K?o]׏ZX~Ux?Zucc.;TJHdQI<% )tI$P%)$LSI'JRI'$I$ҤRI$)I(IJI$JR&I>Ҕ% )I'JS`%)LB@$$IM)(IJI$I<% )I$IE<$$InO*0RNtd)dIE2&I$JiNBJRI$ I'S(TJ.VX4QyDTڢu*mU3 X+W9,K$ͪIt)4la%$$KSFʅCډ/XNS&ҞڒI%)nO1jJRI$rbSKjJ]$P%)SؖĔIBR婡%)$M)JPRI%6D&rT:d7›.I!Kb0 BJRIB؟b,% )t$ XHIPڞ $' IKSJ a>ġ%.)^wY(n )pIjE!I$R4$$I %)$QmIJI$IJRI% )I$dO )I$A2$$J]$A[Sd&.O $$BI$&RI$򔤔$$I%-1%)$H8؜1%)4'AA!BhO)JBPTDޟz A% )O&ؘ6RЛjyJQ7J} '"SJEВ $R:JT% $b&NHA JJaA$HRIKBI%1ڛjHqb+S mSIz[w&܍ԡN> œ%**7))*E]ޛ$x.3:]kueџr4Q6,j>MS\]HM%p p]Jh)aR5nn.F*`5JQu 8O@ܥDrd#o+ nUpq|ֻ;_X>Ps&cAN&W[Ѻm5\%`c+ lpuIa >D/^]^UqYNk,,sNCccwI+76O- TC3ʷWO.d 1]@s\Gx7n9-xRGcuFD kGu)^{MAukY[ >ns]5ߝcZu!)"I'M>ַݔw uNHTX`>! ư)P ?Vǒv?{'h ;q 3}o$5uq2cM=5Ӫn蠭<i6vJr}&c/[i~kԀ>K+i[h;\(D;s$6T<'EpOt<\{,Ȱm~,sZ4Ŀ.YQvyx5W\71P=:\D_YDkaBO Wki mGL}`lq&S\Ƭ{o4.,{N.cLLtF(kk[ĩ!;Ra$yU-a/ [v77 Yַd[k\˻g6AiD)W߸[`fᵮMqթMөH D0~?` VuC@ql։yFGT6jߟ)u.C 7ri5& -ThS2K:e<ПVKSeeR@aoN&Hnې6eF}QkMi4SCs"y1h=d4oলtvjLBgAN $T'ꬪ[q>=km[.ԩ5Rk9'#!j "FjE-s$i!iHkS[0}n{/m,HB=-":m!P2*)<_x*L Z#=R&tOvET<*5 @VPiLR;_P 6G]KX3XtDx$}XC;T6\;TshԔέպFlnҵZpJM-o5Vs*,*ѬtLU# VJ(IO$mw V~{,ujvccZ8<T$Jpr2^#Um}tˉѡ]S{Yim:4Iyx j]kCuɰ+jV0瀙N_P  5X Ӊ鼻EAMtlz- 5.hUZF;M7_*Bdn"_Ys`U>@{>Yeڄ7-qy>R_Zck"]j.o8k·eRrPrgfQr4hTjwj AFVc׽!?6XcECM.ȩXR:|;zN;j%'dWls4"SXݴs⃟X2Z{p"nĹ=PaPǙWVs>WYO\8+46B.+\4Dv@_avGR<PWRv4V+kq̵ͤ^m; $'\䖘D oGYW(7VTuP&]6S`ڛmή[Q~sHq6--!xvSvw9Lh!/4P<@k{\sOQ#h̬UZ*6rW`i$F:݃ef$' $"whf5;S2@(Xkk}Hx!ʟAD51J6gR hqU\uML4Skel%d4M'U:+3(6hU@}fP:AIx}TۖX5<%t@ƶbUweF'on3AݡP4 wMYO۫gՙ[Hli\_GDÌ5A1@!THtW x 5A-tO^xwt8Ny a]cJȣ5L8 Ot7^(˨U;+ \>ws4t^a5xϵJ8$7yQn#'-uW7`rGEPz6uF9ŝ@+.3rwqqNé[o?>{Ʒq1oʚrmnSqNeא9`? yu _WIV87O"9a?UF#v/06 _hnK5ȷfI̹/I$EI%?o]׃Vjqw^k?y?Xˮ益))Jh*I%9M*:$)$RF PTI'%DM !II)HОRI% T@RR'IJRjI:JrT`%,t4HJY$)JiQ)RINSʀI%)2t)QI%,t<&%%,t7%0))d)J)JJY$)O([IK$$YM*NBSJJRI$)J))dTTw&%%)$SJT%)IJI$GTUs$AjV:*T)ATF,s5JݘN:J UVPRI$4RCiR)'))PĢ$$IJP)AK$$IJP܊I:HnH,tL)IK'I%9L\r*RI$D9RR'IE6E%)$Dܜ= $IzmjJRI$8r RI$@6 V'Irt)RiILa%%2PJPRQR He$%"HO$tL:hIJI$4&I'4ЊI'ܜR IJI$O))I$$ۓbRN9)PNRI%$:JY$LBmIJRt(JRI$ TI*L1R RkTASiEJħQ*AlN pRRҖBS<&ܘCr[a8 %ێ~8.cgԀ6ڣeX ƚGmh}sؗ29iw՝Õpdgo ^UX ~Ϻ,7Ses?tr okCN?=Zd㩏 eG =ݴ ݰ#B;Ϩ0aD)Suw35j7fTU W}tqޢא #Q)h R\փi-YoK 4[_bGVW[u-"n1U)}ReO )8;t:pTV?EU:k[?K&mDjoc=ԵƎKk.n Ӱ#^²~~lv<uR;*O!g~Uʩ8 A ]D>v4Π}+?(Z q>Mdg]pacO!bհ̹ڧ.Tuﲡe5;"jslZe*27vxrU`=LBQ{n$>. }Q#t<CY鹶!!g>Sp *s(64E:i"[eX'v5kqٿot:ٹsAsoOfXYpuC-e@k% Z*C܋,ul$$l*i-\?=Sal}*#[VR=$kkyI!*V4]i1Ŗ.Xh]wkM82LkKq[uqwq:iiq:AM@f݌Єv۲g\b{[cA+Jg{dPM6"c)IU'ߴ[_7@?D6VSC{)XI!)``{yU-Kf4:3kwXy5j ģh:HV5%41s7 ])q/I_1xAxoA9[tQtL FSa=G8&@R͞ҺkqڒuPv%u@Z~kw: I U7Xy` ctT{<(kLZ'^ cln2I!vC\T]+f=#,9wGcE<<;d uyRmQuWMڰ>A ڷuײ(`g:D7U:I<4rx׺5GͿ!3*l{atKh7GNޙ`tLG/UrY`}5kA?n&;Fe\oC7p:><;qѣ!o]rP` JAٴ OtՍ^.O5v9g"ctl6VFNtJC`8WvvT,mb@B}wd2NUrIaT}376K:ɨ)*[ƪ@9TN"[[ "oq4NΠq̫-5AslLnV6^Px~RⱧ{(c@DЃc%LwL44N3EPHYknecou78!Aq~9#ݖ!ߺk92|B sr[:1U|wz{I #6{'k70ÂVbG*\fN]t}Tl˰WMm'ݪ#+ +Uv%L1n*̥iXSp n\T#Ra$˕r% ~yqV4f68L R ժ}_4|wh%ڋ):7_WF/òʛaR p0v6H0 +'XQc9DʮuDt ,]CZ5PeH d^X6P˝ ckSn0@Rʩ9\J^ }2A=&{ 1GwV4ABfC¸[Oq Wc. S@c$rx>>+Jq`.oU vWZ*"Q#hT5*喍:!lh#fϳaqʮ=^KǴ6T6< ]V/2xM},4"ms.ԯ\B5RἬWkhf}ʳ*6V*nxK!%;">ַ=UapKa+{#IB\eX/[^;8 ݬ%i,&m[S[s{54V1w@sߴ[x."3s TeL.b럔|ٌ*lh lB{r$Unfo78諷v2tۡ/:+\}Mij#HHfԣƆuu\rf9E'Q5}`lDOT;qd ܡɴ~B]ՌhQ5DCBع0&]-k%8 UeG\[/mV]pRe,GBܷ*DX6 e& f2Q3uV9ۃ@a64HkZC`%Bۘu$KP`!VUElNi׆Zy=t Z"Gf?%UJ ;#~qh p*s[s}I"5G{Vt !{3ZOSYMbG>6u4P$dUk?;arz3KLB%] BY}K 'b `J*"$"]1 -\}#z52eWv6MZ(~l$Km܄_ Tp m!1UuCL <&$1y HcF87ۣ5 yX p^$H;RihtQ YǾ G! ne1camB,G˚8'-;fQ7vi!BT'# 9:Q;$*5=ݚ<&O))L ,kt5\:tS`@̎u[nT:`g[p/7T0}]7Ԫ2[6-o;+\G2$ZI$?o^ٓl?gKW?*/gYRO'uUTlDܘ[^O*06'؟r})yJSBP饱Krb)(Q؛b}oIKR% %>$JyM Bm%>JR6Ķ'ޖJR6Ķ'ޖJSBxQ؛bJyM BĶ)JBJ^RВbMH9H8$)L=47%/)F"ň$RI x @IL% 1-S$Ҙҫ& V Bm%3AO(b($JRAKDRWՍ-%3%)Uj;-%3IFR[aOXؒ$)JYCa Z!T FZҊj#PՇe\Pc,I$&TNotԙ:b'؊OEQVF'JRJi*/MX- $I)J*V ILENEϝ[8YU} )Gb-ka?>+`5!\Z*Uh F9 kZi$D'LZNE/~.?@J-9"6_PIlHlH / ! "jw9 9}ͩbSQ jȾ&VEd;n~X`{*fgrF{zf;.ʛs?97LꫴzѺD1i7C}ѯePIpUm͚dO!>^Kck^$HIxPAy4 T 8e R*ku,Hh#Lzyo?pepKw!T˷mklH?EsmW ĕ^6[w `4 .sl$n#Ǫ3=觱 j29ꕴz*k C7=C}W4cT]'NSgWkiiI Eˆq#*I:ǻt4K`wF` 8 C&[㢰>+C-ch.~@h1@@7k^4q>?u+]dIoϸvlo$Pp64Lk(ֲ9wT]ŭWqǟ}TZ[*Mn%YּKd?qk?'KJ[wٰA"~{[8ȷ$F!sW ۧve}xd8Ew,NԶ(n&(+ma~y L7Ln*x>Z vXqkĒ(\hS-%ƊY 6C{*82,p%=;P<'U_.>`kߒ=VŘ5}YrD.Ƙ=vcx NWxk:'`}H\ELY\?C lw:ېR"vP}<[h =:S&Puyu=x!] V]hZ Gh ,fë.|}͡]S㰀\yYB[pp7$5c+Ǭ9n'=(&Y6IGú̗aAU:{attg_tݖ]ͬУktOwr*nW $*tٹ]WQ%Sqfa jYa}EI(+Ц;TvUmg] N2uY\ Wl&AS3^ NW*nK B.w>*`Y^@ e[-$E[ D,\YV6fUڠWp閣:K 5C eo0ܧ^ I*4fB+IMv@.k|T<=ݐPL+8+j;kassf9qC}v&G49M#ܴ21p5;6y-LyY E}ō74JU<L;ȤÓV]݇9U2uLN}~d7kI쳋EnJ8lڳаGt KZ3ͫj??Yfɀ.* U~e׷&$"\tlwc~sC95 _UjZ3ÏVf+ 7^ r2j`D*Z ;OYmx.#`Ԁycqc,mkF5QkUs̖x)kɐ6m^njv @TeMOfRɫ(7;sjoDr5RZAnwp:w$QfS^p> uL\nni)Pˣ{}J` - ѝ:T5Ю[KKZ$rDMǔ :ۏGjz{s8gE=kIo>9}s3;ipUnRf+]Ƈ {&tlch/G:w~7íQ~C}XsϺ4btmL:|<:kIdV ;'9-&d Gf8HAgrB.*DkKfIvB1]I?Wj??2PW0m4$?֩u b, o6}G<88bDfkCO5r\ϖLCEۧpʭ5cڸs/եZ=q;CKr@;'C}Vre;7ul֥lTsnpt!׆h^}7ZF,KYW~F Uñz&H%D裪:ƑVP6A5Os\+Oc>\,l#1c^^npsc@;YP 5uvFm:0tK9j hv=佭<-FgZXxxZN4Ϡlq㧧r5YG$TU,`2cϨ$CѠ=S9yy"́AL[T-A=ҏ[z6CiSY ~Jus^ר`znJ{[Rtq*]=v%~KKձuYyvoxӈ9UՈ ʖxz3lytjﭻ_wb;~h4 30^qִ4T4=4 ȸ͋%Z?A$+[q|JN1=6P3.+ ecZI )Vœ+˕|ߦNqur ˧R{캹ё+315&EPʮ{-~O%ZٯԦ,㰙[|g #j{;܃M;gA 3%)Uu ױōlF\wZGyfo`sPϾe$F=6= y-ua) fdZv ƼQw١JvX:#,[sK xSsEcrݏs<+7G|ÚgXJfYЪGE*θ3:HJO]2y gR]̴vV~O5]wQMsW.׀Nca[eh0buk.kt@ @hD?BD~HǤ6@w6NGS d@RhXMEeBHwYo[v=CN5O>#c)[tYi(jG vE6 vTul Rł8wa<cUeo/Q 6yhBepG<4hWC3(H``KNC7)Rnq۸Th{;p+\]+wT}fZ1s~hGtUhݸ D\5|[cV]aVmn\tV=74>WdՖ#xo*x.:EPqY{4":ֽYu3qqu{Q]=:J%'PrsUY? jY$Uqa[[7d.,:,KEE#gN,n8d=#@t9{,i3P1+>sA+2I.]qȨ=9c5̬V: 5&j<:k="C:}o/SR7BQjUO˴VI-V9Sˤ1uͬhfnIa4䠵ӔQ3Qv'{56OM&#geeZxɦC>cT 3 3@{u'vH)XPa BDivXѩ)hXxA:$Bw0LFJm;NQcUKa9Qd$\a 5[ %TݺtVsmvIL*~+Q!ם\Wma5nndVz;\t p4RB3N3t7]~{ ՝Q@WL]]v Ʉj`r.t#yUmUt}Kv 'E7L(&B<{!dFօF&T )h(vAYbqgĢ1c.NNeL+&jg>${Bm!1s al$f0S2}6%к0J8SQ\!:&\JF*pFVS4pRD Y[F yU{UNA7'Y!:SG0UA{~"-VSVv@}#vTu{5% pUů Wi!^ Gꆌhaؾs6*CZ2b~j~mL$3<&v?fzqz5mlD80ı-h[k9,rT5۵ 6u*YTX h S׏rЩ7p{8K^ZKs>=wj cʾF%IC움纈anVmv66€I6U6h |1uhn}6 UL:Z$55*VCLD/@GE:wݱfTa}L4wm~1+:v0aI8 m<ƃ{qZw]=J i-HUB7 bg8oh<*XsKV3\1mKb-5mnosmh;,2tTKm 2oy"I$/@I/?o]VX~U][?y?Xˮ直;5r I$'p)$B $$JyL(Х BJ]$%Ч %.iJSBJPjJ]$ҚTRږԔ%O* Զ%.iM*)Oj[RS$e<$ZR&(O JR)LI8IKR%1 գ))pSʊuX SlI M)JQCR-IKR0O $$-SLBJTRZRB&ICj[Q6%.dv.RR&I@Gj4%%.dnd Z;RBZY@ڈI$ItIN.[42N+en$*LSS)pJRv֥@lے!-'J})[ܖԡաՇ=CrHdTT H֌HE%\֣飘KD%곫P5dB(^RLb3X %tҔ@s ъp e)JdXBJ]% JUIGVš%S9IJy*? *JPB%2BSJbp`x )M(`Bu=$$I(y@Pr%TqOi4I)Qޟ)4ޚJ]$ҞTE BJZ',@)I+BhRIKz⒘P>DnILa-I#M%1ږ$bQWKqIL6M$cbBqILvI%hZ 򗨊M(VDSyNPS Qp=8zԶBP'ܫjE4"j9z[R(LZ-9WRIH6ڎZXJBr})ԶmMBR7"j}@Bޛz EO%j[QHMآmIL)ID OhLZ}ddJpMlEږЇꢦܧ6M(^U1Ob[!GjIL%-aE7b%MXZ1)jheI Xb9?u]qX]DeaLճHVZѡmZ{ #G8X,$GJ0z3[ad"dUl|ICÁ.cwYe,hZO*`#A~Um6k8ayߥM##dS>絿"A!w fO~JgZUz.k\7 K&+3Ur%]mAIms6U3a$qU.q6Up$iq0n.iAB>@=6轴?Q}Ny)T6ě  "_XkֲI(#]ݎnk:Sh'QU9Ѯ]733kl.LPDɮPY`' uX5N'lƜxA-H 8XnsfSϱ5CA]ֳG/Eki{pvJ%enl;pХY TA%<{6@`wt u˛KH~vG2.CIYY$7R}ąf6>^@OnKz4O2װ:P{MdǂkKn$u[vC =@3k*Nh?P}BC\A4k ss[Hs1ÿ;)&NkfD;vZx uo>CBf4seaK64van.ߘiJhu0 .Un9qh\p0DzF)p0x*[N.3ZִUߺ^[Kg:1k^L>;GK-N{{9r.q|tx, \'Cݺ}7-SԳ"=+G!׶h7 eftj=LS/5cŶܠ[[:.eƚۤ Sk5L3>oA|HX="ʪXG Hlp:z~@lwNcjkO$ 55QMZa kVN. tj-lfR{S8.o>*9fp_m㖂>79>Q&tGf|"Sf\̍8:봼Fl*XlWʵ6;O"6~1ٮpnGxV;Evt'{Y7 KD>g )lO%PNvúǿmaV0%^-xfU tpպ{^'o%hl|vcG)2=Mm?yVżoN$܃n鸝:R4wevOc7:<ϲi0O-9oo$HO>Qُ@bIaվ_V]pC 4 {ǹZZ^^zNd±(l :e+4A:)8sF^q fe;mnCV@do jm#Qzٺ:V=ŀiP[O! un u hdZi c^EtCZO$h79)˪pUakNQKhS݈4w%Jvi(6v }ZS s)tֶN  XaK8hOdGs\5:w7q6 yR涋&pڸq2V в(gؗa) 0u ƍ FBg&{!6+2B> f^%mcyJs-|s-c-d#ic}"$.dcV恇YF|ZחLM^=OuB e}FjfYӲF?jqB #;_#A:wBީ.geHkcXgdt釳PeQEQP;='tNc q;%X8ẅ ãjQp`HUjViHfګb[$E7 4Vé)gWbE@lhCzu5O>*le9ѧt׸Cdj̱cAw$T}G*Ɔ>)tr曫!GS醦◁\=BvZ5Q}7$6n۷Mp^2&*k[o:M v~Hw 䆘l56{*{@}nb%ueJ]ǘ]8a䚈k{앁aq9N/pd)\Ͳ4[ Ȼ֩ Z4IpqX7xNߴAkbcYkCX{%@q$ o'nҏO\Vfki5wZ[V/` =7cd~Sٺ@HʪK|{PB :±"SZr*>2vYMvU BdYxƿ7_$g45-Vqmƚk` |4N׉kB%V$DnFm%꽹}Gp"4P-FJ9a&eX0ˑ]Q~qwSnqRMo6}%>tWkέҩ[(/96 ]6ܫhiWkke p?+ha.}Y0A:GQTB}[Ŷh|^=u7f?X\~/X]GOTTao};Km%hᢇ@:+ ;S [^Fry)R*$n,ƇXaaC !;Fy.- p l꤮nṚGt%΁ ̦vS;8) 5ӲB[.֒5 9k04=(at۲Z\yU^7RD:!{+M;t#@laA:$F5K]|D ;}Tu\:'fր;''AրǙ"/PinA»$ A8Β K!g5$x!6 )<|TmnêxƁcv*dQK#ڢ[TT`/ D5 vU2Nhٝ|%#^fd_Z? SKϊv׺+6bt kxWkl#U7uT[dQFCLȄTʃFji2E㹱|Ĕc};,WM :um[qN tZ#^|݈%h 4CS!2 ȹ:[2 4C­[! V5ׅfa-inYOTXeE[;NY:}n'4D)Y4[g!ǂj֟‹KMx=-:ۋ-[kZe8u)`iAE#NS} ]̳s '>!U:HcyON_5{"8ngܲj;$;:𑄺*;3^WR0{oFAn( p;ID> z8Vp eJY'Hݰ6<օgODKChtIVƝjl"ƀ5 y=IV7 kZ4 >{dצ-*ưWq)lxJBtswV+ͧg}x'UhS4d ] 05:}(֠+oKarǙ; ΰ};l^sscew! s3F/I$ERI%?o^l3qza=Rσ?Zucc.;TuX(Y<&N=IJ)$1rxO R9I%- Bt7% SJ(N&4ZBP69JRRД'Ir}R(Jm%1)BH=%)tB6 oNJ"JP$ JZ"JbTe1))hI:J`?B*RlM$O B*d?Q1%,<%ILRR$0DI$IM(~})d($J $JRI$UʍIXQJ7zLOr/Z+'9R[-)*i$LkJk,0T+&)AsNRICqJTa%1R4' uS&>䔢 N*\))A$:)˔H$- Bt)Pܖ䔲I)rmɒRI:p91 I+BIrJJRI )P'I<ܠSJ<)ФRL$BbO)Jt% &"l$BJT$arJHdD)9())dd%,tZSJJZSd%)$6DR&ICjj,&-I $8MSBJ]$Q RڔJJRI&P,LX)J&Ib[ B$1H1RS!)"ВJTILJb]>ԔȔң) j[Q%3r[RL1H5%3)Q.Q.Pb[RS9I r}0"O%$Iz[LB9bbĔ: \X%$ ÓUFzi)"JBLQv%餦I(JPOM/M2JRĔ% -SNZjJ^)O-)PjRRRژTBRE6 +j}%*^VeSs {J[jK}XUO pr?e8QD_Gn,LOGmaw,~. ΛSC[.css´E(U`I]TGrQ7[$}%WY%P[®Nn VՓh|#ʋ?ιll6VXV6keZ'Ee݉cD:oj ۙipaUeP*q VX܈k \@: 1 u-սבe5v_Vj ѡ ׺IUp{Iw&P`l>Z v)J^; 3w&%cpH.#JWَXZi1ؗ64uN_p:ccdFLE~+-k]\uli\͕{{䔫#"~|,٨IS7@2]S}-"*d2hs=Om>],;Z#O^VKB!Ǻ݂tLܴ"> @nTnj% T!^5h xrHoVsj P2i@h&tqG̱xڏ=$ A9$ooFɧ"]-y *-uv?52糧^95O笺 WCkH:Lt 0IAs]X?5.x]Bt'6U^6`q f S&*EָAKJG޽`dyt!A^]!Qv[=pK+r?V0n={m <W}M q{QvϠt0T GuUEW͏ӧ]5aSc{!8*~ #g+  kC =r)>韌g4W;V} />|Vx IT[s 9kc}^ huHYa1ɷ 45O*VVcw)S*!N3)nnKc2~Vs1][5lt5wOQ$ ˾cN7Rx_< QquhZŕ47u?`\KU< JGG]IqHL{'Ta)heY 4Xeߢ+O\X,& Uv;ciUD;"聵BOoUw]POFqsZƒHZ-i;Xƀͳm$jcɐؐU665gN+dmBvS.HH@rYh=0ْҹCxn$dܢ89JѤ=[[uqwkk2SW؝l4Pm hV{-ƪb4-ۛ͡ ydc}Ց x'oxT\0Tڲ#zcu`8˚1h';Ia粹Cdh$CvnMWpw`Τ\VԤod/p2|GI >};2Sh^p>XkL#t>X|n+cF;Q |ڤ|RLؙbBh)}&u,:84vgHNb+jՉ_$O\OW,AӔ06,g:=L.e5e,\B:o[Y\ų"ٝWL,77dBzYQldeWs%'Dzĥγ"eZ58!'Ruh2Z? -K4AmsLl-FY5%S%!Am8 kN7rkP/cj n-ct#da:[e>k6LnoHD:#Ş#EL P<e"6i -]2s=GȢ7ZG Zw! F{;߫t!I̮k%`7UumEѫR)v 1w%PiB0] %P7 "\{Qh@VҒ=״ݜNlxk5Rɿmcq5E|@N#D[n֫۵CIOM* q)ՉS\[Yu0Y`&(09Q…h L=UD A:ؠ bRe~jY\ҝ P|8Gu&V;.i,?Lnw!aMm Цcݴo 2N6E$6|5 UZAqP2Ixr9A~Ik\\ZpAHuz ;c ^7su%j x !zheRm{__ޫSAVBBk![=ZnX*Cc=J̺] ZXO(]QJ4Y}B ."T ǔHD6Sz%kXO(MkAР5C\bn>*mp\JADK4*"yDlpwd!ra~MAD-J6a@n#E' op;epQpR6d7ʝډM:{ M蹍ǝ&5Cm+"ZXtGPD:~4VmcdZCyP2mQc-l[YkB@9YٸW.O rȨ0UZUUu0=֐Jb~\ uLlDn lz@xn \mJ^>iB- Gd)ջ$}N˹)i2 k4H0qDErRh:JhEP-#->Z=`>Ei$pL_QA9h[M݊qPvM@uOL<Ӷ>[{# S AkVa5R{P7n2 (ҩ;<~x0HgxqӻU#LRSZ 3YBzaW*D$T鸀_ZIN4Dp2JE)nkZC!ޒ)<% ' M8xIKJRmRkHX%4!MHۓIL'ܡ *^VD')je-U% <\1HVIL-rlKb-*U3J[T.Ē1Pܖ NTS$4(KbpԔBmɷ&JT%/ BGr[&RSL/OD$,ZbmAoH6 V%Kr[.Krm-)mޖJm4'O)Js HQOIԤ'@KAKU-!xrSILd%:J[[m>䔶'П`Kbm%+rm1 (Է%%+r}ɡ(C5JRnKr% >(bRJ2](ЫeiVrGp_6~ pmL36X8Rp|Wyӿ cΝSCDV\[ps=l~*ѐjFO y**/T*U_p[$%Q,jO-jpJhU{+V~:`e+u ߗV ~k&¼Ƶֈ+~ec<*׵eJ-ﮆ4{8{F=k[k#?WXcCZ!@k>J&E& /4tuU-pړNҍu%Ѯ㫐-%@rӪ`AY2| V4Î>+G;_j?2PE'F)p)QєO )pA: 2tU-st&V$i{ȅFmOi+t:([Sliką_Js:=Rݭvn-̸:*u+)$<s˺lMQYt-F'}\9 i44>1%U^ldy-,-cCMaĤʚkne$_IGi{oP3eWV3+6,${m-.гp.n3Rd*?憺5Hsju4+:Y_,?vzYcE2pRVo=W{k-4Yau<[ScQL}ae{]S ]5k N735 G͚D {lAmvWJlu͕< ۣh¡|hIJy ̯{HvLRƲ+k3U,+\1D{Jl,kI HG%̧Ԩ33 `i}Ovg]SfC  j;k"1Q"u+e ;鸾NN(ZM7sig[Eoy{i ?sN9< ,a7v͌\ iPeYk:H hS @6+mྦྷ;UWˬʘsAA:ً㥶vӦ-V]S-3=rlR!XkD+ll[^Ɂp]C.|a.dmN|iiy%SžBxTScؑ>(5]PGu7\>c\w^Ӳ\64\7r :iC;kb*WQv*t;yh7 HADПho[?HE: N@QdcʣmSW'k>KDzĂ+l :}7.l:keH){zͧRlBo,C!h"yO}ViA ?"ʧFi*վh$ Aev{Raa|n'@݄l23_'&Ծ{DPpr{lry% cVO$D9gւܭj i OF;OAv杀IBed[CqTE hH\1͖V5h_ x9-'dm?iqʎ=ެ'f7kfi%Vޤ.mduqMSicP~1 -:N4ٌښ\aZOt Pɵ7#`7)D5=ĺG*7 {A4n>WSC*cVjldd%7txCkGn(qw gQ̉1͎ͫnFe'=QPemcY, 'j3;NG4;'۰D{1LR#id [92J F?VSL C*4G*6A0 fMV:@V#P "72/8 {nkCp!lUpcXqE!SӐOHW?ԯA2u;kKA֙ :&4A< CЩ̥ mcHVq\@6[%J=8yzkK!ШClUgQH3TGV6So^scyT,k>I0 dn-4J.N`h ̮^汄5:+Vaz$1V{n:-T C0h:Wzs>j sH]lV8, h<{ArhnzWZKHxK4sT1Bw? c3_4:-"kD,Φ4m$Pu3;gwe<+ML[ԓ*.dJT4#|6<ŁB)Vp$ONi`6 =UFQN鑢?HBNQ}Bӽ{g~V3YX8ӡ迨ͩ* zv=ZocV@[BC`U|2~6_%9yyWe\w?s[wuvcJI1;xj0w`<{=7zdL\mg]BXd\'Rk/V-ˍa7ail9C<ѡծ PT6ߌmwܫߔYG%[m-t h';깠 llh=Ku)*e86CB>[2v:_{q-:܅Z>E(=*[Zn)/ꥃR74s6uفirJ*;HG8.sm{l YUJ9Uf6`+Tnԝ s@*UENQ3)(I 2́ARfYUhP kEmzϵSrwUsM\oh ) gVݦ WhN!qׄ/Sp[{({ T d9T@k)DV؈Ufơ;Snp%fUʻU諽h$k*u=NIk{\`$ZHaےֺstT:cTqw BF+8!:TuA2,#-$-;%R̬DfB} Dѱ ăUnIԪ,%q-ʎ慥Vas%!gR5 iM4 @hƉCr9.nFOx37d2t7|l)BpϢȅgk|D*!!NhzvH⯿;ʧvѹ\=B8:& =w܂qδ{hSpR=_=x ;܌\*fuRs>W*y4?gUSUc}`I*C .qRm!Gs(T]w-g`U_ Jk1vVC( pHdkU~dfTz 1)4Oe,E1b%8nXg)ٗI v`RkѮ4%4T';*up9*,Fn6ʖ6r2,*M<%N̶jAtBpZ?5< /LBy 1lH{'䆎P6)wiY$Lhvr8LiJA%,ˮDQ~SA3lEozuRG$&RA A=S0xT; %?Xx)OIIK{LmXѫ&|Qhk샱YZ*og[⳾gu?6!l~p 9rk2ȉs΋KvՕf~K$JERI%?o^Uj?o^UjՏ|SPw+$+kI$( 'QI J LI dNI&I8NJRI&QIHВI$$IJI$)LJT% $RҚRRI$$ tI2I(IJI$M)$$IJyQJRRI$%B/M4'ڒI'ޛzm$InM1 )I$JRI$)JIK'I$YDR>>$E)(t -VڪڒP#P܊Z żF+金3 J!IAIJ\I$nj0YhI,E1Q"5$ҞSBX٢ĔFT&D"l )I(ܪSUVS4JH-IJNR$H(I :A<$J$`@JT1QsSBM )pR%Kj%%2JTe)P OL5KjJe)4B)bĔSJyPjJ]$ҚP ]S$e)PhSH1H5$TR%DAY!W$R QUruJJjA-fd6E O餕Q HkKjJdiJP*;6RJ]$Ҕ)BBiO)& :Hޢqi@-RJЖ+"ԽU\JJc-I#z?JJJc-I+"SQS mSIXPS VEX))ň&dX=VREH&ڊBhV7ÒJ-Qa(Vԃ`-) bm(Gܟp@ܛqIHOpO!VܟzJCj[U *ޡOi(ج@L@@ FҒO%KFza)z%#ޚ/‡o)lKbT}DJ[ԄTzi$ޒQ/Q%+N,Mأ%)8KQI/I8'S?Q7ZRP}4ޚ6ޅ((;#JK҉%W>Ҭe6~ pWw./Ilڸ_X_Oiϼ.)˚ct˛޵jF(tB y|ҩ7Uk8Uf ;UUi,]a'YAʽ`-m> V,0W9zA R~uwS-0Ip@֌O<1b[2JOfaVRqvѨ `۵yz{ud)N]Uw-#@tfNOO;BCiiq%A⑊H!t"uT@H^xCǀxvV-ፑ"IXVt1LׇS> o5=[贐O%)/ڗ iJI$hI/.i0v{HU$;k#M4HVIpIT |y@a"Kq:}՗;#Lr͇l{[Ss@x*bWL:ͻzBR e&"%D'O/yK)g[V=f5Դ%u^J[`slx` ; vS&8n%'mΥPI@MUg((JSxn9>r'`S#k@k1 XGt] ."Q+ ԝ q4:5Ym7 =p#Y#l)A2 ;424+I(V_L+X\'iJKX$~EUewm?<$t*W-07cҮ\A&@Gq;+FF048ys@;yWN]ܓp˕CIuYa3C{*Y[i>xp#LjA>%XLH31}]k]BKO߹ڇv=gGE:9?˹kN-4~}_']_m-O#VŶZq.-ϴt=nw #[ggVC]78[LK]Uq~<t2@i=8{*Sh uw&e55jFE6\G_3d 72\8!]iqvö2ʷ?+uZ)qly)ӂ XkHpDm@+7'VQ$5RcἅWdzKG ˏD+O7h{xC"8Mݭ1%Ѣ}' taik!C>+>KOQ,RFx,hR`-#29!Qq:wN I:S՞ehB(==]\\v%ch W<elTĴOF\^!0n#f恹*oA;(Iz&E/p -|&;cKXdlc^l?D[n#8l)FZ`5Lw{HxYlrd*K:<}_kqak`X oѣϺm1K+,Ӣ͠mvF 64ӯu7BѤ^lSc&t8Z !N_SZk(ң,l<gs`2]m-`?8B{+/{_sGf_<"_j{t?PXT;EV4IC-pdPqŬy<&[{ cX؎mi>e qRh#McHz4:UWi6Qn+gi[5]pɇ{< ~X3'_$jm`s9 .Cݮ#Վk$4Od7FZkpyV;5cWrY{7e276\a2mR̰  :ENvr~\ۣ@9D}>5;]v싟2L.9۵us[ Yw!N!Ô⡠clhal|>.+crԮNJV{Q`,#DKܩ1@wXۏbJ-oӳ*[kac]g0{}.O4o mcԫr骅y^xM.";xn_}.$nûIv` ;# -!{\W8lKmzB%lsݨP洷a:ot Lmmy_q,c2C@:v lt YIpШ\P K$#c>BФޢjfV1O=u졕{R(8u UfX#DLYp!:"4Oa#O0L|PYςVxs8VjsaW ˨Vlpx+ O@Ϩ3kϻW1 } |Rkݤُ[nyK.K> [H;yYgQnx29C6Cǫl !!cm)I36]2!jX4W}V=םQ#mo{6pu{nlP.#ԟ&[6nӜaX f09A6{W->Su|BunxT0װxGhB/D@G/ "UL}:u2ݎigB+~Jkx~>J"^bNUWzŖq`y$U~) jҦgUn5Y-U6 : ՛[ h'TfmSzUF'tS(JӔzm9SswpX[i {e6G( Mk fJ;2EZPM2嗼6l"z=o 5 `)8Ǩ[>JM7*oB- g!6PA"75ZNƗH*F% ?uyCmHM*:-4_#뼈 ;3nٖ,IL&.MRBoD)z8"zKj?JKS @z[KJ KFzmpR2+O颈Nކe6;zhoKzJkQ,V :T S*қiVvJM)Jq@ژc`LkIIe+}s_q~zF5t›"鷺%[TB'BAT\P@n37r2rԦKZ4gQN9n9d6#U1ZHotΘ6 LtΟP?}g^xV2wy?5mIpw+4.?G$ݵ;Yѐ(eM@$jT01>fDҬS==O,9`YȴVI߰DV\4S$=A緒+H:NNYͺ+5$ӣZGXmi#mgr|wHtW z(cN8^gSPztㆰ8>C.P~CH|5 p3(H`$$!W:{#T8Dn 1)M_ieM-h>bAqpTsË'_@}THS<'swh37-$ 7Pq64 6d?EEv[k fӫJo[;1c#O0]uVFX~y٬DvLX͠yB H|UQ׎Tmb}:f6OiKk[PR4 әɓ-ҡCEݺu#C\~JE9*-}z4Mc%[әVkA3![S TQqB(\9U*ﰴ%n~H"VE5ʛLF#H^e:K@°'[O*V<<9h(׌l,#@ƺ <@n8TftVk2,#{\D܈|TobTC8)u־mqPnM-8nJ\s${^րu$pM47TNoʽEsX<±Xg_VOFL  7HCHq%D< 5J鵂I#]Uȱ;)۸w *vK]*MhLᮋOacw@W{ˁ≑mA<;%7ז4+1U9=C ٴ\|VKA[{p 65*9 hft5Ov2P=`; 5veXݷMufv1~+},q#^F"u:Vv?gVa.ͤƼt`k!;X6>> XVe;XС<Z:%PJe6պ<@]}VWE{` L0"4An%eWnhYstG.[$u4|6:hdf꙰ m/-%{3z:}EtӢwRunScEc$sFpdޒjfuF{Vd[߰uBoqA h 6pgB i,0IϪxuTX4$ջ > D Z٬m/1n8 57B:hx|qKl ܆e*t|{?\>(cL!<|5 W,oS׾ZK{@b >jmsGur4pwEua|MA}D9CX %c6}n{*5y=":@,D98B(aqpBj*ݪw ?Ɗea;]4 +a!WwUplc)b=!z-{ FaS}OyثM òjYhZHj)%.7C{RcAtTD.e$§}T}6rQL˷굏`|9x LgLmzcsXۦ]:uw^&b'Reۭ<{RJCFEkLjsot _SV5t+4XeE~]?U eWo 쬰\j2jN>V0KP#+_%RX0w%ڗU{_xmءag59qjˡO4VZgwKD(Rà+f(5@1QhrrJ\&eȟZNգjՇoPōqMwf W̓._$EĩUZӵ%dfo,`.gZYRB+?sG/MM}Å)kfNCt@G~&Ch  ;Ә%7 jEV;][AW+ 7sZH(mMS)lh.ت { +2f[kiQ) &o4*MpIߋc=iq<*& >' R;[?wG.Soxjޛc8ƈm3rJ#T}aIƁߕ;:fKwxj`(%%E%!np 9Jһ e/ crM~z*J8KǺk j8#\6몢T7!ISq_ٮxt5 zμ n'E/[kd}_G8q.f*P! tr뻓MĪ~#uK@ Q;=:8V`K K`JACD!m'^b:`",|7R~ho׆hYmMN%F >U6i򴄁o(EyHABHpAA.ܯ~q0h8*2AR RAL+ `K}nnx&u#kgu x:G%H4{GUw[#iEcR=o{ ;l)CTZH'>GđThc? UBrH1=)...ɚLNukt(^1 qAt%-W@ Sq:6GN^Zs5iVd u q*c3 isX0/H Z[ŒQ&{x)Z[`j{vSwܱ #:r(`%WBׁ08}no%+ t\֏CINJ5ONMv^gU6KD"> _+Sy0 !Yh2|jr\T-6ç7pW3ձX:z6 +bWgo.,9jt@v̅b00WEvslBIWi $?o^ZaWu7OV?9룻n }:ЭRI% %tJR$.<DIY$'H4!IJM*ID O()$2O&L\(JK}ɋR &ڥ()!yM)4%G`RےJũ)I)BU{ :P]U\V;lf,v Ϫ*fV^pky[yEkuIM(Wš ;uUw I$ȱQ$rUyDc%- %M1d J~RK SP!%\W lGrR)TsTaZuaCII 9KrF 騚S$7'܀%zV0IJnUÔ$p)P)}8%0Ȑj:P,O$ )mKj*H^qbJbԶ*;M)I8jH[I RSښOR )`(I@D%.e-RR(qJJd&ܘ qNQ}└ʐyRSI)&nLToMH1/ $'ܛr}ÓmNVڑjRCT%;TnKr[mLZڟj[yO(bRإ)H؛P*)!bN,O*rIa6XMoQD%#ؖHRdX[z^HCmKj& %ꤤ[JPQvMK))->Ѐ-RrR6MI^qjJc1qSږp TqH4ꠓ>NѡLFLyZ,~t!ea[%'I`a9D8ӰI#XJI Q:.$ l`omϴaM$ t %5,ug{4Q.pf֙s|}H1? FE5H>iQOa=0-l{BVz8s-0J-Xv1m3%4 jn VlxXdǻCGKEi Ms &?9+Mcs3(pHt.0x<*i i$@O5~jXl 'Vs]aF6-UkQ)EN?FY0\}+ҫ Q9;L'$ve `HAk{-4@Rn[-$UWr}I4VIBRȰotc՝khI'OhcE/,O.q)AL%ʹ_ZI=]!NUbSȑ1#ɵ@#YO2mxH.=2.~BnT(l=+D9 M`J.%l̝O-8kǗjZ(1,o+%"%1nsɰktRdX{"I:mhcTÝ66'%\{f6oxV5m;@w'"-LNc[N Ú4J Cos:cŷVJsplFsǀSTc)יKOC1ׄs΁Jt'~Hn kaUD4F8aT0b{&iraEЦureO5&HW[KV@"S ,]i1DV Ƨnya܈i9aM;.AT[j<]OktqqVEtq昈3tͷm2*Wu5  &HԄ (ƈ ک9"@M|5\]r=vhLK*kPBb;H AT 0VUM]PԄURTEG. tuId՚I(-PUpOxVHP- j >ǽ+u^ptQ]N*lwJ6cSoh( &Jȳwq,'BꉰԈ lzmBkLfSA@zzĂrBf'.) 蓪AJsMDݸj9O^NðēI<' yƎKE2kOI i=+mK>).Gh<%AL}&m|7T?V HD惹-wM=Y#T{%jW5R-Bܖ&BV 3Bwi#Z]JNB{IDxAkYPr`Z㪛kNfN1dmeb[*=;J:h ;?;c*hԕeuI ث.ƵRGsFW(Y=ah.UEZp#hc{Il.'Nk~%sLw>(7;"ǐBʇ8 U W Tns++lPmAȕG57@0Uf:jC 4< ͍s8LRuY/6CTӢݯ)RtPȟdv r9HRƨuOTwUY*#@*pgT~SYAv;$ʶF o1-UMB@vWz}@[# ;XQAXA)jnA!7+0,XCD0= D&5"9HtZd%=y\ 8$Pcl] ;\ % uU:d荹ņxbSN@$ϚXN'2|g$t,4*6@5NEK\A *-BE;[; \;yB}v%>zw07_g[kU?:glYsc=ӧ!0ۼ˃/` ?dnw7$Q4^$_?o^S;X~U]?K> j׏|EC+%JUF)% Br)JRtIL R$p@&N1 0TJI]$'4&I )SܚS'IKBI$2pIRI&QJR!E$.Iԥ1LIK' $))IJI<&RFRIJSʄ))d(SBSJbhO)BRܒIJBrm2RR$nB$0)BP)-)% PryIK$9M*2RR'IM<:BDžG=p:qY5ۢ_(+1 CĀȰj: ,KF1IڭM ! \*Wq) )$#A&"\JtU Z)%dE1)N.!3!R"А)ՑjV ))ŨGu>B$$M%d=E"e%#ڜ5M(S/Rc RkRИ4Ԥ!=H=$Ha)"J4%D7Q)$Rt%)NRP,N$4LPSB)M ) )S-H5%2IFRSD O餥*鷨nO-) ޖҠE+ T7)?IZ!6)3\r)oM-R=SʬZZHI)!OV+K )JܫưkILPܟruS؜1%.iJP(F؟bJe)J '_M7Qܟrr}lLZД06 0!%- $2TIF A Bt0S)RL@ꘒ' 2))i))M @'JRSR)BhM-)iO)B[Rؘ-nIKKz[Rڣ1Oz[Je8zԶzi4M8xII7އZPMj>!) ).!AJ jQBa RnOPXԢk*ТX&ܜ9WUM6­ za%R}JSiO^KR4-V}$$?Q/QV!*ϢBmTIh҆RRT! 7-dKZ>(($O8{ R5jq> xub׏❩(!s{fa!9o|køDIN Tփ2|IR]p's¸2+5TFXzE*r!_4El/v֒TYO!F̗Z:GYm k3)h@Ԫ5vqTC͠<Nc>L+$ Jd66VɃ$@HE.ϣ6Ԝvc$B88g^l NDU.Z_0u2DGU1& lP>?XVX77kR06zlDZ2"R:c[wt?HXZ mUOQk4(!8j )t5 ИA/(V ]mneVEYHE(JTAX cRJuW-[IY%",uI*wYl.ic;A2.쇇Em%dS3.DKIoZ=T>"?XQt%oi9*Z6,X,04%$I( (p1=S2e[>< :蘰D)( axe抋^ u Lζ7hN\tS+apwdX;HUgvckGu 8ӄW%^$ tB F՚K @] ۠HeX:Q2LY=HV2ke_2 QS$TƩNpo)V?AtqM8q%Ir=yvU94DZGOuګunCm^I Q6VmCX d7W$bSC${-9)@aᶰCe pcΐSC[D5]o<,k >].6)hk(چ$ moHvUdU-ޜ(pH *Jv4tgb`3#f%'OxWcf4%^ҏX@-i$@Ֆʿe4p.ҒQNzl-t+`:Qqp->҂铡uw ^8h'otQ Pc)VN X,Ju(jR ;X+>ԫٶtrUR)5IZN젼IB~,wAس[] L@\5nt{zoTx Q L )]@wvVXw(g#šLL(tTj#V $n68- h8h"; ,$S`Ɨ^`-|vmTs.Ȳ [$J:R*-$h{[QsU\%S wec_Llb~q*8iJCS4U6cUZor 3 䕷zky*WW+gd}@TCJTCmDV{=&fMr!)5'R)i3:%}]fa[ ;h2'o'eNBbֿN9*SW3!;B]c9ޡ %WאDpc-p"HY^u!?Y,=X6@I "HI5Lu'I TeUh=xmlr 87-QM: D^>k)*:sk2I^DpT@mSУyv1B~ps̿T&ZN7tYi Qש]]g2eXd-l V-\UqA쬗AU:/L-t+-ʉƮcʬq` p Zvvɗ|?hKq9ǭO聬)Fk 9vIT~.!%d@MM% cDޣ@sa&.'xT:\t*g qy]im-cI[m@#@n."Hl)W=α//&^ WC6/Lmoh^8&!Ss)-K*pѝ/qXg@he]mg&$PSλZ> xӲƛou%'k9 >Ua:{-NJTad ݍ[aZ_KOet7m.p;$])WRٕ*?heNs]L{+ZhTiЩMYCvew5ځ-AM"G%ީK%. wSϜׁ&{n] ¬D%#Ed&!VO!lR=W` \pZ5"Bc$jhT~g[ A3#\-8my.!+Bݙ2?E)hNˤAߗJ&$K?o^ф+ZaW}kvsϓ"Տ|n f_߂Jh@+L:2TBup( )/OP(:tjWԠjIIPRܡ)ilI'ɓRR)I8 p)$)"RQKzIbr(Q!6$8)BP&!"ےR(M )JRRJОܔ$% Q"RINJRI$tRI$'I%)$QQ(CNmI JRI)KrPJIj:v%XWU%jϵi V{!pܯaYt㼂 H+A]V[$%z\K'EmeY+IB`hD*9b1W BryIs N D&Pڤ0%>Ԕ1M)7)L$ JiI@5H1<' )yM)LkP,F%DA(Bؘ7 Z$ZJ^R%%(@#*$"QJR*rR* Q(KjLt)Q A8jxIKJSJ)BpԔhJS <$*2J )t1*$PIKO 'bM)CpE*EKʘ(`R>V-lAM)CaSސLXXBP1jzb0Jc-ҔQ 6Ғږ)JQ}Dm)))ԡJREܔH$0)$ [bBJI"' )n))&DM(AR))J{RڌPEA%=ע4TPpS JҒJRˆ*a%-)9 %6TNJ_riLJ*0)RC)JT%)C-Q-FRRIN S$'z *%Ŋ&0yE5&B@ԶޡzIzI%%Gz[нBSzI!oO8?-IK&إ-ͩeޚ [b}'܉'!ze/L>oMOrR-R®Te&RSJ,¬ $%&QJDUoP$Jj[U ŋCR*EIiZ[UdςL9wƼ0|VzkmQƪ..NzUn0oZJ侵uQ]&k-udV`2RQ8vang H:=Ռ~Դ\Djry zcu|6=/@;[ϒьPlK}-o+Ex _T$90Ϩ)yV }Ol7},:gk`S̝C\pe 7d+NYc lSj]1`upI.%fUE/sEcO̭ ,ZNcK \`vɵHkŞDp]nʌWⵡӘYH1.%|W9P_cls ״ uLTμwlm&xNqgv4@R;F wf8 k{Bƪ&?,ʭ7-q_Qt$ he@-_g#2 8[~u/ iTpC5s'qg{uF=b-vAST˯K<ƙkIl\oZHm{u"v*]"SBt˗g} ~;x dcf.]!#=Щ HxN|]6t6 m2c˴$y%S6?S숐"Uə2=%8 SxT懒V$*pH ytuMѵ>)GUiulϸG,gA>(5\o(ynoK FGKI"کVͪQD(cSp'S*kaƧOOcl$CE :(^ $:Yl;Z!ATQK! 5s;Od<u+!w*I4С{ưXs Qnֆ= U_@{۹S]уiLy H1#]TT\l{M.p`d]W-f 4ElEJ ˋ אGY/ƹ7W{^Rڨ1DL!=Fc )އora0L  x,@]S;So+A }DZ*X'D;5)]zݴ%xVEmo9G%SxNNo'!kpXA(cv)Sa{i$;@ R\wx- Od:jnn@ BE(4B{ ZC*Ĺu 6B\FAɧ{H˓%^Y;XC]`6LJxsBjq͚Ή][V p`h3%>(Np)ikeDžϽf;}PB jcuV̻:d+t曧 ~8JMyFǤL"5C z}u C@aQIL *@1#P a4yc72nL$習2\uF@2puC*k([}D=44yFM-ewbVVoSoA-9wm Ѽ+M7 Qn1J6%HH䏚B'm<9;oJ5p9˨n#Fʀ`v1E5L1Rn]c?^n(p˺Xph]Q,?F|ㅿwB(}&@ cP*3aë4LtWX!uVQyVՌ0$ԚJטV5Sc=2qT3 KzlWVŤKfbU?Os> bƚ{ܷb6w7N6 9my+,uOv;bID{dI?o^߯eL'oLLPҦRZڢa1%?RC1L 1hUBPSd8GHMAh}!FN J=E*?*k4NHZ/6J[c\U;AH9eՖl^čUQU$)@%(P"KjJfMXڛbHg)(JRY,Q5% n@LIGS4ܫ)Ôi$i&JSnMOb[R@9>-$'M)Jmɷ)lM%.iJSoKr[ؒI41bbԐܣ% $6)!%*SޑrIJGtѢWCxItV<,^t[Eb! W8V*UTtYЮ8.1*@,Z:LYsB*f !VP)JtHJH$ҥ(mR )LS)nH94'ڒU :iN p !Pd E2I]$ԃT\)Q%$1 SBp jml$ I+bRLF%)&)1!<*;< API1*JԶBtRܠ jjN*g)QHڣ$/)SPR %3LTw&.M B)tCrbj"Dې@R ! *`5JP\L"RPQ@L"( ԃ@RGbpԁ0ґ }4%4ࢥ&ޙ1P R%2ޛM mQzHnILFM1OrpRS-ښI$iM%3ޟz$ 7) B_R $j+Dk (:*J\硒Sj6E  g)!$) B*H\JBBP&)4I$ILO $$ JRJJ'JSJI%):dDI %%:I(M)JJZJRTm JE%PnIJ*[`0 nM%+yKyM>K oKrJ[)Bj[RcXN yIK) ZX[ʪjM[RRp nKqU6-,r ?;UP.g3\ky3\wD}7кn˘΅ӄpr:5-!. U:RB\]Rի5S>0#}ڀ:u%lUpq~h|OW9׮qcDxg; at{--O7ņwOdPcZ3`fujߎ" d*2tL %?$"Lh<Q STPO#h  4r]P)԰`O}WsxFnἡ"cUkm$M.k]nCD5QS}@ '-;yU4j.gb>Z˵(t9JRc}B r>붋iD y$roD7X ef :~)SH-'Ti@ii x .yJB蘦{ IqöP!SFGj,t;c !M2$( ˬ;i iV3=ǒ%^wvDVpe:<$ĎPm[@ւ"ᆵI c-:H'TVIBE% g9$*H`Li= bM!kEF"5g"6Zy òK\IO!*Z,tKotm4VƩI_$2F;&I:KE֊+hiGKX8*trMP$)nLցxLN\daZ&5TrA/*y%XRFZko%EԉVleoa4ruF"7/`.d$c#8REkwPtlF$ƨf ;gA( H@,G6ir {g9`\Zh~('Q xĻOZ8Vmx_:dЊ zbA(_,>ЋU-G%Pk.AO9-W+ e*%IA΃@#U~eO*7ß5W68h.!JsI›D*y6ZQߕOz֍ܭj0u@ ?Ւ0Ufᦞ+ Z{h]y Ѵ,q;G)@ NAj3c ːh{b7wEn?~D'PMU,ک$ XZvI$p=KAw WDRT `h5Ԫwk?ϸ`U F(hl{O &xDǠ>jP.SƘi@jbS Ԭ܆d%@pԫ6Ԫ7Y T$PpY]H/=*F+R/ 0{wYVp-`Y+O$Z[;*2bI[GʤyJ7:BC+H$RE u<5; vt047-:9e - \'P4Bu!+sE 5t!!xY@%ֱeU 2UD[ںҠ0Wɻ"cZksѨ%[xVnw<:e np:pwbc>a R*y<'OhWqVل@D+`UrD ZC=vV9WlmMh Q /V4@0V8fcb29B# vQFny2i0SCBScRXGr¤uJi)>vSD1<*`;,:@{ -5Tan䚛 +,61+ M hEW6]xv膗_&4\r~(c:Z|PkBҡcd .u0mی-\X»mchZV²63WQu;Caɨ"ՓljպqDj$U׏gUK%H[:҈έ -+#y$6t:D:9Q4Jw$Un}=Iդ=V?Dk> zE_HFKNT]!y\M[ІӚx[#'9+yE#aI2kj(-]Ǥ!fCZtIDs#zeZuua;)+M˞B42\*Q C;ΊZ! )y ?-o&ey,L*Tkjxs27%A 3P8*dQnm?R5@㕺9 EV_y<1qiQ(_ K}pپҝPB:'vD"Өj>;\ wpgfR 5蒖xݯu1ೃJ8'=DOM'aWyUk@uDr{BS0ˡ(ra+RFς,y菴IDŽ7MTN;j`"=m*Ѩ]=͐ ۻXAI }V1-.=-7 Q28SڛÞ%TĂ4tDfKHH8H`T+#[XpHQ2#X\ D[Ȭxh^ Dz% S{5EkK!pQS2̂SýV\j]|7}Up_[zx{^ݯj;B`VA [NJF{^M cq-/T.a`-zG@(_`hLq,Uߚn!_³fyZV"Bi`QpcU 3 F7忹V)*t?H V╢let]!Uw W` w咩[q) B5 \e`$zoLXiI ږRB%1JHއc))Զ$%T;R4 nIH(Srm)N B,oILR*P#$,IL5JJ%B[B򗨒IJT(El MS}mDcZIKJ[ڢkMKz[RhJlQ5nM%/)JhJ4$))yJS% fw-J%g/Vt hK㪳IR{ES,KW=WMc7<)l}롤\6l , XIAS(Q.LZZ P\ N  `' S ILJiPH-QR4N Ԕ*;!jԔRF7$JpT)*m(%%:R$Q ZS1 pŠ:)*OgD2(NIH$\S"KI,'roQʓJ!8%%!2i$p=TR>RS(LBm鷦 )};Tܥ-ɀO$ڛjrbFQ6E Cz7 U]TWaaD(()yNTI(aPP%%3%4TL$r*]2IBrTRIJ I)L%<'M)!-D$iw%*$)ZJeH90rIJМ48yKbpĔLZܘH9"1"EKoQ ^T+ M=-lO%--nKrpਆBHbZjrmJyM(IKBhO)JyI2I)hI:I&HIJRL)$t򘔐p% I% bҒWNBxLxL &NI$%)$)$IE$RIJ)BPH$e)JTR$$ Q_)gu +DJ>gg,w͟?&΅ >]M L.я#DEGu?HWVx\_w gU.H'poi%Nֲ;MyL*N|}f(n@M;L~XE"[̂4q9fnUVz{gq,KU874>o]bZ=sN88o^YK^HwcCi.j|y.ڒ`8P´=ޖx?I>I/n 'U7 BrH8J7;I  UMs zMeHzmDl* J)'2%3۸GTU1iyi rhMel }$nKstډff[J#Y`s lVʃo(щ_KvI{$頃}@hT sʫu׼w]aW~8k5q:~Ud(s=;A 4lF+NDo4j|JUd5tT_m|'YA"\u շnk-;`x#ezi?j4O2>T[d&Tlw ֽ0d8[k;Kّ(͎ژ5(YC: )ჷyf#~r.-ǰa5=vD)rRiɄ\Q؟&.n mMnlk}3w Ъm) tr֙p=nm +\ښ,eRcY% хjC*HَCieIPE,_%٩QfdHG#)lJzڂCKyS$8Lg+S*nF+#X nL`%4dcm~)tDz+hʴĀNum&ֿa`.#At168xaWh'{JXpy g5/;t YM i-Dr~6;XL< t6YoS>2D[M%Y ף ̦7v%jedփ!f\]閍=ڠ;!-q{ £As=;AتZ68K.[4!bUf. d"|cĂU[m$z9I>!^C>!"D0\> mD!SkkIz6`օJU84w>(Up].gΚJ#v3K .stG˵@%qh]S4xUh7<2^adCbBlä+L-is(BfG&kܫK%6dCF`R^Nߠ~xڤ J.QhhX1|6(B$MP|lƩSI,oʞNSgBoE<#SXt=4mWRMP{tճ.>CKWfןIQAN)ƈ$Gu ucAݷ҃0D] Ɖ(PQO)tkBfS-[I:;xj&̈́J3GV#Vo Ή1p5ę@FϊZ,sxk:8O ;;Ը4pAWJb擌-L$URKuxmlj'u!1Y-2eb V!?ne}|F5ʀF j uXg$K͇OI:H\42yFíϱ'UϵRtOA@{څ;}[PWQIa,,ljk`-,l[45RlqkKPY;syEp)7sVpOdJ4Uj"#< Rw¸NCH9U(Mӄ72R8rRCCTegMeDn}J@ H'DqNFT@.%Scq~ѪvtU3vU47ī?g@Lfg /3(\pY讚 G(n͟IzHX m%*9HUXrsI q'50ҷ$QnsOeoUk> - |U?LSէaMHT}>KG UW]d@:MXA*#iqV݌JU8!ƪwkֆ 8A:XRT\Aئ!NRM;5t/O]a~4V akuU'a@Z D`!Ūջ&ۜCL+XL.THVYIB _x!4X\m*vn o:hBf6 ׌KTM3k`-5hL*}j;ZxLe|\"3Soꧫּ#N繰CrW\sK' k1źH-C@![0fz+mYcy͝^8nt`cp;\' uU"5U'j҉h~Gy v$.'{x)kI (&eK`Jl"$2|=s]4{6%qɑ4JҺ_k]UH2A-Rm:j\As)hHRYSYͮGksC\vk =/>M;?4^.v cjHAh;(NKuP(!JN[,kqNC}F٧:vQXc]⅕KDGW:BoD8d$y}Vn;$3\L}ʜf:蝙CuB}|Ңiٙjar%aFZ5hF;ZZ i&$h  $HP1me֖ƼO٬:F}ytE'$_k mlQEria8wWq>H6&$);%eLߤah#E OyCnA1> x!uGAϟ جol@Fziձe[Wg!Y8ot5yh%sBUntq#]G+I%]$K?o^rMv?*|TO_ U^Wߤkp/T^y)u[ԵQ8qN P+l6/՚Wo`X!!) ׸?b*C= x3=z!p9(gqZ`O$,Enr ZZ?8,[#8Ѣ4'.Z O Тq8m '=Hfv_Xɳ(n[maTSݷ5;a}%*nנȡʖ8 +C-hIL<'="BPJRSʊH%$2 jm&ڒJ =Qv-IK)ȥI&jJ]2IJ%4RԔI:)$Rޤ()I$PZ=%d)(($NC[%0%4!4&-d>B-PsQS3ܤ!'W,N֐LJpġo)o(0 I%"*LF )b"4&LY*LJD`)PrpA%1ħLT1 TQR )d*d Rڝ$䷨lO JJ_)Н(Q!JT JP(#P ۪(E!-eYiTiV%=$ҙCzm&S"&ؒ9Kzቍi)BސzROKbJJCz[˓zi) D=>rb?L$Bpw6$X4'!S IJХ)TÂ%>⊑B) @GܤUmH=%"ڢejbЭO-RGU`֣%)i("IHIM(Sڑ ;ܒn))lKj}-ɷ$'-% ܖ䐠ɶ6T6r[v QХ)JJe)D5<(M rJ^SʊZ]$)ߒ? 7 ek13*ӵg"Ҳmtt>1}3\}N@?޳rjcn8 OKt8I:WEv1-[k,}!v+Y;iՔ= ~aΡ7sq3wFƙ05q8P.;c+j.͐.%0x?\ü4`eKwEN2K*' z~7AӈMd@GMA{v @u JϪj{Qs`%G)u Vǀ:']UVnI'uW=]alقL%hsX-a!枉{C;k+ҏfskD>HnТ]FծpO;YcHvmQhU}!󂩝mΑ}IW S B<'43tLİ$st5-@VEd!"*4zVJ 2ï! ׻!:\@.M?MuZ{Tv"#|Z9#^x-N;! 4$ewͨ947J6 t@9ǸOU˟cFE(p'a7 SRTzu[颕G!kNV;i{\ u[5ߵ{6*H@qYY tc1H"}3c@+VpJg4g<-f{!scy숔i6O C&6LOe}첩0O}ᕺo^U^Ka->h86 2P_v$x`cHu&U=7&9FwKm7WΩ,4Р;,cj-..>`1ۤJl $j?eGa vE d!RJ!i:{wAց z%kk "[f ,ςXՇ n't: e[›(Y=vDz^.qHc6nǂAx$ VX)RN UuɊVAfq]"i[,k ;\³y>S8ky#.f#jfMDkjkûh m6TlI)ݘX{*LahKT{̐U0@2NOoo6%j7k¥^5Kez 8ICEmyD8SkF}$ ecph|:Șu(l4UĴTj>s`TV6lq)v 2|F 0x{^ZT/Pn8o5M G --h*mOh˼A c"XEf;/&ɐK%ӨΒ5QokKе9׃>Ju{[ʖ<}BMRV.Li::zߺSA$9'~ʪ2B.ikN+jk$Y(lĝR*U>#9*ϵ,FwuDq@WsBƤؐ#kKH! <%K*FO {s"յ(Mʾm40hv(R=ID *G 7{u%W&q.I)jWaI dHsi [S+&LUvׇRSa)5Qi.T$Bk5s*șt ::0xB@uMi2 ;pEof}|x5 OckrUCe9<&ýYsO *?|;¼]H;qQs}\44 `0;{0 Biâ&*JTH_j@h4Au`T5P6nlpK{/W9)R蜼4IP,(yKy *0Pc[Y8M=aޑׄz&4RT)3'A¶ۃƉ Gw%Y͢- Us l{I0 lCV& ad5qi- @N:wtTYܴJx,l*&QxI|U-vE!i4+]!w8MY!>9@ D%KFHTB5s\0 ٝZRS ;)t򣣔|@!OGwKoѓ z3~x0xKq!1iR`i3i-K2\kXZxGdvJ’8BT~[ۣ/(mOR5%IIWi)[p'e Ub`jQMn&&DΉc&E-p%Qh?a'& -IZhS{ 7)xxj|i0y%jmi&4Yh-xlV~9% %TDέ:)O@4TvSG*U< Rw¿'ꀎ?lYsoǗ-4 ?f>"WJQI/?o^H}%8ʽ-G?O{cees[1{:/Yw^ݯ[ٚBvX ,=RO$3UOhLXЫ?6[z'z,=quqxZUZ!c[\{vOJ]x5a[g-gP-3XNަ V̧o_]w4\f;B۷VΦOuT Bʭ1>BԣW_n6{?,KrR-ͯ5b5$ e Rܒ(R' SILBhSGr[RJxM Q!9riIJ 4&!JS)$ mO)%.GjD)JiIK:jmi$/)Jd!)B!@bĔ'Q<LX$)W#(B%)J*RO%.)IDQ KRRIQs8t5ԗEgp<\_~Xp;F6KMOe}ҴpݠArvŦ5ANkSAn] &5Xj ZKD4vAuBP]ȅWrbMhB}+U:,˄FIL^VaHc-=9"E;c0xXXFқw4qR̬O@'] 2I HԠkZfE:"-a2saCU}ԠR\ ̭U](J}fM([ wքk(( HM);J3uBeeXeEM iJpBreR b!RE+rBJQ(^cxPI J-0j,YM(rr C<"!%490$&NTLI>JKUQ))*r Pv.t#*j fQ tޣ-Z-{ܥ6Ҕ$;RM()%0؛b$#n nA-RR-AE 'OPSAGB>@@So))Eڟ`G-D!o)z%!b`Q}DĔzQ>ċizJAmzJ[zm1jiB BS?Q/P TLO}II@ꘒ)ghH0$n)*8iV}0SbBbBm)b((O*SfBi SzWʱ5Ԅ*WIV=$Ƥ<\\-U.(%&5X,@S)zi).DXz[ܖũ)[R'L^So)))p')m)ڧ))ކe<j[TDޟzia6D&܂\TKJG-HUI%D Q6$z%D,V0UӌY]PJ!duq *ggH~+l8~(OfKк^uAKa^QhGci]qYJiO~]`$rV.*Eu$O\mf@.<ٖW!H;o4 oZ,ojKw%s!U{*V?'@6T m%[`˦knt0hNpzFbCC$Vmi-2u8j43SUigliΊv =JF0!po:LmDJ EȩqTlq;vPH-wjO|Å[+Ր!aYLO9ӕz.RיYIX[ `Uq뭎xxqjmW%hmS AL58Nג` KwWF}I&'Br.s@ēH7f}7)<.V{up$;{@uo :&gL}niΒ\֛sO۬vk߄f^1I r@%i.r:\ikh{N[ ]m-!˕;:p 2]I4tWTud|dV\ 8zLi H ȍ "LԪZ+NμöB'۱o\R^ʠT3h~p:Ɗtv-:{}v;w=%>IZ>-?rlk1\QcG#W*=sUF[=hwIap{%ӴBjnibk^K5zJ; -vS4Wr2 Zo9 ƋV:J6T$)@|Tӕ T8[B*o+*8IC,MڊtQs_Ʒ{uoS<0hGu#G][tRk]%r<5;lwYTc*vʘCu3U/ayi8L3=4]JeX8C* 4۹)eo0%m#T;tQ7[^`Mn fD;c~YZv[qOt-Wy0pRg2ULg<'e{m>%!S\$& lbmw`]H nɝ^RieG*XAVw!X*9ASLYg{8pN#Օn8c5u 745B9wUKΉeuَs YIfboJ`~H:{<[亦@;ѺUO-U|P S\nRenaV ;Ȯt Z'IZ>zd8VM+'~eFAN=AQ!\fCl0n:);le^}y\WC %Vs'DQ_Q:'FjvU:vטtZXd9f#qF8( H J)/ԍRn `j֋65 y QTʏUMCB++}I:PyLw k`K*5's^W 7tZs-3J\;.E.vi*/k`([H|QGюҤkoRF5% *6{gUyW pR;fjJ# ( ;*,WRt[bQ k |^\$Uca&;,{&fYnżJVLQwRpZfT,s蘸D5DZ*=$nf`FMo-xN}R4k. W?wSk$.v" fF-%9ȑR8G#]2TY҃V@1kO*[T'ppyKUl 9hhOh$K`JSFޟIjhA껏I~ @Έah^A5L׸w&IP9T_JDJGN Rb%0}˃i%nRm'Nx(iۨ l C~PՖ@}ߣ\8I'3 ZF!;{&^6n aV_iHR<ړWh#l,ɝ`'0;]Ҋ(6ոjOtUίYjۤ8z j=6hڂu>\KH تx:T0gUtBgG boFPSN),xhV/" s2A*)7rJO$$dvQl3YѠNK jD!|hU@ɎD&2习S{4QdkgU *vl!jAA6e2VϷ#'E\S߲g V6jJVu,ϐ 9NsY6:)[a lsDzf #]{=Pg@ D6vn:A .\<{<%g7o|+bU@9 س~*oŗ/H΢+cT$ߗ#FQ+a oyBI$j=I$?o^nqC/X~U~͹.C*yX˯絛-/VԱzz(;7eV~IUUW耍BԣXkG~A*b(hZ;- qZ.JJ%$lƵPRAʁZ;oL#jL_ C!eHZB8:oH$uuh+7ނJSOꅘ2J_iYi :JSK 3)RH$tiYKaZ&BJCxKpT>ԟ <-+@㨜tT~BBh*Mp!T ЩBZgDЕ)/!jJFBJNZB MJH}@)nS5(E%3GxO&.Q#YQPR%%!8)aMBI)I4%<$%)$4')$$(b8I%.RQ05sؼ'h谴^.+uvI+MV0jE/%p+G@2ap\4Yhdp2Qvpϸ-΋nD+4 DT 9n*0 'I2H)NN'IK&)IO)JdSJHV!Q,ATF1+D謇HLS0(EM;D)DB}`‹ B=vLMUMIR>-Jm&u꘶7**ӈP*LrD6B#r6ʘ0B;) -Fb) Rw*YD"=Щk*BHSQ1.p)PsE*orq(;d!敦i @c,uZ.v್* SvS4U;Etfc(,CyRcÕL 8גS^XX16Jwpg^h|!U*KzCR [zVnJT bkKj|H( myP#U0 Rڝ4A>'&,RҒ>O ;ԥ)IL!(P$))C鄽$YM))C Hԋ)JJK%BPjQ5%&u_bA<$E2bj,'%%ܘ J%@%8JRBS!JTʔ%$LB.Q SJS2j'ޟz% )bޚ>HJCM#RrySޖ)@SnKrb[ 4%BSnIHT(&ɋR0HOH5JޛzJXKjbMGz})z^rޚcROz[R!j)zAr[JH-KCRPJbShJcBR$ǨIP$FM髥6[@⥼~cZ%ܜ9UR ڵZ9B*p6?Y 鴬~d.<~Wg6~ هFp..Op]H? av 6S}d]j3rKyy~sM(8jO ~refZoRV+cqmm?=ib՚"Uk0+ۮ'ⵐp+é! d˶Ƒʫs7D'HQ: ]a12 '5NOej !$ʱcd @qk d)Ǻ̃P {Ʋr"4$蟔͵jXefREz+Nn"#">U M:H-,].'Åb)N5 ˬdY PuaLKB\ Zg|{SsdI /P6Ĥ i1L -qif+C&6~w!NwIiYU] 8p``ќZ{"^'DZLN] X@qt\\{ =lxTKNmx J/U4ePjci*y˄O\2v>M[6<O#7 KpѦPO[=W:{AOe nhxܬ!$#bfA   (l$B^S,h:%q:fH#LO(XEc ʜ$-mF93+X0L)Ӕ@t@lѨYTp,:sF0[eVKu 6K}VyZq2? ǝ]_Z Is=¨-#VCmA癄\LHP#-ʶK[]N#+unOߏ],hp+E!i0kʳ] .ڟ26=Kik;9QvYOf/ѱAVN6ch'F4 OO[wttWc %dnXl*|Q<1kPJ9=VZ0t:M}Pka|?V n<4 Yc5=*rw 44r]G1I#N˵M͸v#)Ϋits/to+ap34SŪ2&OY◽ =ScuUD U}C 1v3Vn;C\4(TCnj+xl"cp\PӇ5W.*+n耕b.vGkh(. <@PeZ_"D=˪ZglwV=~֔i)1ƺ׷su(;R8k⨱na1mF)^kA ­Xu>tV& 'A6n+oh9i(t*6mtI!jomR?@—NׂсIZWDŸs41PѩvUETo;5&A*u *VgNiC1h6('YwFm ON:Y,$B8KUJ*4 6fO ֒=q1Cmf9*{#"C^ H6N{tADm:H0;P6 _At0TC[#ȫ7hU>.0-:B3e/:iUf[¾}.])j¡k\9H;DGe]}2IA$pAu F;X÷C<;\wsT2RCFCFx708B 5tF;y :TA&"SkHDrcyeW!$+9>jW27!sTx urXaRȥJk8K ɒX+̮652 hO zHU'Tc8so4U2 7 |h "a&*_}]}Ӱ QtoMoTxx*ᄐ!;}!v)J!vCZ> 4e{kCZn/pi+Υҗi9۠:=F6s{:#M 귢6ЬkS9MU;5IUmU&uL7oMGnmbGM=$*u70mʷ׼DWӲO ;$7r `('٦D)l^K΀GII h E#q] zKYۺKΩQl zE[ZΟHp  L+#PÜ %TN"+RúfЯB~Eat@JʟR$HU#]4?a#H <"dz9`7 m`(-HU?JNZS1- egj)oTݔGTFSdDXJ^S LUM`1."IQ" w`Jg IOl%Tv}ֿDnFINm.<B#50`!",P4]{NJu5ܴ^Gu'Z5T:jz@ I8H9>IjkU 7u_p[[z/`.?gdnރg[ZtT8,_;{ܷb=%μ.G]- 4h_qKi!gzIF{$I?o^ȼaWd"Տ|n纥 C.aCȲd+LX2RM)1I+QM)IKSdR&$I)$$JRIJRI$)BRI2I)I$%%)I16Н$qNTSd W($&"IZ JJH&%jl ʗUT깡7Ք6Jq$t[O Z%8TRD(e|Е/YP2ٖЛhJN^8?gZ{cXJN/TÎq֡&BHO ū3*BނBo@$tDEh*A[Ъ*Z$ݵ,7-!gdgDoE&BE/9r|]4VV*[\rTbٰ!"E<+l JpPRKʌ(JS4%DH)2.P.HК&iL)SCpP F*: Ng?EMI ( EXОSHELCS)mPxMEI=Tj XQi7(0hAN @e 'j0!;#ШYby%SsJcI 3RBAStFS]/aRCrr)b1bB$aX~X}G¥F#AkCQJ0jsasu\'$+JMhh34]Q+-EZd(6 DΪ-ԥĊmc8J(h,}ƘVQ{M,2LeJ'URP-S EnFk GE;So )AAɽ4 KpJBHe)GiJ &=%2}TS2*g)(jJ*pS8J%-2Ti@=H=1rmڒ>ԃO ԀIKmH(@p)JPJe)O* %1B IH!Ч)A$P PO))) M 4 ʉ(%@ @$अ-DQ-DI%2R IDmRRPSM%D%& rp*n0$ 6&SRRlM-鷥%,))[^[Ӈ)z{ m%-騚7%!O)~&d'VBЪjRZXJش0+2:yIAXUDZ!auQg.5ײh .rYϹsv=LAQx+~YZ֖;k.p1>KR2'=Z/vpDkad}Uఽۃha\̆M~Gq#H}T.CMCOA% lZsA9ÉL:m'!O'qk=Gh.[˱`$vHUyw\ 7!>vba/-«Ytѕw[ Fǖ;mN:wFRvA'(WZJ\'PQ;)%( swVV`phd8c\YVڙ R.,K .U@q2$ʲ*N}@7"3xI'G!WKL贩>N`&H*@pJ46x> ?kqDVJMQ!l;=t8mN|Uz{z 'Q$ BrAOhxIWqn]RPD'IEWf鹠s5;*.s9)qv}r)w)% 92& M_fѪ$'JU2SRDi⴩k#sCG}5;_$WAs"V3¯mE> )@]4;ef;]1 JgWkUtnVF]44Y! k4SFC:7ua N/4eaefX[qZb}td_]JMNs@E~8e_ mm!#vƄ*^$^%]mf;c2hQshZc)&q2AЩr1lȪ/h61 24 vcctZ&!Fkӗ]8i.eavV3lgV=:Kno+@Y)ۂ5 w05+*mPjH>+..Fd6 jAȩt贻ocGUrvjBsmE઼S-2m9 Jβ9*h7ij*Yh ׺&P2GMԪKh4hW}dCZV\XxYWW.5J=6A-Dr^;,v=pb7_}ddžs ep-N׍Cr^R*m;zKc W3r*n氕C;vF4OGk}۴R"Dr:V8p]3&W;&H EK iX7D p|@PIwQ]MaJ+.k R#iUomst~sX@OK`rE.S<' tXٟZZ+vy)a}bƎeYKl#PǹvpPL[zYwd}NqnOc7 Uio@A r,i;G%ZoJs[$Ys8[ΩJ&11%eԹ*3s 0+As잼B)9Dٴ7EAk}btRz!A4Rc;l*Wq" j1+6tu 5j<)<}fVXSOt43CDKUYV@egdZ 0A`wuccAN+%.%6:pU#NUYh l$y`)֑wa`)ͭ?pQAi_qHtEu lh:aN3 *yЄ PeEHcpRmBqP7E!W %4#6&|3 xh#a$j$&g5:KDATVL42 vI UweF23@wVF;NhR4ӨyD~a7d /@vTH0+Z%\n8Jp swSzޮcIOeTCTٌO ^; !gx^2_[XƷCNqBחXFwPkϱQ^{S]!Y as#D/U=u M7/M@Y!|-1HhlKTwfcHIis!qP1*duM`ֈۡZ镹F{O)+cRI7KlݍnԟnݶZ`9`'+Mc+&s2UrpTrrUPVtSe}a-wd .Ɖ3S r1(t5 @ߤ!1X{鄍M:xM5gK8 u;ZaWG5-K*TmJ*:Vk3nC92.:4KsB\]QMl%?MVPnK㯚_g Sh(+=:#Temg3tI!DTIS>Q6*E'~uuCgW!5]:6^Ы/;z[F MuH _lgDf4 }YHxiV׀20Cƞ+M]NDJoPP$;- #Hh$ _dop.c颞1A jVxADm.`DvK gUm.(<'6Bi= KE&+\7FVuOΖica Ť )#RZ)#0`&wRao;39NۏtT]\:4BvA43E~rSטItQp)F@m{nsK#Û A[edGP%8{pV\ٖQe΋&ZF&AK8g[<*X_sgg[w#!ˋ=&,\Q4v{26?# m# F#qphKI%AI%?o^":?o^9ȪO׏|nz%~E.G 3^<6ԶoM[d_KY%HdmMXS, )6sZoM*Sz*C'mSr[1 BRSh9<-CIOj[RJyIZQI<&%pI$ВI]$:I$JRI$L<)$I)I%)$$BJRI$$$N$'I%/)&E%$RTP$RA%JII%)PIF$S9JTQI2Jg- h)^~Pll"Ќת;lE-kkT-i-FQQPM҆iCOvZW*iV)!8mIyRUQtuPi(TdZz}T$bZ0Uc*$nx mjpBroU*-aI F5La5[kptdUv,))po7Zu rJ(Jb’ C xKxGIK%aKb*k } Ϩ? BL kx&8X/ YnD)}VST~=J^ *_hTJ h<pVRU *AS Z%A нHd*SI.wBBҐ¸/Q}ҫIH )8A]_- 1tNbQ)qAK6 _@::Z-y)CEڒ7IrU}Q(elMIu@NIQ6%g[)#i.D7ck6Deձ*̪^u--x!Z,{U kMJM%!8C) i%JI1GO'zlQ,JM/M-A^Ujm)oI7-ȾUIHҒ? jzihGy)䤤 [J<&} B8%%"²R S\ʉ`1b®-S$ҬMH!z R-ɷ"iv CNnL\kQ5B}~}rmȞcZԷܒnRKO>Զ-)[ܘ6‘ 0\*S )P *{Rڔ')JJmAM I2Jd yPLt ddhJ$)L% IS)JTSI(H)M)(M IJ'-- Rz[D% XR%+zz% &7VRAR-f_5Z| E֟"ˎ Tz󏼮ѕf}2[6} {7.> ͅa} ΏS[\fEfm,r ck!J>b42^ 2T1v*f>gT82_??Eu Ԉධs6^\F鉒RAћcXU*a{]}(*ecA*x]R:)JRq-n:M#"T1khJZ6.OFȫ:/?[hmmi".p$w@c7|Sqqg=}Xd*CM\Md)"Ij0 Rā[t wFZD $ Lne6q1p2C"d<:.-UhPC 멵)ƊIsg՘OK #]Ys[NBWZU‹Pyf^@TC>[a@5q#S(ږk@$SGyh3"JÎw7A7:8`Jl'IDּw D2Bhyj{ yJ?H.RVv=2ճKonQlkXD4"VGXN=v[o~Yu5j4IEƶ?j.$dVm ];=+\]&t ".T$vZ;7X Ck42 `[IJI-2L"0u%WȽۤF794 ADĥz*`rtLzlA\&AZx ?mѼHR6Xw  Đ5*  O*; (5D΂ },J0nqUIu<ὔQt3m~{ j _X3Gq)xݢv%YϙXa hQlI;RPTBw8w(V vY}<Βu]/n᧊+= s 0hZK$ºی -3*YA$SZ))C>[SkaU;'UnĻW*ͫԑ 6#-H~ Djn簽x!eXH쪽ùH !t 2?͸K"p?][-`(։,BQⓌ H^8UwH9U5VZ\dPK‹۸AJ%(r\No HL"\ӽaTf")$k@Rk ¹Eqo mܘ0;V?LJ4O)puk{=H$PnhD1Jn [OmmhX=1 t!d$h3=qibXm9_5$c^ښkgନʻ*542J9۵)DNB,-|{6CJl7Y8{AJ7S)N,k\;Hi0+!sU^@i0hk5% Z D(y1h+L]aԼyvL{>èAicgRZfp#W[Z h •Yv" C܋ ^hRX A~=#V 9W- ,$fUW_=(ld4OhHNk̋ZqfbnH-{phG(ZI߹Y*-ho 7cҡgTλhm bXKVu׾ɕs`pax$R8`{ze|4w6S싷qVsĔj7;Rhc0_D`+jtL a #/qL#u?T0q\ LFhk.Re{B=]R%i5 \qE*C @'h)jdcV+ITYyBa ;tSmekjZhNa՝Ѫneu4%e[vMY\L}U/Dwo[ ToX Gt&7WTjr4F9D/@D$fq zJ߾~Ioq ?R=<M Q&O)jf cxX$);zz7P؄!1qq!jjQխs!J vMFX-]FT<_ydȟdstWk s+:ΨpT}R)Z!ǧ7TAڛ&==ݓcNT= @)XRQ)Հ7BEn'SZRpgHSn3f;*'=ͤ9AF!SI+" tu3[7;3^ngi:*{$Oެ?d!īv6\?EaݗhߐʬZ%\ `KO@,cϳ{,٢Nm{T:r(S6AE*z CCfU<Tns q$U7F u)@ٸ@Cٻ>˄6=Է[^7G 05F{HZhݧ )M.p;p;DCݮ&\fx_X%Ӯ<ꓠ"#>j5tZIg4h#&1i Ӳ'Rw#EMóSiЮ_moYbSbm*OJqV` D֎BbK2>+-(LX@QB1|TەP}4ň@ t|Q|Vs%(⒛(̺U&5Xd(J()(( j;S'%4(pd2IXN$JJY(R:dҔR(NdRВxI:RS$(R$iONR$;RڤyM)&IKmKjt)LJ[jP:R%-(N<)IKBP$JdRД)$RЅkQ\G<(rr-FlADYZm zA+ ΨUVގХ86V ?gVp*aJ]LgMpO?*@NOHxC{ ?KZMQSڂK6,ZM%Jz儝uܫ|S5+ZƥJvKCj^F_h)ό$rT*B|TPtb̰z)/H#T#('P\, C6CKW0 SМl 9v{ 1ӊݡ(j\*whP9a&,*ߵ)j<*w>Nx JE*?eY6 uP4M6cJXqʰP9 p;uvHC #BqUy0K2@vY@SZa=ҙ+o^sswUTaw)r*ܐ1hevAu+4E6p|,6p]aqC5ʉYN7 4 ⳋJPU3B]S2WCI}*{VƄQmۂHUvYRSwr[ ҤE[KM z/T!KTM¤HApTSmK.!oM)nO1 QS(Kj-(REKmPܐzrrmJS"Űb?sܽy!ft@f1> ;,!J $4Zc~CE>a%JCvÊ(o2ʉA )It X ~=7WC^Ƃ\e%)hk(aCŚlunׇ`!YÆXcu?-,[xlkk;Z 5 ,gU ;|+.i v7h+qtOԯC!Ƿ\z.k jD8' AGE5۴LѷB~e>]S%:sH7m7՞s RBI5"N8s'od D\& ,:5e qTCk8%&rp!I!}W9l:⧑+vN$5:^O`|SXkFJP;Lfݭo:)rE"`IC6X==d v 4Ʃ6X6Y@]PT@I㶚~]wh5˭qcG:}$<֊֗MLI$lJFTnЃSixc4o7RN][$J7#UBnJCù}$Y1<銅;J+uo_I]&I$^mZv0Amĵ1mgR G)$kt+kB~A`U3۵XJgoX5_d1sNۃ,$hTc$ I;ps!`ۖm<kJU-wo*&&R& *.p 5^wh[.'C.Zw*i n 0&Ge m.ApĒxDb@h:*Z %>.+t)hQoRZ)11r%1nVf[*OPyg 8Py@BweA5*R׊L *GG9ٴ*M% R:8*){0L#w> :hN[24 U 2Qˮ{x%pbE$OdxU7\Qm#GrZ 1*ہZ4 EΰFj\& 0!F R%k#UCPۡI #TG↶NP3R - :6aP/}OiA*2&kyWp]*?Aգ pQ P}ewn7ddPր`7uSߑB%+,8*,o rv6hF6ylC!.1p$][N7·0U=PL7@nO(58h!60urN5AfeH"eOI{ }"3D,DI *@CiʆG5gRHv;vyD5+4+hl^S+]Uffʚ&asj\ڳF1yӄaNe|nFg4RtJgTe`BvNYdJh-*Ѵ%(qSWԙoAe~:`y̪qԅ!`/HΉYS+'uX#rH2I]C)}HSvGd ЫU`?۵WG^dBCIn>H f$j-04PvZt?%+Qͤ!74C>#37 JழA- mDưSz0i $91έ fn5oh]goO}G˻ݕ;:;erTeW[)@CLpMB\Vq[QDm+XtcĠB+M9l-Ge6R2b*GeEZn2;1D.CsdkK26eJTW{X<(VOdD&+U@zaU1:tU4x lxNù<'I4E BxO :IILa<'IILa(R:I$% (NiLJiJRRД)BPRҔ0)AM)%0O [R$e)ILa(R:I4%-BJ2%=m*I(nO$)))l)Ө6꒘&S,(Oj Xր| k-YZCT[ܭ6l@Ubl!H45-SꂠK$)# T-@e"H< !jFio{#r[\o)P\= ZQJ9)};J:xO+bk%K*U><&-VIOO"sO ?&ح2 -*Бo؛j2 qyTEV廧@0vZŊ]T U.o؛$/%l՞V !@;-?M"oKUwEf };-M/MYmrVsܴ2{ H](zJ'h!jn)QUrP)V%6 *) ASm![*90PvV42cjA(-sP$ɶ*&ԅZ Ĕm '5U>@ZI.3Q[&TM rYSi)El}&0Ww%SZM6¶(Q8[TԅZ-WDjR[O뤧(-H᨜5bRY?>x᨜_$m@CBBbS˂bM6JkUƇx(: zA-*G=/8)P5ސH8("((!z1GJQR!ŊufSjo 5!S\;ADдސF©aLeό) QZfzci 0Szei(`S. ŀ!Bz,*; 8'wH<,Q*sa} zZY'`>o0N_cw5lx;K7CD+6f: TdוXGڈe'SkE<9CZt642 ?#)  OԼhfW\9J 9n8CGt*|Sx9tr=ih<1KLg6@Fc7JI&\mo{Ck{@W328 ƺ Q&m[*몃Ct 684IOEhu }yhhJ˳{N@ ve>kBQ6sพG;D'&k;& ,n:v. ,jmlNdwAs۸'TA(JSG(Nn) +-6:HG>530 E,CC w'认c[\P4~2"uS_ Ot c"vQ&l04??H#$x%c7~Hw@oT]pcCe9#vH h4AZv7Ag?k%ߑKNch516W.'C]P5pcw4.cwcm+νR`x+'0\tաg<ȉɑּmod`ZͪjK (a )teܣ=i{$ X hvy+4T2y- o聪Hs[ZkCRruT/Œ ~Ud%\+y4AhEm{*ԡTK$XJuQ26BP%]~CD)V( L S5$B[:Y*Z4Zαxr9FmAYNѬVF?dzdjnS3p3n")D*S*cpck:#3h*9*N&YFAIOd$c(;%IՆ4tZAL%)ј?Bv*kuW{i;j,;XP![u,jV anp H|JK-g @ WP X`=XRs0iNr徭ݗ=l`X IhJz=wFuͺHP uP1@nssˆʵ^kŗWAqjc8d:?d{ZuRPȱ۸OE\5NXV͍'Z EN殺F]M͉\0sXoh=9!@\A3(U[X'(O P45O_Mo+hJO($ޱ(kK l)23E-Tۂ֍xV}&rSLlJn}ᱵA㹲hvIh!cZtTRT)p[E;suVG`꭛MG=Dz@p6\F0_N-l8)T\0%Y6Ou|wBkq)<%J-HaqyW\SM (ީrg҅b\4)VpUVfhn#1N=5IKE's=A$BU഍J`F"Gs$|(JEhPRAUm&Yg"CfyLʮfPvmi_hp:%9*l YkUs@tˮ +ӻRv"epvWC$o{Jԯ +ƭD+N`{U}RDQ*[ YozlkG/o=KThnRxUmc\uPuI"9ü @jO b$"qf4h ZJ'qdn!X*%EO!H(&D*i.F#cޓ~ ZXDs&@t@'-UtfNڛ#n$r`![<|R j;4*ᵭ]95=LH5 F>ht(BSmםC;s^s ow)pxJt 9P1C5"A>!Xyk>eJ6~C|Pݧ BG ^t(oN,0 ()$Hגhauf&hcBZ)p/E5XJ^X$O42A蝬x^ߣL qJ@&lKc3#Ijy*DӷWHɭ?%%;Õn{4}!u݅lD-#N}m8 س>-_vr/QAt!n]įuzn-.k藭ϫ\#P$UnI$?o^"J?o^1!,ٰGVF}|\֮^eCԵsE( ]A@)Kf5[ZWOC0JG%PSXv"ْ(44p)!Ձ^M z!( }*oKDz5HVhgjcCUs3a쁩R %X `SkҢ M1sZ%g>*hxAU9P9 j*W̯ yFrhU!Q~yU%An!]&VOc+Vz{FTcy)b@E[')Jm)zȩ tRAZS) Jh*[ %*m%4Wv+{oP*MH{Bx ߨzUܖ*ڞN)*V}Pګ)E oD%&5KTh dީA(JpKpFoTBP UBqPDܖOTJԶUl} <%O)B%%«[ za-'ޣ' [[m-H=¯yKVe2%%s* 'Mo J쒣 -ڋ%)( U8Kɑ7<(b i}R(iJ\*K i"z/PKV`K`RIKz[ʂtiKmJTKVФOqKqQN)% e)O*!:TXNS'N)ib(H'DXے*)BxI:41)&:IR (8!BjT(&cU5+lVl2+9Rڑ➂XP*U\9ZJ@ZDiL^@L!8j(JO| :,BUNXmiDEBIL6(moBNډ "oKzI)TEOI$ڛj,&!yKyC%#ؖ B/R l 0 "?P$~Lih]JRR@&4a2.)V%5DYJyR{ܒg &گ ԆB>ӆڛ`Z!z)ŅS!/%k AhTf8jp4ƁŁ?h ѵ(WT\ iDx5bV yV.˵O(V 4Zݮv9($j\ n t*LU5YQ) 4IAT v"j 񶵶Dmel+Ƿj\?K>L$#N 8J%ج֏1>(omۿIN{v> OXE54jO *)w ikIx[="GESjd_K<,[KmӺ$j;e(+۶=ǔr%>MVK7ޘ}0}Gӣ wʆkkCGB:QUIԅ , I1>K11:dLEgE[UڙkP5DY=~mWISZz#8I|ƺ}ʀh+w& ,pJpi{}B[tdIvQ['^U}=]h:O,6<:꡾qJtŲ隋\{(9Eݾ$hPC]Bv<%g%NR&$j#`U\9x!mqyk$ڊ:nRZ.3Eb !Tø [IF7lK(kXCA=U굍 gQ4| )#I+XLXCLlv6+}&%"m$$A,w@we*s 7WRE (eK#q0qp}`q|J$y)HQu*uWeU{`Ua:(xtGuUQ HU] oeH-G77;H^jp$hZP2K~wT[Kedm`A#&~WvJ;G{n"]BeOsa[Ā}.=#kWczn\S)" \4ʉ_ u8WqxqϦ_#a%It{B (T.cG [8VBЫRDic]!s]Oȓ˭ęb:k :)^sPLjfF@6DS/,]V4VQ cNFҢ*t^x𭶓zYuE5l2h암(κxQ6=#ѫr%l!Y7Ɓ;dvީ >NX[Klk"P ٓ((pL&++<#$J$N_jkFK&P1fʴq[u&fݢ1 իCeewT *D[` '=IZ0Lkw$iq64Se.)>r\ݳ,Cv}l𒚌aJkMnweH@ot%$;5*=Rs4Lh_J >݂ʶSSX7IB\*q]Ӥ–5Y})oցPPN(nhmN}=4:-sG*H#gc8${_.pe-* h?1H1*{> z%8(KmB5CulIQv@p%v wQ;$XqMAEa͂aU|лSTJ mu6VhPv[@;BcD*ǥ շM\%4f͂t&U @P R A=Uv l4ق՗Ü!Qk=VnOYT]µCܢ7C*m J#>*GXʙfS6F;yx]: J]\VGwTiYFs+HcwC`%vE=3CoP` dWp7sK%MNU1}`=OA~kS8Vmα "3,NjՒM$U=-oۺxd8?MC1;ey;OT(x283Re+=OK,2Ƣ B'1vV>fԁ {*Q(w!ʮ4y`Qd7sW[hbO*܂1$-Tk`GΪvAv\ z1I }64DLQ6#SAx 5Ep"I wUOBm`0?;k$IԄ_XLjulC)$4xC9GBΗe*fF3vVkO KbB@Swa7޳ "# {[ewa |7g]+pHl$W)ȾKxx9=-ʯ *^%7-YT3,ݜLYn1Ϲ2rr*wK+CI% IRI%?o^9=?*קּZL_7|/c*srs$ӪoN=I%wq_9P9QI.q)%#7h'l娜TG\E0 N1*Ip+~<@ )I@I.Z:dSy*TG* 8Rӗ)%kyLI:IpnKrJ0I*UܔI I#JJ[dI$ZR$I$ dI$#IRI$$!JRI$$FI)LI)t$:dA*I$I$)$I$E*I$I$B&I2t$I$:I $I$IK$I$TII$BII$IKI$RP$"$&'-%yLnKrJZSJ}m*@'$$%H-`'#%1*e8 %QMJ'܍"%1(4$ R4)&!6j0N $4Fʹ%! **p&pBc *@PCB+ZB>MZar^^ Ui HVey5.zAXF^) ZB8VIP40ȕX*&؄[)E nR5&Jg mQO-nMRR(O%!Kr}SAIKB[T-w%(:BPP)nBܖ8JCAܖjhDr[wܒ[Q6rR-)ԡiO(;I(J6PIH4"mMS'IL!2jmRRBP<JRSJ)M2b[S {}I$;Sl#oO yIH&a(EJ )$^cR4% ǪSWܖG^V!"g)Vܖ4@+[SB T8*'+RحSKD^ڛj/)ШOSppശ^ ҵ9g(%酠/RwSJV*'XMꄽPb8d(b !7<Rcljpc S;iAj懄z۹"6& +tOv ;!p@ـ/oKy+7/s_D( {bBwgD>#]:յڹcVnlDBOIBSùX<KFa1> Y4-Lr8T *xSC *b[5Lw;Nd5 Mp<'WŤFʱGAKZjb5J@ۧYHiI kHSH#x)dU陞TV,khk}(P; fSi.'Ee.ktWƹܔ{Yɩ͆{U3@ʋeH!َY!FZb!hc q[0QU)%`L{&8B4j}+=*- UU $L*`+oq=?WCc5')t^ۛUW{]sW36f#FcUZPxrf@;'ur1ꭤw!c~ɀt*Ր)`J͵Q*NIݣUz[ e(I(1ĝTlcA*.U/V8՗a'LC\ɨƜ`AHG0m0%${ fqUÎ4QGj( {7 GuB,᪩tv ̂ [v8c*}^*M.{SƭXp .q+4 4@D' 6<3RVAUMT٨R f Ŝ"=2֩!+\ӻ I$e^\#wb8 {۵$ ҁ"::laD=n XPOE:D!¥-Bke^sMctYm64 ^*Qji↱Ğ^֖Xm^5ֽk r浧&fi$2=ܩX{vQ` itqjnݽ5=Jrc@$fY^HG[&J{k[fPOu,&S!D} 3 ^(.9Xi NQX![p+ŭY3,:#+h꽹E׀|UreHjͧ{+{Uj9rIoԺq68;.YZ˷aчnIB=D#dnmVmhs:Ӱp' cZ y o%B`NY@ӯH7ȹ .þ.Kkj\)pӬyĸy)GrԭauN" dAn~;"bQ5: j;@έRw\kAls`vU\d fTfTjf=Y(Ո?o XG]yD"mq K(ܑb^ noܲYMMT<TwXFpi:.uw3|APIaNCB;PK V6 -e^LF oY-se(o$%UAN  vYXs)U0s }xʛ4+5 0C4tlcg) M|w\s2,v$̌gR jio<+XuM <Ǿ~C\gnS>0 \a hЩ>ܪ55;j/*,vL\%{*܊ JU;ۥUU="L'44VP8Lm=d=em/(lT=ޜ^]I1K$Wv;v&5G6M$ӳWWy[{*MUpPy<1:-%/XǚW5:.uc6~۩1M&&T]ҙH:odqwnŧ\R뿬S@/=;KIG=-{hwэ1aj^JN:z;xf;GܛQx Dƒ#k t)u+}GRm@jfw0qʅV4a>j[*OA͞"-qܬ  g|Rw-8|]ߣl5Pc[]IykEZW{,}Nw3X$Q^$_?o^Q-^cG/7V?sUT2?%}g8~K$-ȒL2I҄IL 2:(ILQE$S$e)QIJT$ҚTRS4e%I:I)%BLJyPOd))yM)BPR-nEJ-mJ%%*R(Jےܒ)JxKjxJnJRRҔڞI4(ZI<% MIZI:t&()ZXRNiKjVY2yJRKbI-nM)J}lJJrm2lO.%S(Jw%BR=%jP(MRD؟bg B䷡jڕP TQ6؅$-0R6ԸICܟrQ!(JL)PJT4!jI)FSKjpyJS$ 8 jQ)JiM!Gj}ZҘBhO8R%4$(KiOEL&.e7@O S2T7p䓨Q*Q$BR.`L4)$.ZIH@Q"?TQ GO*[P<( 7XRP6h MjpLbShd+Lbt((Uiڥz hD-P )I) 6TKBhN絼T\3ZDŨ'.ÂqsO p, O*AKaD-M64ې)JxJS$nKrP19>ܖJv#MHI)B-U}-XHJB x)j%%%I r[$i0{ޅH=KKII!6Q- QRRڟz[KzRRRЖy )दSB$"iCJJa NP)Jr[R4(FޒQHSmDС-)J[Rڈ =8zJbLGb(RҞRؐjd%nIKRJRnILRR<RRД% @)KyCܔ;Rڧ Bz($BpХ O)z nzJc%)t,rzJ{<$/pUd(aIm#5:P+,*9ui*Hcϥ Bg(-zϤ᫻,l2' ]pp%==+5R["JMAvLm BI$f]PԩI$GtT$I;WQzDFRI$oKh捥 iqfEhהf6SO'gঁڒI%Е RrKHSjL$fXژV4qӲw hGd%6ऒ{{2n 8Kpp $bJ"l$!,8 O-VFezh{5!ݯ,r' oX|8+{TQ]0,q"b'ET8RLF`m|UWfke1]8 pj( 2 D Hhpa-DS8f;+OĤHAׄx(9ţQ?EA#(pTf{" %r^8n ڙ yM.PG7YT v+IHqō.d4ġ !DhsN[ #A2KlnM0KS*[~PlX\ t!\ E["HKNuo>* I^@ q"̃!Fի !#Ab&tS9`$+ub[D`Z,{)b1)ұ4-[>)Rw1۴3! bХKJٵ{Z#Yht$7J-M^ENwHB;wv@JS9HH1DvZGF"m$몍9$D$4 \'$ۅCcZa%GHQ6f  c) _1W,]d rNGHQ&h{#D\;>(4&Sn<-.G*h-_i"JxL"NEɱŇc} $ (*ZŬV2`)-^\5;HQrru!gh'd4ܮkѬǡD{p2(?tNO{FL]w*qwHepIDqkd= um @fYs:+\fl-$J9na_0`'R /EՉS=ÿ*ó}ވ9V **>fcU.aU*yuU撅ɼ$Nhc5CxTB`xh)n$X1%MP758Vp$:[)r ]]BQIa:hVWzu%e9ʅO`(,X]:#@$zK+k꛿ť Opt -]U!ʏ]G'y-:\/`{!VzZ$ǨV2aucm`{D)[ہH 1syTsxwW_X) G3-q -8V" U1)@ 1*M:c VyX,n3ZyG RB&4B`q].4Yc>?fKn W8 ?4u%x-lw;HuFYNiEXl-gٷ.xFƱ4*l^o*2"kEvlfdEcN륬Ϳn6M n*{QK繻؀gq#Ue25A7kS-VW6h˷Y+[\GuW|z<O6އ[N {KKvZ*:z:xuG7 Ҏ̇4̨/  >>]-YtUV[cxT:mV7ihVt28Zr)H]NkaXptݱ wJ}m*Np0H%vkrVHߡzi`Y CD$7Cڕ QSse>je!jQS^ȷBRjv4QlG6cT"G6AqFu{kd7z4^ռ!ےWh:\ݺnQqȒ^oOt\ϫue ekQ2}=WuvUzqk#}6j߫50dV}>ƶB;*2\({'sw@42^ji4] 2 tUhX8XmFNMNʋqṄIGγ96PP8U[{ zm ,*#DΪ_<o7+ʑl:GwW~}0+4NQXBBӫuyLfnKJ{ݢ?}b,qZy–?]Ւ|WVF ` :) ZV4 %VeKKUխ!〻uͅV·C WKG+(\eHdtz6-; _]ZKWr !̯%ih7T=rJciGxJsk?f5N&ZM1bU]ÄbR6y ЉV 0ٵ}Z)8hד!Uo$̝[$Qy6L|QKpN| 5g:܃Ut,>4JjՖT4|UͭB'3ntJ\%VhƳLVtǦHN |Mq* zInqF1!aoXxO : ԪsS>Njp {,9 ^ޗU>tV AVvINj'P*fp)elzjHfܤCSkβ8TUnCme:;Lf TǍAʷ :<)R/Bnz!ӲY<=ZePDVX06L N u@3E*൒cHUO)o-)R矇3*ӗk\IhX &[.d2g'=$Bey[Hv]gnG:!zIZ,H)UgܖnYac2@[>$J1( J+)a:prn"Jȃ:t\ UOzglWMà rȀձg|TGoŘ W][r#gqC8[B,c2$IBzI?o^_oJ ?o^Q-Uf?96Tr+&SJdд,.kxNT)Q M1JRnM-Z`SR$Z%jSJS[ܔ%ZmlJS[n)(JKmO)JSIM%JKPRR(CT% )Q4)IZJuJj)LD$2E4KjYmɷ&vJ [J:GpM(KjҖҖg)GxKxM-[ }QUC zF>ĨJRṔ/UB}%Ui$% KQ4zizIpZ]R LoC)"IpZa)sz:8?Um*LnUO* Umʉ*J+ 0Um&6@TMTS*`O#+6j786T^V'+o?T*މDaWrVi.MT!<}tLZPPV^EG3Gk8UO':&܏n|}gm)lU̟Jۑ­woy; }cr(aV9j;V٤U:[Q!4[pgOtA=fI*MTH'dU0lT  MÒ|PI@D hR*%\Ϋ#2gD0JQ6?IJB)Ȍ*%oM@% Yftlj!aV}af^-lVR-D7!w/)ňbEk(. ZWۢmPod+b{P:%Yڬ 20l'B*-^k BikU](/ݐC{~ &fFaj>*/UTvдb^) \Z* E pwJ)$15SpJdZD67F*Hl+귷#zg<ऒo\xV,TSB"Kxu(I+OE|ђ]3z#s*w JR\h='&:u֋8) DRP+yKyJM&FJ;Rڡ&7C=oPڛiA[ .BJK- iJ қUcDRY>:SIV6ư%[p_qKz11%%zqbCR%2ڟjjJHe-oNژڢmO By n@چҒu3bzAE$ P/P/=fJpDJI$e -lx8$J$U&QGJ"$IlxN[nX(JI$U *#K"G"nRI~f;i3DL$#JI$^Gd;jS9%mG( $IĖEqOii>e@ ^RI$NuNAPZ8GcA$C °5o(aĘ(Q I$&=P4i=]E)$CcT2ХqI$V7hcfHPee^:$JU[֒# iQ9{Cu)Ĥ([`>.ۚgh=IEPT[@YYeDB9x2GeRw$62{'qH,i G:kV-[sCqzPhun;.e:+澑HNO6mhV_[_*8hSP,i!wKlP=bϱL-Bv4hIC(9JalS+jo ^ n0G)w5V~vl|Vk%hY%ִ7aR:*{"?ZG%@"5Dk Z Ŀ$;|;&;N및4*l>St:l`v%e Vmt%^,߳q?$"UaGh E'Q$-pkb4U{<VCĞʝ\Y`}BګVIkfdư'x It{TjeE21cYxYе0m*:žt%P+ ٓUԉ\[n)T.Q SlAƟJgtlmaB$!e6vQ7TFK)XCbd>iЬ\l[Wnh.@H:s)˴ omi ՇaxR9d)#XRRG4ABnhqJ(R <.֞T]I`?P珣 cU:h:"4H)R&IZ7Nȍn%V.A9eQfB;i VR/`u%Os] ʟY$u<'5j[.ԅ&dy)RR(켉mCn)Cgi)iS"R`IKHnHwj$ eh7 Z.6*i[RX蘂8Z-~Nafٚw@:kM@sI:`4SPSm%{#}j@%X Aڔ_I羊m. u[egIP}Sm @**DŽޑm@6Ns+hr[#̬vd9A/U2D$f$(wĚn 4Q~טnNCL˜$*ޔSsS! B=P9L!Ԁpt֓dAbQFFJ` 1ꭘ[a %0`aL(tZKF k}셝WPA#ԍA JL1hαK>{:azCEq°}-Vo>h1 2ޤB*/٧#qLh2 Xg>H p3joR޸ƾ\4F( (Bz%a4^Il U(EX 9Y <@mdxNUAAg \@r 5)ņ;XënkEecsIa 'WD+_f$jN0"C*q!3$j?S_-quK?%\)8~ _fAVNߤx<{Z~K++:KupXЫl3 5t )kL mcJd< -Cܲr:lBfFkhoU» X\JmX9p{jf$c`Zܛ{~^BGC{G Y)Ud`̶bSq28:B昳XiGA: E`U7[O At7}dsXwL-qsGA 3/OgҐHIQT67V uB_5x Sl$J]!.aB,13^QMJ"8-UMѐ&9a=:`k9ۏ:oLw&P yExB^)jmw{2THO80a*X=6<Vx=*Xݾ bgoi=po-eۄ[\kzGk̷$P^$_?o^Q-^cGW<7V"sUT2?%}d \Ga$z) drS5Y-UBoJRgͅN PU߳KV oel%QRU@'B\ uޠY'0QT=2UH%x-BoX,ITEE8][<V뛂,\P9ttʃ,%M6RJ<JTlS%1r<VZ!*;JRE6&mO mO4WSo)B}w&ܗUޖ-{BPw&܍*ؗۊԃTO#JR2-)JTE((Rڋ!69M)RmҞ .М5r}2QZ6rmEܖ)M)RĶ#0z#J +JJ.8 =nQưKEH@:.>(az[[2Co;kKVَ>* @x#ORn}$tNZ@ 1qMH(a^%nϨ@aZޠLu=Kb[5 T*ϗzaiM5}%6+? Va鸸@-ОV}yϱ4q̛As;s{U9®%E@k7'W5s>G%dYDN$ns=4ưc Jg`8" KW([Êz▊ hM6к)I\z޹pwWk@J1t޼ux|Sa B?ހZ%gRyDoU? MIID4&JX 6En.LC}znM Dれ Tzqbҗ  *U%'2VS-ĕXPQZLyJPw)1ڬnt MtjTI ٶ0SèU.dQMu;Pm,i^;k ~mU/~l6A:ʐ , -w_03'e@^{'HSFig%>\$Jn 5*6>^etD׻E6--V7iR)1"CDwdU|VGRyF['U *tHkE6I$9A5Pʳy{\4Tlh{C@ɶƖ#cc;":ksCyDŊ PQh|TL*͏mvuC,=q#!ʹ9diN huD𙭁 >'G*H$OecQ7:N*p1Rdi9ܨT\MXZh/(طlnӡ hY5~ u}i< Vk*-!I-l[pbBE#)9keXǸhcUӳ%(l0`ȝ۫B ҃VAU6YU0$fJM+WåTϫtf5? R: Vq^ѻCXp$םkf3nEskl@eTz-0URȥ֘ dce=w&U;fLi,qW᢫{*ȆRlSK^}THk{w΁8CB}C|48*WKcR4ˎS,ܜw<)Dx ygu¨xVX{jD`{ξ֛bi>,s\CP2dWʲvܮHF»|Ο[dQ衜DIW]gN*^xVRf{ N+ s UW踸.3?ӒRXvMV+ok=MB ӯ .-hdrЯ)U(hadܦvT]^ 09EG Uv̦fn0JvcNS+=¶緔x^VƄ,Z3*? :uC4Qv/(Ȕ0e4=R]!"WyׅM'TF(VѢsZaHܤ/XyV1sC-7 v НaExd^RmU7Q 1(uKFoINʽM:-c$%H{6ld+f 坋_]rM CҬMj^rm̱ۜ4D9.n r5(V֧@#"EA¥Qnzi a>dgMCדYM;vAd> US6ϫXwJ_Hkt(g) #j$)s*8IpѪ(T%#{r5%[UF)*g{+X*Ccv}1&I;{ z)W!RUoTc7twe!k}YZ#`')@`G'ugURBp˺gVy<QӔO lcV4#RZYt&H: zTo^ rX)x?c7h{N5Z?`Z>+z^->| I U?؎ܗw*t7_ܷb/5}P{^ۜ%#B龩c+6u-/'I$vI/?o^s qzWoUtVW?;?"X]Z,PBsPFBiqO S>Kg1ÕO P%Jg/Q QJA·Ғ̣IԡHJAҠy!@D2HEICDkF7'W!93UVֆT SrrҘ"4(3TfĦ%1*%.p-)JJc-p)JiQNJByJS$:xRE)IL6ڤyJSJf !JR foʁ )% A%=l6JRme4'6>p47DBkX;˶ἘQ&>74{:}[[X{M%DEu/g#0:m߶a3Sm7ĶtAJr-tq:8 ~1^P Fh{Utjfg+W#Ԩsz$ӧ}T~r-?8.-gQu%]/{Hiiڞnvv~;m$DoYD ])"AD*Wu\I(KY>&k E-,itLI)3 tHl7"*CX׸ v#"\`:ORh{\xUWe8Hku+`iOKk0#SxMɰ:fVM5Dm$9 Y}p5e8yies~RgN74#9Z2Hޙd;Z+Zdj*\wG:f_~ּ<1 %^,Z>xZ0 CS_{Al6G#EޚqV]u044>=}) bCiAGgdUM~ݭ.B.i W!>*c;@.n-~@ksKKcpvg2[K%QwKZ\ew T0mP{HDZ-g^h7C&uUi/ѤANLbfV] 3{GL`Hl40.K`tAUtEʭq,8,@T0*d5 Ӻ-V0o''qZ;U9װAôU*`A-}q#QF?c{'0#S ؙ2PBz$"*l<4+OV Z ;1n E#̜.#0ȷVA/]]7wU(B,:+wg[+i s8Nsx[Wĝ <,WTr8}BZܭ>-5~.̿YYUԈR*F\zAX:SNB(O tPr=F%IMD . ^tTޭ@UZQ`Jl.ŋWhifJ٫ԐUpUƝLՁaˠos %5)9FGxµ &C)}QxUo+n"%gf^p궺{ ݻl]N|VGPdKo˾YVI!V£[qg:3R;d#`V4wfieh #U2IGxO,ZQҒ)t]cG%&;شہciQ=;@IT%JE <,ݩwt@IT%k]HbDlsO43XI$'eV-iସIl3Yg3&TfuW'fUvh?oD<w}_FIC74 C[|ܰ[3QLz )RB X$JB!%߫-6}R*H̭l,,t_Wv;JTH K&^ljiZ\cbRRDM_S5'Eܳ vWQl$S˵dF6+-%:-zwjS4G HuX-Eg_5}]ƉQU%N솳W(6ĞV:KmVnn/ѤJTUMChv%v}"\ ao!Se% JPI2I4$$I$I)I$I$JRI$I$I%)È$ISpJro(I#e6VJ(\E\Eऒo[rRXZX|bHReM%v:p&bmsx%\9@ VIhzs#I- /qr<wARI$; ;xRcU)$@ESv6,Lza$HOi;0aAaiMRI%7@nRs62G=!H^Zu)I${dӺ{j!d$Jm1Ѩ'5>DNYU)$S*=ok(iTII{9S/' XTIY`*cAR0"kSI$Ky NMg#vTIKlTw!cZ9 ]$IBOi jSQ#p4kJI% 6;:#z#I!w P.1?h$HeS{+ НP1RI$=)[!)I$qh0Dhm5RIRI$= Fn hJh$H?`UjOI$yRl~rІZ`M)I$ͭ28H]*iwYs[M x6NUPuMJvƈ-+NZ:;ied8P4LGp::{69ďT[ZMx z'kVN[xPuB|0n;:U*}2 O>}|~r'x)wJ:)xXqghk~EͨRs6vR28DG kǭFTd8G!: ;M$ H3qGV1R5mLq&e =Õ/PR&9K*;!J ԩ2Ʉޫ!fSG`4'tc`Gd '6pT}S<߲g6Np0BD85Ru6JoӺa?☼R-Kl RS$ZN~,㺎HBX@ Pb8SA.kݰr>0S)(lh*G-qrZuK큭GBK -q q?KTޔVW)r"n6*C)~+&0ǘUÛN 0?[v- `CtV\ U>2SűIy2I$4މ$_?o^,q0ݭ^gGҾ:UtU,5֖.YbZMhů%1eIV=nBK]67]l-c T]UqnH--+VۣO۬1ઌ>\[ІSkv*|UǷfY>M׼ECDQ,@)Zv8n?Dmj٣i^FHO^;F*"ACLҲleqM[4Dȝ߲/[m5Iނr):恩'(4"3c=I8"(~ "qi{@#W9R I):8 ʅt 8g.N XVu[ V;`}cˮ2?[wlcX(cvs>n&?ƴn4*994;oyCvO(xhh#DˋdZL_zOv&Ηkk-c?bc,`%DUl׸Xrcx?Gl&cAtc&:;N =M.\@!ޫU>1(#ҁH{ Y ԀY7rn5WϨO&@ w k4K@Qxv+u]mcm7ǿk~tYu$OѲM}nyw+- V]{@!Α_?gv9\AJFm}>< |r}cZ`5hxQc{y :U.cw:ds*.T\[Qa$4VʵCqph.Yκ$XpR6{8Dd\=⋑CKw6`aA>)1@4n}ͬ GM9-ԳQ5:X@Ou"5H ȡ{tRf9;)["$@H]i\]e ks\b)u#m6;HiGzoP0^ݿjTIn1DJ5XN֊çC(lkm ɵo TA$۴V̸ keq'/Lƨzc_$j@8fC*ݫ|T\\6 V\Ybq(Ͷ~ m4@qXx r,;L$0 m3lh`+w(i'/,ul 6];Rkr)D3.R-CpN.\H3%3YcDFJG~Xd2MπN2Am`IP;EuK*UfZXc;x7fe~ lo{#i-*7Z+4k][B*swyBG j^:x(>`RC\9 { Pq2 6i,fFeJMcͮ-'`ho~ 2jߍcR^Yw9W[F$pr^'M7,4m$6L pms=Yoׇo$[Պ; D̴Qv89(ŵVc +Q+kκNpJN~=/DBD" Dvn~>6=2uOkf9W1Zw8;%Dza>hɍjuxmF׹VNl@WcA*aȦjf)]ljmlqgښZ[TurˆvBc˄*6SXP֍FBIKcAɫ&Ӷ3Ϊ$*{ -&Tjpf=t1@9Jkc )Y1I(ޛZw D>j<_yAk7)7-В{uniQv:)1{&v+$ZX!e]I.v}T`Qƹ[ICvѵT22nUwSa{X rgX_5MSI J5X/2\@X=uxN*.P#s >4VhDc@!Aʖ3GUUpmidֻѯR8ˠf1@k +YE705ξjw<tpTw]pEW 76?nf=:/Wqr`}FAF\g,.F)hQtIE4)BhIJI$RRВI&I(I%)$I$IJI$I$RI$I$I$I%)$I$IJI$V1 t%WH Rc,rI$krN4T{BUAZJ$HphQ$TZ@' (I:nX:`͵W+pc>6{,DZi4-c1}a/qS;,ݠuE7DtjV+1pF䵺̔\mSyva"ZXXѩ_{䃪~Y:(,Vd2!}:r6$)2'g8Zb 8uzD|s1!†p\" Ot]*Q Cp l.D]`p7Kg=5h1iݏc`rpOnaI*V\7cܩ/2%"% ,a][ u_Iu^$ Ѣ qHgnp@ג=+T*9NtM8[T +Ɩ5ChE/#BI5I!A(kU&0= uuQ{5I}c@'{a @jcTM Jwsw)V\uNh7u _ki `B:>m%:E=µb4S8MM\(C\ @oSLU>c)@\4@וINyEoW=*CUyc :+oXVg>hͨ`&'nUg p3)Inwu]$fCtbc骞kC'6':pѴV3 #3!E0q<9GV  F.foĶCGD/8qBҜmTӋT]Ҙ'iAkʨ;rQ }MqLVkf+ @h6#k+5D)prnΑLۯsv+a4vZݬ7* Xؔ6ny3]Ze}R8˄k\5v!+vNqvK|`Yc Q7B2ZtTJq2\VـLRF[O8JX'.n.pt~hZj) qDm B;%x:`V(^S )Rwf-Y"h+dc9iPFҢnF{ #<hcCVo{$m)R}GdmViqc ;)zT?} LTۂHLkoeGG(tHr索ft4-Ƅ5_IS}*$#9-<4J% ;2|7 ' 8Ö%IP8ZR;W inOJٍ{vL^ЬzօZ J S8Q8{d)XX7J J}PG{'83i &_\d8 ^8opɃzDzF҇' 'mMBS==tO)#ft)%@(SRR~ ~I*[tJRWI 5Eշ(w(3յBS3յdgWk xщg-ׁ<;lt I%U$_?o^U?ZaW}q'eRsUAKFU/7~)]([Sv+liNe> y8ĎN̊Dy2^ew:gϲNWcNݒu y(Y}:j 4#yg6} _e}O 99UgW Ԁwg8[D cÈT tP_Mǫdׄ=K%Zӹ`gL /n[}&DxF )U$ pŬ84P[h0!敝ndіqjiaBHVmc(Ǹ ZH S[ xM꼒{%jkk5 kI( 7A N:LHs53,-!ȭƾnk[)w4D@.ˢIvwz4BN‚\󧒓7e %$F1g'T`2|T_Xb*b;)5w"9*>!+& !A1ْx jkD[ yOUf A~o.&%#AFOӑϴVӺQHHTMez$jʙ[ƽ:{+%ų/<㺓[z-h :_L09eggunkj<{M[9C/Pp~O_շIee 9F9s?6UpeEA&|}hPpm\ 5tޙ~5 m c܁qd{g__U <;{ݼ5n[ƊXҝUJ+v<9%Z9C'Oх oj11@"Hh n~r koH#288~DvemYM->msnyUp#wt7cY~H74R$BIP ϴ:>YsE'۫U,-pRZ(ֻ} @g}{,."@>=I/k4U2 `A+iXZI]k F651׏p,qn@ w q*ͻ|~~O+,zsO?O^UyRF>U{6f4Ouk-v%ƈHV^h{ۆ\*I;ȕ[+븵ߤߞz^Ƹi!OD :Dz%7swW;nD4οxFWC'c.@ǡv2$j^V {;#{Dh#FK~#l `6e;XI Bݣ/=ʭv3 -t߅UtXO76_k6=AhM1 49Qhkyk*l:I ͬ~[1Ў!dP#豋BU-oiȢF.n<;ՐecDMVjeg˅cp աVEbd'tic܁Gs)kg'h'v0A <|Ήw%Za$qX~10G*< Ӵ u2Tl{\3WO'0n%{&c HS$s@jޜ\yɰe=LQm־w?e=6ʁLKk):pc{sgғ4Uq&?&]8}8Y:eNQ6j$Whn3 zns ‹ |Ut@ $8ODVt]75@E; )ysG"uYwP]mm3 u#?wcpkv⬵"Or  sBo XWpKOyTj8DŽau#=v:=ĵ@eRY[ƀ}_ht<#m.N΁8' Qi-0Gܢ !f.Z*( {Aki륱{h}Eh5V)MR7יD[baVqL1L "ZDLǰhL~#zD9q^}Q d~@Wljw"\E[yVr5 m]uW׫v$$'{-{}6gB2D[X/;\P!{(dP;6+hr#ږTN {4UoVǵͨٗH gX $p^mЄ*5EĢ"A T7&Z A*Ŏ4Wds=Au7W-{#EAc~&4]a$qh^[K@nAf9C um+@h%׷kSh )ם3X^^OGf3)v |SZe(g6qOi,|PۆOXiRS(pуhn.ZIJ'SNT=#FUu1 %EuӸm/PyBhAVGև P7cQNCn!N@-|*ν:Ρ W/-9E#'kvPM'~˝cCsWp, b1t-Y>SϚɅ|s%gҽ*]]r.%u d&QI$% PRI%LBhIJI$BhRRBI%M Lkp쒔I(BJ~O;%)$CIP!$ҒI$!5u:34JI$6iLI yN4Ir x)9Va%I$DMx@'T }:)$RebA"t%d:Jé->^)U=CuDLXО"S> %tFZ'Emg{xHDKe1 >}7jX ݰ*]0Ži({!eI: mvAJڈ M$J gQS )zI$΀Ҝ0a3RI$FDirVI$w2K L-Ѩ RI$'jlwDeSu^ƒORI$SOuH44II.2U,$W1xh7 BUI$/3F;(Κe{J@$Iꬻw9Q/BNԒI"Ĕ7<uA $JI$Уp=R$J0 &s}# $JFjt:v%e>RI$xHB`0NRI$q#;LwNUjI$=Ԧq$NZI;Ayh4Ch^Q-'j%I$;)5# \\t@RI$Uk 66J2jSY:dw=n_apI+&XՖ)N{ԒdEP-CbRd->ЄY̫ I)ڕ]19N'M(n>6SW/El$[h)9vq'l#ou 4N܌[2NJ3J@w'T@nΨ8jnј^d*O+.f8Sēm+qT* he` &*KOEĨǕvX"eA 4ruU+8d&adO)nUF+QKaD軓KaF J-ДUL)J;[i*l蔪n3)s 0KMASbPt"ʛ2#R,)BL*RO`&qRv@GyOY쒭&t)6zD4"Ÿal  4EmpYJ( @A2QRGlJBܘ&L I\Ah$gU` p`V^R0'Dr z #l-+nD^Z ZQD'!hmS:¤eA< SF0m)('[ܖ'.vm"c'roie4O}T/>K@ r{G<@f&+ŕxJg[صźctQ9HQVs't1wSk۽=+hB ]o1~Πd ׷_+o&~c#)ϑ XuT%SncP4C8׼>RmyB[8Lh}ʘO`<#ӠlqqOK69JHS8T旰xң̂kF vkd@|5:2Mh0O*][_1'uHuhWe<1M6^t]R1lR H@Vgwx±ub3k~w YSq^@H1-:w =8Ba iS-M&th1*N{XaP?k ,2W9[Clk!cc54\ُK;U|d55E]^j>Ӑ}14k_L@Wp:]X DsR%wcӫ/!,{v 9S2C?I:&BVvTibv>h^^9 ΢5T81I.t=vYc<]4mxslGaمMީ \=V?S>vu6?_E~kç:oOPI~}s:f8%!CXI}~o*4 sRStI&Sf;c[F .{0X>I}-w{.nq*[:/mV،qtiXf-E2uYV^!uU6_ɝN ,[\/xzy㜊ZHtv~@edm1tؖ"'@ߣ,km 6h!=='1Ɠ0 ;ںx-%cAk#dY4nF  m5?qeu[cL{P/a ^}Np0 }̪$ ~ԭ*u%Gu,8>w63U}Cw5iT<GxVݏpgClstײ-,uXh2=3(yu紝DBɳפd-o#eڈvk;:$VMz5z$jIQR8Y/ӧv_]{Is?ujpn@&][:KH'N{Ap?sߢ`Q`J׺ OuGk75͆XE wDC˜?IP !gʫ/c΍z~R~EM I$Diy>_R{DGܠuD{%V:z{LSP2,mHw6[nǃAz5kȻeYME}Ap 4[ng~d8F{9ӭ_sF늦.`mC>c13s5ْ6msIYO:(xntKR_C$cO+Ūְd-0Casq.H@:u0;]T9gTfvӄGu%$mɯKkέo1?,2Y"uw~ 46]>(ͨ`nH>}9ݒ]62Yrߣ ٌ-y28ߦ`z."vosM,a@;{Z #Doimno3(Y`{IhLݷ#<%ge#X}'TӮ5h@8||gk-5Np~ 5ǖDo$lwPi.wE&w6h]g%gZR7Ǐ"cTk&c1Ckr˜F2H`Nߜk;&$s[] -=.GP%O /u[X$hvQx: km'gܢp 8jxV_؉3:4:$kX.i>jŮF#?5ed6m)u%;D"[S^?Hh!e $3[{ uCMVSak2L:Z/s]\΀^6n,-/ZT^ {P-s52ᢰCIqC 74cWXmKk|<}>pl U4iOULj3Ikv[zݥ.biVEt>vmi!9ʅlyu:8+ 'o)y6pC}SnX`O&csN+19 I-C1{:Uqkt&$aNPaCQh;]UZ Tx3Q53ao5\Pu`xI.vztDޛcm<i! gZE.Y0DDKb~*-mPc)t-qIc7D<"חM "e#G~#"<!{j8<οт93PXcjpBxH` --PM3AcGdz I3ᬐ簻ݠkLm{^urs$!k=I{*}B5. Lm*iqpvf V=Niݸǂ#]@5RVw|-iO;l 8m[,]c*u6۷ (Gf,Pu(ൠKdV =AI a[mǩۜb)IF1$N(VCjsA)om`rc;ТƩT}H$wciemsɇ^jy8̨ULENyVIX]g#pAʈjG}"׬i켚oY5Kzhw }%@tbx)g{cC|'/sr^q?TIi]1 J_U!1\ʐ!sX{)g߂:?hgoQaCx,%GJAvKT @F`]k5JOT@)yU=TyE:Y~ ^ યT8B+hAkB:DoQrSѫ'tSViw%Ȣ?4}:8>@K %\({INJjX%gEFZX1G_[uDI%6{v !a)VljI$E| JTI) 83mwtBI$ >PP$HFE͗yG(oq"JI${Kt=ӵjI$ Q&søL >I$Jra#&A%Ei( >JA"E-1kAi'Ya;u;Ze&JqSK$%b4א U65@I$CKnT0 U$*杇g(BUH(kSAnQs.Ѩ*u@ĦԒI(NifO2)88rR6IE5:wh9Һ _)Y I$2Uvʘ0% 4$$E 3@I׹<p6()d$IZq.OLc-+A $2q%N${I$fG|Tmn֓\k7qd)$(9%hghԥtI ^|SYN-k}I-I&Nax\{.vMZcDMҒI1*¹M{FVQfJ"Q]1) X %A %5D:Zt$TnӹIJҺI$fQ@BRI$hxRl7HRCI)!I$:UJ->* ݔ$E@Q^%E՗j9N% I$MʋqRyPst@*I$'@fXIIJI$A+,sgWrL򕑢I)4nI֡N)$RshN 9JJWTI)Ot(4AI"zB| iI$#5Pj_f"N$J ^$JILTIR'M9QD- ӢI$=Y=Y֒T5GbtO %NBD )RI$KLQ߂]QqԋTw&.Jʩz`)l Q h)II[#'@žЇm &-V@HD 'Ԩ͐R0A:z0`$ ެ'TUpjv8H2ₛ@p O7hUi<(<0[:N֓<TU)!EP8LPBr;'|}iQU1{tfJ(hFwLk(^)zxJKShc0r=ӆ>L^RUv k@;&$ªiSmߞv2Ex0 ֫ T)pPh}8#b vG)޲oYj}hAOmF SJca6ҟiCEXEfBvQ#h%8Y%aV jap:!bEq$!0`~kTe%1_KhBVM :Z~R%+Wc0=SSz?rtq6 -~qH}*q y-V؝yAr>•4 "y@&JTڕSe\cDd*Em9Ԥa) &=IVn6Ƒ*'2;%<@WV-¿?aH,sƋG,VH$$K5sI/?o^u[F3_y7Jזz'j?^?99 7'aQfK0xXmwq:"jid?C7.jq+Mr3]KjPNUq8Ʈ9pBζeÕ|n-mbŬ7y T2-2KOq")iMjer vOCK#y[' +SC Z TƪmTc^$sw6;}TʱL1sH-JS3u؞TeT{+_g&\HOWtXa4+mHª\K:`m`}?V݋DIq*p-xE1yt viY_j{Lg/m}]R`j?1v0y?UrqoMa-[w1j-FC ̠V=3fYݎ{*t$#U:֓)@h*n}ˤQpki!kދ,54 ςcqLrJ(emJŷ1.sAˢΦ?tq!wPf(plzZEsjst7C_8R]r_cU _#nF2LoMN08h?X,"7Ҁ]1%vuֺ-r1Ȼsud 93.X1#dZ5w2ăߘYQ:^o'q06t=K=;!k[CpݿYnɹ\NIMk]X.ry.~%tOtGW{& Zkqe[Y3lcդ L[htW#z,65kJ-?h{͇ٞ&L(k);)OCE&amq W?ZDAw70\W7 iS'pn+:ݓnSD$SjlCvE̛s֎Og9Fat綐ӫkZ{XAJ1>F()XCqUs[v?R2_Hv, YSwoaug}'ܖGR}yNx5>{hk([hѵ}IRu~5wKy}"߫:ew+ރ֮,l{clCS;?yx5S n6q I5jaKaΙVC+y}`Dju\eL#Zdz`ƫ`2?1sba}l DݕChy/.=w5L!c۩:V~X`Oӹ r]]$OKPa2Lhxԛii(h`HI6ȭ11={AƤƨنXI;]{A*X$T=@_%f5[-#>IboUa$OaEkZƆ-MBƻ򧹤ψM2[A-➭ %!A2?KpZQ.oǛ LJ}EiSN˜6f>H`>=]Y<*Yu 6iH5*lWIq?Eg?.c9>͋BaÒ_D9C4:%S:8hs̑2skfclFfuY@H E!7uRnCb"D8q \_65KY+fv}Nk'1FHtΟVCk+6w vkjlwF)]aĈͧ|U۪(w1 [F0w`2[|ihsO`6wCjlKf)L$Ôz#f=ײk3$~IKiCC6qb#A9Wzx:T-x9NgAb ̄-TWEOzu ;6vڶ&X$f= v;G$myF|8!YȒO orcf,k7j4I6v048kح=FU,K Aޣ[CM<<'$cסLǚ=?ZD"7x(ŭCyҦl'EkFןke-:#^(3c~f;*dX j|(i>50`l_X4'ĠNLu>y)jDz] y-\{(nupS 6~R]Aqly9$oVI:*5 E#i%Ѭ*9Łc/ C|O_UѶ[jcXUqZUAo8hG>joe<>Z"@{A'@][,A(cdÂQ5uB :nUGSsv]vQ!żXoIae3a ^" X6ɇUdPvi%!h֝> ۍa&H Fm*KDp} ײe|b% 7eޡ#dQQecAw FALnLxH I V^}2Z7;υ'"kUxl6;C> mv -M X\ U& 0܋6W ӹ@ֶ >欗ed]>@5l8׷i!Ku<€sj'SGs ;̈s~\'~=d5}26{FY%T\n|Q4n2dIWLpl`D񴫏@tLvU2r^V?j`Qm%J*L&/ˇ׊.A<|]%{ߐ5Π.pt k"F5uݔ˝siٵueq&4$iߐýuR^`lΥf;}'ʻX-'UC|!]cE[-~!4ƍy84c(./<| lvI0u4Vƨfs:re.IckCk]s+K\GzvUEX{=bL@5։&n#r1x64s(hN$vu5۱7OrKdltG ~^FrXm2|Q;+"7pIOhqK-/(5EI*26:{b+-@Gu]-IQ99x=8Bt-+k;$;D1.' UX\\~TbTCfO3qYX@rv # ulf>&d x:4Cy&2zp.6T)հ׻+F]Fv:&8c{@RlIRokK'pS{jvGd7ŏ-i;F::ZDvK b'l 'acLvW\iSHB|8D8yEVld&5O*Nɤ<|̿,-of>ᰝ}-r)=S ^TCW> Q▁5jhU#=ߣWe[꣮l1zޕdn@qd>ۭy{KaprSgH}WCFKt3hkDư@ v^\hꗎ /iЛc|]7X9Eo]=ҥq/)jooEޛro]otVt)̘㕠MaF4JN$+'rAP8R{ꂒG)ze ؀/dXHH/RaMgÄ,Z>[ʩղ4:<'㉔S`^& |zlmӧp9 6tVDl㍬-IfyS54Ny .ԒI&p' JI%JSKJI$x'Rƅ;0nFI$mR (mqJI$뢛_49)RI$HO US=:ZI!"W*?C~J%JI$C 4 #d!I$NDƒO)(zI%FPsxQi$&N]`СlTPv [LKAN'I?GMejlhӺlM)*LL'I,(zj SE,zmF!d)Vq,ìR RfX~WY R6(M`Z\ALnht3YQBF)j`2[k\4QlBqC8LJad'uE6RJ}Ѹ( AO1Sz'V{xPRn6/S*"Ue[E5H ižҥ8O5FlNi4Q#|OU\[6\M[, z:8ZGBoNp$@*]*[ sZڪ`GmiB)LY S[ghLa& pTw$E.sFy L+i@N IK)Oy(jS!DNh zZ%CiLTE!xBDXpL(e1 fKJի`<'kBn(c{aJժ_PJ[@fJ#h JAL^xM,Vf1)Ў'pOf*q엦SdҲ*vSH\9RT 4?O^Sѧ(Re\%Ʉx4Vv8FsP Rխ/:y'+2BmF6)M$q“UR1{%Jj Qd|zm҅wKpJއpdvGT- z[O XTTUM7\S#bQMvW%9 zh \-cL$.`O#K(1ޗMGekl'X6BoYJphUMaG-/)R֧ 1Nqy0a"~FSi h2G:8mrTY%j& @R}E Sz' vI)6e%(d ˃c^S gPյ>cv_?aA [ff@%^vTIg-m$K?o^A\]gIk\aW}q>!ϵsxˤ>sg^䖒.&I׼ jqmAreU8OBY0?IV+x41oܘ(["cYvWԯ,k^$0&]/E7 SHJE߳7kOW[{Kd?0[H|]@WTߤc$ {)G>=v`64^`~AUaYc}Ѻ]JSH)?&솖ݡsH tFA-UO{47Rv5mAJX;sC^[guӪCg;UZ2۵Ap8Of)|zVi ֐oVoc}N"PoۃSfĤ̖KDf GHsN۶kS Bqۨc\xvhI3_]*aqp){CeҨu60Hhd,l.lm{H1ɟ* 5B: Nk/ D_THiiB=n^ݭB5,cm}v&5*@m q"e5U?0'IoHY/f5֒8i+ms Zߥ{le rc ?;Znse3^Ktli?wigZ}bT~m7 GeK>snk Y[oI%ߣ%uH \}E = 7 s[cxoo)t.kk2~޳:E~ݯ{s0A2> Z/ȣ y,N5CY^s&Dv;IcX=Cd:J}yˬov{7}ràVE9g=d 0x%_MbZd qCIe)ae828DUcf?L*׈7 W Ip=/;_Up\2Nݳz C[Xsq6?z~Y',cݟ,^MMAߘYyxwcC!EA5;V;kwH*fHnk<j I[fc[a/y:Ϻܶa?RAKN%EuY5D urX;M^.\@ 46W8 o_ouki5+Qm{5vNs5}\Y4xwﮇ>z ׫#2w oZ܌mt ?8i7k{USUh ]Unqxaw5mnhv˖ٺ7_yݵtO':[XwXZv~xwx̖czPŸD;* tpL#?dI>;:uBD]nlpCuh^:`,mF^GR-6w~l "MV3>Ҧ?O$[hds*ƸKqZ\tv 6cBcLd#5WqښYă6|@dO%?C#Vs8sp hsߤ!0 2Vø$u@(hWNLU9h Cܱj%W-J(}IbFԞ##mnqkO54dH򔎺&}PL2*c{u䧧V`OkPZŮ "Lj}Gz$ms`=:G{4 FֵOa'Em6Wip}G%w2H⧳?"=f[ Gt8սW{sCDHtNe2p4G,,yؘPl_Z8d8s i*v8t?@#Jf;"Ƙ_r깆5E tZ\HUeys2*{K3N-8vo  瀏Vݒ#KX#yNtYyc4{[H.G+78;lnidY~Cx Tm<T0 9jF(gFQNUlQkv4ЭnUN%pHFV}iA)ɬ;p tq墆H'@sd@ʁlI 41%4SZVˬs_K" Y<<"Qیl:♗. h&X* hAò(aQ{,@# ;ktbΞFsݲCfVskLl-l:pXK\`WF> 6) F&{Z aHv=1/h}`AM#:,%?96csޫG%TԿc1†5WX+Ե:>UxW5,)&HPu$o-պ%+ܼ+llA@4? \!QS3 %8WCGQv\ Ru?F tw벸\3VF`e9#,i -cTa􊃺%9N a^#ǃjuAٯyjFxG܏epσn&coQ9 ls`F}"[䙝dYݻ% qhv5vNIBbϥg/t(7{?2u0'1k=E䖣 r.l|e9sxB w4^*yju.m9+cCv2w~6'p%v];`q!{aPv]lߴnmq>h{ FUKsH y.{8 @R8XO&ahmg,0G#[~ uO\8!z p}[ U"т.vuaPP1%I&Pa|0>B\`vZIM9 4`}uVe$֙:[4c^׳aS6O{Z^ Bm]{8MO:'NN9H:&8V~K5.-@$l7Gxۘӣt~h10I ?fnvN#5zK+LƐ}:ݶCA:"X T:v%8ke+,pa<* i%zEGdx7 >޴XQh,q Ÿg@?8!\~J$:*'|U2PnVͲmnh=!ݐo09oT7 CaS̫9X'V凱y:^w4_uUZOr$Ym;17 h.A^uX`ѡvVr0ֵp=#dƍGtǒMv8~<` U3^Kλۯ楓mM{ Q[{Z䢵Iq|oD-C7Ak qԔl)p2"<1JWc|AC<7s^vi'+,>$h F9itAsJ(9rk 88gRˬa&\`Lj+wIƾǥX  xmSxdhyɐ T-̏ 2Od&7qƩ+ lfD!|7M5R`#bzm&{F&+^w@n}٬;M֘_H3*Ntݱf{*i{-uv%YG؍eN^yh3) fwIk_}SgdRhW2 ~r$4I.$]@ZH/Iij@*I`8kSˋCLvK=h`A;))kϸBy>|B{xusĒ[d^(l( s6Ox@~HÌnu!6;s+AE4ʆDRoef{Z࿝~*MD J}0n:1:Ν%8J/@Ί65T\t p_}vqeSe{g݁DeO$nEgKj)iaVh$qO*}*ܑf+gaV{&U&\8qQhUrߚBc!]8LQ8-Fʩ釁K}\*Nx@^i6xxcphYY埚7}]AOX8)zw VmܟuZ!c?5A'-VuSVɬpN.a j=z5˟8YM&YˣBwq#a\!0{OpBq<(F'\׫!{|WK$mw`օ( pKиp7Z9Fk+wf`P DI4{Of@솟t{L2lOc4xܾ*tF26-J%:tK%†`QAn ]`nIC)njԙ:HAqh.ڪ$YjV 7T#*L1P. O)d8jzjR& *Э`j|#ĦVN;l•nkJk5xhZ)@(16EH]DpַrҠV.(sׅX‹L*Y  JrR%:P-hO oLLiIV% &bS' *A g &/ ŠJF J JHLAP^쑬BH q‰L ˜IW44Xu\L]e~EB\F+HS&ꝵ5R 뗈Q} Xg!fY`T[IK26qx ~CCd[CKaYYLk7cCbFSxr+ .$WW +- UۈFU5E%/P?Qn?G{P:{a &t6M☼ЇW+sh0sц+_NtLbҙΪ;H8]Sw]uhJޱeӴ+'8g`3B慸<%{_ӷv,YOvഅ,璜V+5|+b]O@WVՕk DHےsr>tU-o[ :elt8Lj^^I*KDI?o^םnN:c?o^*n~l0bu>A,azC`4 6} qrcdF Cw7qr[U6!Qu = ]em9qaw*ެg@??*=:~]v}})?w&~U4Vl$?xu쩘րC|?uH!j=byNXiuo.g][sq1FU6>ߣoo8uF͵D-ѧ'ջP6HMeW m-A9NƱ<CNC9 h'4:jcwje+bs]uvsq#CV9Go7 9l^SMaȀnAI6pʥu;ZτD+XMA>kDa8N x]Mmn:Msjܐ"Z߃W+. +3d<$Z>kFM"a`.kU8թge b}K[a9%1G Q;^v}c'tSIMfS^LsA͋M\ 2kn&p?VvLڏ;rzE;?tk&eQť?mfiK}6Cm^AQ4 /ɎU:ƥ1u}f[4C 8]Rn [/oѓ5cՏ[ِfeccrsR% vrBvSds45R䡶c}Zt4Z*K {otWSfW`첺=q=#7*NI?]6 zN7['p+VH XgR}^)/ph [ӻ=e۝E,c}K&Dhe亭V 4x P4㖛Ğ[ v[Y ܸmݳvdZke]hEm$/sG7N89}.ճhZ; HWkxkC[sw+tcho{keEKpX,I\IX]W?;=>p5}?`}Üw:?;+ n07m?ihߚ@k sKlK5Iy>w^S=ߣG[s4n'}I- aZus.J:f6 lnok\_n-ɸ7M5oAN+[cݶMXdC C߻kX}k_SH4?̺bggneV= X3-SgTkw\LߠpNF@ mt=/ןqcUFּ7"Q?CKZ̛/g 15d$7xuۜsSE`4??Y}Ke8k Nf7uiZǶF*6]W&3T+SL~Pa{CF|fc(ޓ2cntGRYؙ; ;x1lԫeO=V}ލ~5X鯰缇M}?(d?ڡGNs$x2ʜhJ%u7àWI_O`.Ν?5ZY"Y g/PὍ2㧿ܩu')!w\ǭH:jGTbft`u{[M:Z*e@IszSdže͗H `?C􊏨=q{"7o޺s=<ڍ'-xVEil@?^_cyUvؐa[}LvɃ\Q(69k@?ɝFTve-uceSgMK#dbn)`HsmVUos_ϵ}-AmLv;d}7+}"}"5JKaZtVbIc1S m=\KqnaRWdn>itއ~+Mhv25YV}OIٻo 4' pP yS%3@ˋ@_Fal8oַ=_eCƱѽ)X==!$8̀؆rw]۷?9wm,n/$@۸[T5 }Nn"T訲C\I|m _`Pgnx}ź?7"lk1c8:cz s`.=iݺ \[ ݧ<gsGPfS.skK\}^},O׎="^$D"lO&vѽl:3PKs`]>atIޥ5KAnu]mulkj-Nwes$W$'J2 \]1H6IXkd2SŖ:8HGm K 5zf?1ENqY{lAh;[]phd471@!ǻGԑfËtBL!.NQ},6.CZI$5?¢cd>Vփgpr,{s"I?氻A1áHVcPkGG@iWe1ikw" R=Q?IOXZH,$"kWzӵ{%Yi?Wn#TՍQc?6}Kf]M1#!ľ"9!R,6Szf?/2o`>(&c(}qoQsͿ2ì|Wi;q{7o"c2|sō9p]?%;64ߝ<"SD 2msCಧA`\DsE??-F.ޫ_8b}T̶yV64ni>}i.U{ZF|ݸU-.n9MEg:R5usZ,/` [Ո k~{¯uOݴ ScL.P&U4 Cu> ?DMᮭH" #8Wh/Bё-=Pn-%ykIh[w)]^h05'4؀ v#XXAtisH~_ud=Vϥ[sO!i$?\kp`=vOęD_33 PCĈ=LzgYx8OV~^C*`;OUzX68 2?rrSUosZ "Kt%̏s BcW_wT 4aKrX!Dȫ 8A?+f4:ÝOj^-X kZƴk+#3ۼm.wn˫'=v%5z@;ܚJp+c-;..69:ڭY,tLSKqq$Y5`a`k(mtO }(dqT֐+r[얱ɤ8.jF#9 miZ\Oїu_P%;W kĎ"ODXSL8fvtOfPhbT vcCv F,h5:蝍_ 5EyDnk*HJ\ǴOt솝nxKWhohBTvGZl5 Sc #_SWqQ¯Ac`~ W"Bpo-f^V;KOaw 3Q4uk>Ǽ%+N(d2i>"5HOUu{C\UmZu&ajr\0?HxUW{Á 49NZڀ4O|DuN rOlw﫶Z u^c!hP~dvNmcj9B18HK'AyD'R#.}KW NH=3UJc8s&G>/7y( a sP:~ccm1@ Gu(#V ~JU8S;vJQoOgPC>Cݠ!$q*۝\W3~fV,1; /57?]1=>h{N1a '7]֭Xc}Bᬟ_^S2^Y*?[=z61cWD e_z+y^k!XiS$~|V'wK;I6yK+]ѩǐga1bG o.ʰ;qaXB;zDTT ;G%{B:9!q_܅\<]SmJ2 |TAT^1Rc<}+2Jm QV|SUmX]f^ܬĸ:H%βyPx7|#*xu]?qW\D vgT`Z-Rwp RI&<(i)#mRENjQtU)j$PZ?4D~(-dm~v'EN`!6Pe :> J&+y*78I 2c$w$H8 qymI'#(AU͛#g+69ӌjI2u;9獭BE)$A24G +)F7!*)$^7j~jd71(׺I']*eF n>-%;m:I$y"ۢF I6RI$棶SG4@#^ȝRI$;U EtW<)RI$s#>t6[= k$H0|EHw."TIEH("=n!: $P}dh4Pku)PRI$5d%]!J!h@ʔI*)NDI#:0KV={NH + ~T䢇 tdbvTV]o 5Iy!nq:6zbC!HitE=v iw*^$/)+٤Q'PB`ZK*ЈA-strO:x)[^xo2EkTm !Cm~:,>uUpI Df }E6U0>;#خFp3I4mCv,Ѫ+^T59)X(WI0x)^Nb~*dV'U'Ip~BZ=] tI:JU8W꨹XJhO@ !@U J :5?p= <@!:X-Dyiqi$'GFʬY><,N1hZS)\yS4AN]$):xJZ`w[y]b-ִ“*Ґtfd HljODQ=jI2i@Jʛ5χy$EhY&H'A&AE5G %!6 M0)ʋXN"Z&JûTvӢ7PMDU(IKp*"3^QݺHTI*շ\ z̎I`ЉQ+[Gx:*WE\,mUwJDiCӧt֙Z8Ob-:HXFs|X*0*,1sPS#y bO]H&6<#‡ NR5`8%͉B$e?ٚyS$tOB˜6R-J,1acM{)I N K%{u-!(L/4MH=9)"D 5L'-ӢyI0y,>)|!<ET%N\FT?iZ` IZg.Ftʿ]*{gF% UWG!ILvWeVxUXIL8olQ]\ۘ}U'Jص Se>uOD#1`\BP۴UE}ʔr% mH`JYVYBseʠJw(MiʱU,\92VhiUP0ǁ)WTv[Yf@:*;T+MN~zfhct2Ph SZ+D%` :q8ɕ]*48Ñҳ5t.`QTS)J?Fcp-B7(!L@JHc t"%E*'&HCsGR;O=z0RU=A:w 2*B5/Hxp6K jc *=CB6B.JQ=6w)ⰗW7iOu@e~uQq SJ4 +*gJ۔NG-2S)P6} Ky<5{6 @IK׎?|:U˲W;ݨйK0?Qexsv%@Y_rC:=?49LV .<y=ѣZae`I#@~~;8+t4hFoO?HSa쐴*up˻ޣA txC\w[˳+%W}0XV8skesO~sX2F@ctk8v:kV}NiCnW4 xk;,݇hC݇]dc4v`f~W^汳l^}!/#mS Bku{w&#Vr kW)w>;Z?SfH2mmdW:.3:~/x{7S}'BM... WEx`Oaar:M 0@ݽ gPr63Dzkd׃Ymčl{ٿ||z4bӐ7UTsMtIݹh:?[n+fv[N:}.cۈsKZڧBzrMOIUKY; ^qߝUK8ɷ(y#i}Umg\]H%ղШAqtVO~oh(^]0Q6XK7Ysk[ mNߤp,sEkC5`9L֋.vڃfkZe{1cZXLkѫ_SY #5}e3НiG?j7O&ͯG5O;>̯JU@S8eZ孝[=58,r;S{G/}4$_B7 ߓ\]fpch_dt}j+{c{A?~[{A%D6W̯=֑S\!n36E ǴBScWuA WEA7ƀS®i {Dy9H&H8F?0GR xkK7~}'t?yٳvI?=n:[2AqXCꙗ7=4 fH~çq53&Y_705pxZnY]R+am`fݱN@21܊rmo-mYiS}0?7 X< T˦.tkGުy =TL|*띢\:T|_**xe9žL8fO";'"R?Ej~.9,BySAQkNgZ]1x*k{x-{x'@^Dc,m%}i̟ܱ=ő_@s\` xF͍<<+t<Be9Ƹ8z+a~=ŏ0L*y,x&8o5a;%0r-c0{W- V"[DitIUS^ ?HÜIc i#wSj-CAUw#tx a)8OU@G#UGPh<K*&Uc6Al/0?xQsl wpY$:Cǰoj9at4j}'(YVs챭-qׁ(n&]da$ 8[uPؐ twu3~|L_uW]X尥N.5TlɎw71`1sм09 hyxwB(X\͡3;+˗6``Z8CKǂuL$7Lx%XlN596|@5,>.` 2Ւ-kY'ݬXϧq!0ReNg< VVHF_ktx#bV[>hZ lenkKy[n%ai|txTbOjuckJQm% > >ȍyn?7Q>NafPF6;]I+/oZ*ud4LO<%;1KD+1j:; KRCWC%6GS6Z+{%ZǝI@݇d1Me  U}3 RƲPKɒHLE4Kj9YX7L<R:7͡!\ +Ɉ\ߏRV{ʶfD"kVLips -d٨IАK!YQp-XdcORDrjʥV̐ϳhl$vMVvs{ZO],幕ͺ̱SV6Q 0Ooc6S-7CE#(Iú =`I!d5\}W+3! I倫%5˫}%D 6 smP6h@"Pح:H.03F0da5ァo2?AZť6Vƴhgծގlmm'ĕbG`Ud48٩-ɰKJUֈh:w)dcktj%H֓"rSmMFga@t %C6. 7Xӄ!K-ӰzW*xvY`XF53 N 3Ӥ)u+ls⚲Kt@$jHC^8:7msDtS!iK LGU|Fe.ѕ"g2Oc <0lr:`74;}ʦFmLu<5 K?j$$!pwo E{lOyq4&%}MMD˃7Ztյ .wqL2lIwM{A#͇p<8}. H2˦jvoO6ڬYHՐ^`pB~?EscB|[S\C `%sO~A;#7GnHR`8D =Q;ޯ5mt਽uo~ֽ"YELَlAR\v L'GtN 0r;tt^afǷo۝I]I~Q-"iG#QMmw <-΍ F(u=7B?;IYGt[ͭnFH7<=hSZ֐e2Zwk68T8JE-cw?Hg+$~ޡC&u3\Z! AQkLNaD H3[c^kOs]kkohif* ѴH'LÌh܈\؝CZ#^9 umAUEO/!B"^3~F ?)iK=4f|l‹yh<Ӟ)&#NI$ S;ti D!㣧PxԀNUkt-ݺ4!0a0<[V虏4ވPͅ2LNSuv5uઙy=p!\.;bu; toL)6uGA4ZK5_Sծ%E٤Y7u#Yyk;@a5&480MX͡2X-s& tYvu!LN*VoΨ+iJ'.hKAvP%P?"t$x{znf֘ mR{@A9hFdz@7cGu q{ DžbE}Q >Gh!mW/jޡ[Q[&/AP}Ɉz_߿%fnq[#%>ɝR]CqSo $/Avͥ>N@sg䵬q*e$ʒF=^gx%QXk۴#]lVEcEOo(' :lCq +q^E,hVGՌ9WD|T\֎C9UOͤGf7}F?FBqC%d{7)plGkW|~Cw3 EҠK/i#0 fGWH~Z;>Z/r xB=AάR \.5xW) +{xWg% ==w:e$hQMcx*_[ة%m xQ14S9ϥ(9 ((M(wL,ARI%bڴJ1Ԅ /5pOuZnXۂryQ:ꙭruwmTĄ8E̓YR{KUvsD/!eʙא[Lm)w*J rrU F60UT. Gի2IU{ˌ&ۢ-5(uN%&?H*BKӏ̧j)NuC|T¥kJmI$MΎH,ʪ &)N2cYX!KRA7K'I2~P!.УZ*E49A Ra}{ӮX'I2K#n*KXIAAEM:B:ScB*&ђvX)&M*xpQ[TJC(J֑uEԐrme. RX]TDX/os Lh+tY4*3v7 (A S6Oa 6AUn U8a9x1GE6{'iwj[QcG!BbRqH{ЫS½W!:U ьjk;%*m򥾾ʜ'"R)8v(B9kJ`Q›,mQ 4K/tZZ%Vk;(4$6k%W`x1zYTU(~CNB-bKA<;Z{tUu b)Pb{Mhࡌ0&VɘE,쨔*My%qrAp_S\5 MtsOtf"=ҜVPĥ%RUI ـqʴ0Chؘԧ>$ OhyhKsB-p+s6`ލ& )PЀǂ6"h8}'%2-GZʉ6G)Î:[tQLoucc.AsXA쫊VCk '~-Ǭs\JSApC:O-m6m^=6{ {K@iэv+e!fuwq$~ܯVXn3㛽7zP nض=GWK_`ˣXZXx ^ʇV @XDyh}.ɬ8Ŧ #EW(W<8&!vK?@Mt?oF70K.[ϋG47vz-gɵωW@_Cūs*^Y:{Ic׸yogb);qUe>&^c߼ESF _T;}S#emgH~תWlvXuzv p@ ~s}MoQC8wC73QMo6\CHp'7,P HO,̊)}Iq/,Ӡw’RprumWhsd{3g~ວYc6@_lYUM>y6(@s ed7k]Kb+Uc\D}&fGG:4Wn%V_pf][S_M5Wsw?iA=NֶAݣlCIŏ ֗Sɷ"qhc1.w5=(kɨʭc2ւ4uZoŶܢKZ,kW8c?[} ٌ s?F1R4ȶ܌Bh"ecb,z:k^[zun{=]pwX]͵=u 84Ikl# }JITch"I'ˍ:1jϲӧZ,~+lZZ}c,MLLjH-ݳ99k:Ϳشr/c1@sv'I)8;V\6WE:[z[.փ4OVg: 4L;Af5W6">>[M+Sw@B׻öi?JQD>ηV>H!C6w+q,e^rdYv8iiŻn~Uɲ'#+=Tmlcjr #۴.м5Me5uę/ =鬾O}7i#赻fۍcmmEcQ53UiF7gYym47q~k2XAI$ks2Zg۸S"A45vx6V6{݋Yv[~Fe[^,8Oo@=,!.p}oYCf!Y ůcZkx>?Y}_2l. RȾw0jַGMʰYqbq DuXm63#sC^ չs <~}wlލ_@;hml9~~;R8&7Sዪݐ Lk筼v ljkn% "s-{:O?N<Vv-ͮ0A#>h;q6޷.%8ntc!߿pt}PǦ:s7YWdlOiIk!4$u}d1ah]|:+;:*/Q3whB2Kn FR֙]RF: Y/M*"VUֶ73T35Ӹb<lUtTi~nX9vSv9mD w{e {VOTtw< tDn<봔!eoinsF)&K6o;ba4TwW8H{Fޭ:n;S Wc],y\rM(4o4?VCGMpqpȋCl``mkF|wgH7p _).>PGP=liaP@!H.j#u FKKdGg_[7Z}[ t dfdVw@!H?{@{c蝹ecOL4肜bqzK0u:ø:@SvS%io}G 8M7h~GǪVf=GM<<;Gt R53UtDT5qz$0 uߜn{kNxYgeX6'S^{a!K;y[w`kPƑ5YjN ͩ5ۇrcE`fX6[ؕpٚTGs::x%9X:sj7١QN)7 0ٓM95<=nɶ\Ih.?ƐJnGM1ty{i!#qhsH d8}`X7f= lu$eR '[ 1:ŵDn=k],i?J+h!>"?譇eeq汾]%xC`C%0+<]*ݑqHX2!4[gb\OQ9Y1!YgN64K:1DG&.'IeesAs F_5z*uJqZ? ,i-{jrH _v5..f9UHfCƞ*gҪ7C%d`IɁ`c?TXFqٍ~Z g=.ZG&YpMjgҝmh! 2]iNRgQOXn~v8$GA--{Iq`:Z鍈h:}w7N~*AG"+2skA$s{Ge 8 X;tRWPcBuY|d)SC~r+kYm<# p[|GuY/- i! {I `vKJQ/FӵG"[_2Gor68|4C A#H<o) Yp9R5_Z)54߽8p,nAs3?!גKKH Ujf@&{Q5;t)$@Qd:V+4z By,T[}cߚHzd<2s=Z5CXٮr8us=3;~Y!nGuܳuo<}U`sʛNQԧ4d["dل9l/"jUvR5 Q}8T% f]Uۚ֐'\][4eg+33+i#<9`I(` t.~whs !i\4.Uߑa{X:^Lu X@Q,L፼/H~dUw\[ A8Vfɮ=oҀ# WXLVl-*f}=yp:s]:Yk;NJVs2nӇc&ϥSkʰVǶgU6e3U"L@٩Խg4hTVWܜ{6OwLhZH+*F{v $W۴R0UKM(]{pZ* IA@+[>%dIs .hS}zk'i}z85@1"djoN9 NJa#)}BpT@=ӋI:Gܢ}-rhMjɶ

h̻ p}aC4T4!=7|9v*.e8UlȳЩ7)#3FP[Gޑ][y踅umƵܱW\{y3V&?n''~a,]}~Tt;x Gr[ Os8}&ڛ<5+f<J٧WEDmY,%4ݎCv%gBb_;H=5 '=6ح$)?gOAS〚 Aѷ<<;,~ג)A®X`iV{ !Ǖ8aTdH4zz(;^$(\Q'Qh'LRP{6Kj;QhI02z+:%Tʩ;1EZM'Sv/׺%u`&{@@.I"7\I;Pi~*RI$3-yQh)0ݕRI$< qNZ\Jv 7*RI$CFe|N8PBI%Dm&,3 MSu)RI$ v$_BI$ D &2N*I$*.t\!8S(RI$c7[*:5$vU$Iˤyl*@JU)$Vkpw@ENx:2Y6$jnsuTQO+BE%ǹ+r]ME.O94Z1^AH0)U2d5EʵI+B4DIik `*7w C=4Z 4i+}dtVi^B r5"9)FeR(O/B:e` j&**t@Rnʜ'Z5!m`Ьv]3- F#ˌAVS@Zԡ )&%Qu %1BQ EןcfQÕ s{( pkGOFIBD&Y+)ꝙNB6!a&MdT`7D}Е̗̂tf; ]޼ T' Ev4)ݚԗrOzJZMM+^J0kAXUJ5űAz> seWMoV [V+q !1⋖܋:pQХmAS5UT@ T~wfZl,uFAEoP=-[}$ ;FRPTkg$ gV-)`VSƉu6[۔tRXf hlhS@@%|!OH֘RBmQO2jm"ږR)&dZڞR)O*!.$S<' jBZҩ}0*;HJLjPj}1>)SmoZE---)=(m M5jkvt5* ‘i uU0ٵ3B! )KrEH})KgpTlN Ke&֛3J.nz=w8V)Ss $ 4 oN Zd{fM$"2*^%5)m7e1kXBrRB¬65HT ۈ%W٢vEc8` >rp2IV Gq)Ԭ9ΩxT'Eb:'0Ju=P)fjVIs=L$UeHHoy#6%AMԕI:Nu&!#^%-y앣`Jff ¤Z`p,}DzHHWx YWn7,Jge˧ւ]XO6e#K2\g62RaPI 4IVHgǵܩƈ*R)0)&J+ZФ>JRRN"Fmb|y)IHTI2%NC[){*BJڥJ RѪ!B-~ ؠ]K ڲ3Mg2+kWfSrlh"%pգZQc]5uW]}X .$\vM^Ƴ Ƀeүy/0u:K@ܗ7^wNGmWF+]$}L{En ZO/oUs3n{*mFmQDc{\0;UΕc( Al?zPق=n[e uCc ེ9'T [c*Xipiز0ʚY@!pdOw ߙ_\ I5#tܗeDTsߡ[m!Ǚv;oi~϶\ o-?3{p^.m x:8h?zEnZ @ET'k!O ZYK\eJv7zSUv3\[hscV~ 1}@,F8e;y{H`C/Txզ #DxWby8&fNcai.wk=+R^s͹VZ=ߛziז1n{pxGmsǴ?F Z3 IL?9c<[mkcL8l`@i:PߚmOF}K`tpjya5}#p#mzܺ\VYKiu~zp0/5k7c $ ;dG#Y}?vJ׀5<U<<[ '14Iq=I [#tAaumA"5kawc-zɮ45octwX,kk_.l3mWg m ^ODw C.ΚeS'}n9f繲#ߤeqU4QvƵr紹WmEś'-hQz k[L}-Ї]{+cnڏ_kY-Ӯ>u7zVƍA}Zo2Sia&48:^\w?';P8Q~Pc[h@MfJ'`P۱[kkٽe۔*6Z4@h#s e`m[`mi=USͶZs c[ *bۮ>FiroP.6wGh@zo 5$jYykS;zJGcSڋkxV8'mrL{snu)pgUUV5ϗbKqo,iXV= ,kAha~gnFMؘf3k]qo?cIq'ˀoe\ Oz}eG]Nh$5wTc)X8Dyٯ~k76q}WF_rY:qv UّHkIsD>D yژKߥG*,y͎tUV׺ }G;ڳzn?R& #:j~ױ=wk]ɂ7[gѫKAuϫ!³C!ctGU:^NG?}_s}h[9[Y;KVBk kd4~']fڟ~gDuwsجt쌃k=aoZnM4oU~A<\nE%?ڴSCD+]jpuwɮuMp>bM{zcD}*F,Lvӆ ^XaY/ 䖎%o!iЄ\3q;`́ʫgRe C@"%Twdn s(UI fۑӠn=1V/6\YXa䆶?2޴/ȰՎTZgo?AVqw4n+r+/q26u+ ~<Kr}v16 \Zr_I~F^\& }5vْىq5귳>͞gt ĵC$=[ ].@<_3nӴ+XxܩduG[yrg֒'yWKN˵}8u[n廨ٵ u64}OZkߔͮv?I mzA>CU֙e.d ?Mʻ%ľ-:M\lq`i?rjcsdkLM|ݫ i{9AiueT`IFDm}‹kv7TN5MZN21Iћ0Mhc{T3k.<;Dƅ-i!f- As[MUf eם[֯I½ـŅg'o9u8̇8όJ/M-MVV]iP S6ROrB]7#%UbzLȹčLlGͮ$ vƭi:7V @GwICەXkkeYfYFwm%d hG不Ej[@xfߢ76xu-ϦnV]ohh3\g4F e>3PG#}Z.{7q vj^j찫-s # jzy<5SYF69H|tw=i{5tx<<4{ XIlj:wAOx)qtDέl5"; .-&6 V^gXua0OOηc2 5wEFtF~jWy;k]ms <8{l hq);b͠7UmX{tob Ȕts~F6(awi?TŏAVkvx{M;, *Fݺȟw?qhcD$u _U= e8L};KߤTҷQ}cM^uf/Yk%d=B5]k'O<ӌ]`3-p2] :`?I3j2+'kw7CzR6OIƮkgEֽ-te=pZ@$=x.2 7B2ix7k۸(1ę$ ƫ  Vբ[^l;G?QEȻW :?1X' M0 l>-#RݷG쭭1Ģe" pcEK~cy^'p ȹ0xT88)i|ԆhuN*"4#][\ ڽ#ִ9:iWWuvsX. ~qKHRG!&${G!#-Mn99{]\]h~3W)=G9#u=X5>jB !HQW\O$!'DnhۚCcmp v;x~r$K6FQNߦ8 ^|D}"JC\" GvHO61 ?y2 BpN“YF;xP.)s750A=J O3 O sʣkBS:θ$Ywջp] IaiV1 rJ U-/#W@ p7AߺESƊa7]s{G+ԴHͱQVjc*xtrb'X̧B֑;2ZO m׎?i`2|<J;i  XIn5L.a h"Z< Oxإ{Wr &J}e+^䏒xw MĄwvro'43}B?VԀ ke~ z-]yc>]8x?A{)<ԏuɯْM&KzͿ.e/Kꚽ⦎!w-kί[\>eu<$HWP|St̛KZ߉W~As e?5ұmh+5;Ir <_[Gȧ60*gK^8Z!4toy,NJ'Z92Цk ;Ah "a?9m;ݡi!Ѳ[ 2`^jS={3w=T4ٸn7f$80?^Λc?N)2ZA*w;o yP7Ƃa%9 t;v0ݻ]}@DD~(feܭgəReĀ`WD\djm T,&v]q?rsݦ[nsaro< !dS~rjB P8t|w80fuuƁ 1}B\G)u)>jyCNJ]&v蛎{DGd-@yQ90#a S!+tڃoo*'@ F`n>G'B4n5 #@lZv)zPU6Fy+T;r[qo` ]`11Dv!VX!^( -TKLGyRv؀<=SUGXf= OH3S$9r,lp5Owo0=1*AA7vrr%:< 0CrrmIMCoOA]ub\Ϗdf}`܃>ܪLq/J:]ЭW@"IUƶ!Ħ)f7EK{ѝխGq!cp-3,j^ ]Gdĝq>}]E?4}pPj`岈:}&Dv3KϸkT]lOnh8B2 r%Mfi}4z@zFSxlfk MڸADnu.9P=9TOOtO,/eMJhy QT錪O!ugYw<(~ͱ޹ҝ rNv Eܖƶ;øq?zaVKO.X we9poztPv}ЫWp4&X~SO%M-:篽p< ,ռ.6!;#7 h(7ȣ< BZNIU쮊ArYU\?~Du:J :Zid<7R':@;`TxZ{" o7)r #ऐP.$ y~ro8:hnèYKCc_@ѵAB)l$d< ItSeNߡ✵it 1xn^U:[ E ؆qÞ>f=Yhk^ gk&P,@RH S:Hrd  dZaeqNfu“,XƍuB}T/1$(tJP!NMmEx(a?~ b”1Q*maG@PΊAC .S4I:"~CxNmHlRI$scƉJI$\H[bS<9֤7JI$G֘\JI$ JY[wV'܄EꢤIA%Mׄ='I$F*+$™}:I$nNp&;(@ӄ)*I$@Dljו7HũI$0aQKDu)$Q5Q/'&ܕ!#t$II'7zѪ@I$!z)04$J`QqԃEJI$ ӵeIRI$Nj@ ԢuRI$G&tNJBIK7($JE3gJRI$&4SwU^tH*RI$JZe8iG<'$JJ&K!ZI$ >*.HYBI$&XZcVBh)$R.T:HɷjRI$pv*$I!E"9)몔I)VͼS=#P'SL>OX;q 腒Hܝ+՗ؤ+FP.xjkZf]{PǢ9VZSHty h sS{gS=Zp@CU5+BDky(Ш0*Ǔm0J'Ft)aQVXטvg}*h'n4s65WuӤY.QV?ER6^0SpP J[EzxPLATe-跄A!0{@ו&fR1*J R:!Ǝ'`K Ьw8JN 7Ĩb㪺랢NVMI !Vv1HcGt(.:He u3¢tQ:5uSSvXE\Eз!Dpp;JN# &TItQ/+*h~)pnj]<)m !#l:!F/q2)q2TY+>+q "S€F,jlGv+f5N1L R tAܖ Ve=S}ȇCx(;mR٬{nv*4R(-=¯<®U5*ĵ-'llD( KrB*rjø?yt ?KWe>c4M.r =%OpǒO*ɍr`BCW@2R5颲r rP%1(pp-%D߲{MMg(peBROsݰJPS|UiNGs[ :$%4LFXS  \!\LṢB)>Jc$}O i4BwhlA cKzZM' ?z?8P ˆ1 p%GU7h;)HM#c!%0;D|{Q7jTO. 2Q:[jx VAs_ Z |$K=.I$?o^Τ[ckϨqz/zX{-n0gTOH}UUu;cN7W\Օ eKCI';cQqpv95tsE¼T8i;[W6۬kNcs憷w֖W} xƗ[_i3 {69ߤٿbƤ;y24=#ouuf =߹k|ZlKXW>z]os.h+c.U^XK:8b}n#seQlNE;$}؃znVާ~6++5w oME3[vYo,]cr(u4Y4ܛ GzQe`hFOq 1_Z{,F@.I1=G :ݣ&:/~1Νw}7J^5s?wlΦ籬2 n,k QԐ%RS9Ѯ!?1v $Q#_޵IOPƨ 6`WZ ?أgF9ϳEvw9YQ/il)ζã}(s\i$]~cP:s\0pVUiWHOF\"] {C{ٯjQ8Xnkt#ijwZA CxkDxT2ehm(f(?-]*+(jx;5oﮆW /i5\Լ졌ȭ=Eul2 j{[,.C asYܧ v9]FP6Ky!\>? ~ǜQhI7}նV84q/<`{ji$^]qosF[zrfIq}f)v7n8FvFE*$G[/ײϽy6`_/Ȓ]8~ekHtwd5Nkhk#뙇[IbX":?pa:N+bwح gKyi$Z\ֻh`<쿫̲uLs`gwֽ>VMy w~waU'knGu?Uzv!{ JV;\nݸ zqݴjHV,~S*۝f%tzi{k_Pjiko} q?mvև=cV=Emz5eUV0S?-, ;Z~օUT]zR~5 P|CG)~XxqU3{A?Ɠ[h{u`}rXY6ٙ]k~wo[sl.)ltm_ԭ}K0ڌ! FYsϸcʖ7$7U=k`vC6?M{C+6KG܇n!k?7kig#:k*ɰ sr: ϶"*4d˴~rӰ=W5 F 2q;iH[0>lxS11ZD:)u7qs%X÷[8$ K?6:[Gw6NCoޫiZNG(Z][?zb(wbHn#"ė3u gMbH{~fuşp$7Y_hMޘ<V#o>5H-款uMpsoI j#e@A$my Ӵ W7kcciFhcw}-/7`\wVCѡ3M @|ص[}B抃DΧ(}vQ:h}! y,]F6\px´ޤr-v>;N4~KP4XnӴsurw@w @u|d0K#PsEݧMw!"/E 5-~q:*^tlT=;;d˳tL 80ũz$ }-e1̗ͯx*{->4N͠yښ@:niKZk?EM2Ͳ@k>0;=B07?5ll9cƺcޓ%}ߺqh{KO ~7V6j`l2>^qBX"t0[7=vXUOnٺ1l@ꗆ֍#= ۞؝N Z!֒M IݴΏF+qu'EcSYYwWv5:H;\ ?D❔7u^z]xtx?1^9G[ `rJ|F6 ]< ^ fw^cf~r{q=Fv0q:G}IFαZ-s7UZKZu[l~cbv5>Kv09KNA.M2Gryfu7YS*y=ߺ|[Ci}i.ܛvT@0&5;];xՂֆj AkpWAac@{&,qu,%<nv`ļ=Ϭs{,ѐʅn@O<vմh̨ D}6 s* 8X)`) ,(fIEJ%u8|^!ݻ_Q HNP39;*,Of[B'BpyRuJ|ԥFA5W=g[TIt<*Vi Q7A,@ջUr2kˆ SoRoQe> "?L[%$+C{jv6Bwx}c2+Df l. !0UM"t*I.Ef8fs%l5SBxРĭ[:UU7\J}Z^Y{)6={ ZOS)M t6{H?*y pY)Zn=l6۴/XwL PCe=jGmMnEІZT Ԣ 8 r[° O(;q o!/TfHޤ9FyC=:\ ýV}r2HIK7Vy" OxB8*'E9bhI-1RSixpR<0WIj܀hߚS4R7SjE4~kJt'Y2SoQ#5Rmʛr,n؂pnJʛ=c:gBͤmSArǵsH' K&Fp: w AB3y/Uґ e?WZ]&YS(M3 &$"B)u%9Ӆ{c| ,=jg4 Jq|%)$uhQv8h5I Od}F:Yt!;Pk◸dhQ]\צ'cY>R:|ԟ=E'i2=rH<tC)IP +S6vdJ^[Q@H^@v< Un`~钑qZmy!YQqӅGMSnxha v-j %k)8VwxAH/;ܡ}b%K0o>`r=WuZ Vúx*#jE0;K H)$Dk6@J\P͐u)I$'Bg4¶Ƥ`TI&5.(NIXM[ 7q ^RI$nndphI%;D*$PԤ$@, ;]3 1ZI%&t V6HwRI%X4Ί}TjNU)I$yTߤ )$P`((H1\()$P"LD0X5JU)$D7nHO~$Iĥ[ KKFyI$)fԤ 6iFu&W\ (vFJ@A ~#%n$P"J4-j5HIDPpS7 : J/D}ANRڢAH8xJ> %1M [%JY)C5ΣKub҂LexST*U>O*&>ӧ(Kڦ(H3¿o'C/_ݬ(sLVA/""hZ+|K=-I?o^ZhiscWQ?*~=u纲Cy5*YXˤ>u ٷWǵV,k\pUqC-ZO1}j=\nhle3,0a4A CF]gFc}^6mcZ4k;w{nWx遶6|nwt{򃱫Ͱ쵛:}l/1uӬVN%j\wC %ĉ!Q#bҞg>vѤ,Hц#!v|km;]ײ6@hW^;È[u_QF]c%juMV~ ĨW2cK^O?彉Uf 9՗3i;[wǦOUkN]3ǧFDIY\nM"MD#/gEf1o 2wzmOzރ^nm׻tagR㺻]67Ӹr~G'"jC Z}[,зjNf8KOЃӴj-ȫ#!Egl5;Xgc^o4K^GIjˠu H{Y@ RZa~V;Y$KJ3K+S lإc1*ΐGm5YY_2GABEjl22n*?Kc, U̷XڭcZZ+;>fMsF մHiۨKu}^ñd9Mi\܏o.9/tocݳ.CE4ѺU6 :ꜷkK"+0EMk3lo\PԱSvhs-uZcdP1Z7nlkݱ'& xipK?Kgzn&'{m7X*Yk\=\4KQ6t&Sd<#e€w31*6^7l>L\1c*g?bUs1*cpumiG&l'Sݴ8%n'SKCDZICLܣ]Ïhy1yۙ[5<"6oN{]{lюp|5.-#g\̺Y]iumwK[%ۓs6Vx?[#[HicHvߢ;Y})޳=ѬO?jWTP;B Kd{nC \H 62uufoOھ`c mS?Cz_gg>̌HˉGίEO,L߰{-s5gq7Z4֗鼏wU~A9B7qQD^#Qo}KnOګK\ε^饡k۹h6t 0+`{}'W7 tpo}7K>\^}ۉh8ͻqa>{V쨴yN$F;sϿ{w{*KuΊ9hw3Ħ=5}=H͢d_܆~L{빂@-qiogo~A֓m~,_Y 59bԬE$/-g^?5\U ^A{H@7U^= qU/Qk3"@?yͨƇFpMU8]oOn5*=MV?qkƻn ;@\gٗג"ap?2Mh'E`0Z?Wf]/独s2ǩ{\ַs_}Ν-]|]? vߑ쵟;Um_k^;]UtS: G5Y9/akVuLk ;|@w`MjσpƲ k \nKn>vߢkɤ_P9.qng# ,ב*@+"^"$R]nctn䬦Plf l?֭n}^ߢ8_)pjvvY9*Ρc2}*i07n>1$l͝mS,`UlV5 ,q! hւrn_4CA1??vld}Xÿ.=?[c>ɩk`nߤI{uϥ@ꎲ&ML Iw-\vcafwi*c{Z]O2ֵ`h]vYb|߷d6 hW#?#+2qvM_Ws% 4ϸi:NAkn OYkqs䗼ݯ< >}WNʙ4L:eftsߴVGLkg(;wџgJ%˱:C_k7 dnOG}t2ppnn>_GIߴ3]^}^ecZvVv8kk}F!ozO` rwh?JO?qTd5? דt88ִp)idsBj7,{ԟf@8%[, h*c,àd9S?kLuj1yc7RX%7Z>5 l<~o\UImcݯHl?V2i7ZsGgu׶Y~FMdd 6$mVm,q2X)׎iEΏ6}/VMcU{/eicևDl/WM.p_oSא\K #;{9i/5{E {}.cdb㹹okH3h{Ok]_O'sܭ Z/ E4;&5w?WUðƛG# ۩=.3]lQXdׁ>oݏawuk\$3_{^̖ӹjr.i,/P@kA'E-vCņD>ګd\]7&uk֓GJ:Φ -?K\7C^G&!U(͡`qU܎^Wlŏny~x5M` kK3 ]~]!IVg3jvmKZ W?o[Ӈ^V~Kjmx9/%q 3"Wbc9YEY.BkpdJ칲 ǤZDYT{Eyz5UmW[b[Z8fW'Үw\\ì7qu/1 H# %^3qj/{^6a5x?D*C1 >9ĸ" nel}4BY f;hv0?=Gc|_[-RG,ߺ?̭#ߐ)EkO2zrR#BNF[+#]u* Y]-_s-pA`U!]c:;P={UsKDo? .ðj31vk$zuQ[`}EQv;[cHvgh7reX7*o*pVCǓem>{}l9PӰ\-+2V5ƾml+?qО [d~(w*(.95;Q{#Hkd=|?9GvEmOsO@&x'u#vZUAv_,s-ǟ_Ysۨ}՛-SvNoow죳%Jbf4wU~[n122'~b;"}Ӯh˞[<@ DX`k9I֎ʿ*zk=qmƧUI{E8&}젣x~PCi2O^<կA8) :Bv D5n?Ld%!GxF}`X~d1\LAm][yOLwo߫geSuq[\ yu73GufdCژx@/g=[G+ͬaY3e1َs\ }c#,h<'ukrP3_`=k>GC{5%<%r_*#lF 'ۺ?PR[ZOFc,u H#}BRM?[=/&=sꚭպ}eT?3vkLީ:VF P%kKpVz 7*}4M`zn Ld肑qR2T RFv *?d#J t\kmg%4[)ïohsAn՞ @HXGyIMQ{|۞FR=4k}TǺ#nu*C>!9!sx堦oRSIZM%t΄hxO`B5J\9c/U︫ҜZJQQ鶷޳]@PuR/TyR >7[g|Gޱ UUr^VS?rO`d=ܦ>oossenM%h .gK%,UԳWBrg4ӻmP=00*;lOUa :%Z^b#X?O#dDJ=޳{R OKht&6x)'ENR<wJxq(8iQ %Hg{y? ֋/{;~1V㖉Of'Xd4AS:$,/Kxy_XHik\֪{#YsN\.EE֖.P R K=E<. Ih98yMHUgּZ]I7X2>^h1>]Eܑ΀$w {R<4!9R,%?VM8kdI.\_-i2Ю:ZAZC꾐)c`oi<4OD= !d*7 &^5p' C\$#\On-mkO @<,U< ѐ^]؈W7 x9-our[c# ++~ -8}Ȃ*9P 8*c*,yx(.nLl蔍vB!Qh’{1 {%ea㵭iԏL"5pdΉÎY%;D %ex0Ip!6$4>=9ʈxiwʑoFu )(b!O0kX-uKLRH>ʕ6?{] %̔V_c]T|a$PfG Np䪶:4'I: I*U41:#60kClM2 n1YtdH)WE):dr 5N ""P묑ܡ\%[iN(YkXc}NÔP$I{MՓˆ@M)I$ '<)IJI)ӕ}=\(!UJI$djxOv丫@RI$\P$V) jR6TIZ !k+U)$NyC'T@[ ڔI& 岖FDNRI%'oq)RI$"AA. I$8NE܁$JTk{$a"D^I$>Γ%&I$HwQsc*AdRI$rjT *II͍S:lv6NYBI$JbTCS)Q I$҉Tb}B!TA-Ι\ >E`eEAπeH\`eݡX P{#׌+ *sϭZs&ul4 ,vup2:ɗA ;l*ᱡDЙd;Ea%N}@HrwW9\xY:7 mA;[ʕ9Rɹ.I ^`-ZT1~t8Q)+[7C~D4$BhITHQ%1O A'F@)PkCua@)( I" |TKuCZ$%"$ L& &}euLRR )a$iw"OuNWlDB!A )ITQG`?3x6TRB)8QABi5 9Tnq5C)B3Ma1-J¡kr\D50-H%qg<N6 7˜c o[X[ZwhmHh-2 IjMR+WLѩ21tIƄ'(DJI{"~Ip5H)vK\-[V x'Ux3?y]vO'.p=7UQN≺S&Oj `ʋo›rJ1Z8k°lh0 zm6uOZ"I/Ωc=FH: Tw%LW9P TV̨0ӝ74?FN) ʜ0 \E $\I@(io x I $|MaRU]{_;NJNq=Ӷ3j<JU"ƈH}H-UEL8KT=} Cmp@M1 Zm{tEH<6j4ĤR"_fs bքlH]#U&DO Qh]Ert©lvTHE<(;htS7YpSk+j},d;%ht4IfI/?o]N?3l \%7+.!v<sUU'#ڛ25i8s?j:/W3@Wgh{+p&^6?~׬3[,74{MUM9Qs{{I>ع:E~Gk}P&>atH9wj?ww W=;kuN %"GdW)x-_ۃA?՚6!Ñqat6ZO7޲&uS63Ř6Ȃ9+-z:}engϯuGbK YfsV:UMB]ţ2`= 40׌7[\<} ^]h"=oNv9\6Nb}\[s\]X޾Evg;vhj7XX%lL\>/"x?RK[49wH i)SS@8wW%.y ,ԁM/ws}8?vM{C}0dVGCZ6Ew4̉s]>HR^m8p WvWkXp'nѱg} yI4 w{Z#c\M܆$"a[]s5*ַ! :B+kwIã&v=mw*꯾a^v4n5k76XuWXAq\ߤ:yfEND9EzM^ȼgYO#ꊫ!d˝Mo78tUp=TFaf+(Xt|}>Vc9<·Og?T㌛l[?1`}vdAxw{Xo\U*hUv${zљN9Đu}`6de4'?\˯j->ځi=n˭4kXoS֟5]S0??roxb57ԁu/ :4K9[cل[lHX }eķh>{e 1]̬Va6 1 4S ckG9ӻz:G!03;U,qo֦K2 >+2c;5s0\ۭ6hi6W-a7eOcU>MXVM3n h WZu[:}E{q-q(*\ YkcYk;c~šlɶ5hDgگf[A3vuJ # hթh'>-wefXke{ L+D,=csi25.`w<~qWXX3)"aA;E>[bdͶ DFot;#9~7[_df6 ;)#o 7@CZ_)z^0dx#މ: ֍KAq].Ck0.˅F0Z9\՞]yzNoعm04.+)޻Km#R}O#2m̃6>΃>6[ܻ_budz{ۈoٱ &uֺ5G=sC"{Dr1)۬ =2E9kcNĀ7lXx~CvΆ(d? .-cEbNJ:H7"I%@)r^K/V.衵mr7|%Ffz{NQڝu\7G"뽵Wjf#n<- (c!̒dTs2ێȵ湮?46Fuel]vu?.݈Y̡>Iay;b͹Ml093,6Vacu6;G ߆h&$3ڴmWQc%X]ǟUбvK̝WAPVI.\cwKdkt33*0\6={GFf o9Yl0c{=_ɫ{K4jU7VMLc[\n{?T5⃺;_}'o]c cSƲaGU)6@֕D3oUgv~.3Yiyǻڏu}3+wUgEͺXm:7JRn&3 ?G.[[nhEgiiqh clHu$?ѱP!ĽIޙݓB.ڽ30ta,. gc6UY{]EuҐu&2YLj\\V>?YƯG;qG((C{* 0>`{IBvd$NV`ȱnsXe=n-av(BD{P}n A贚sv5[VA76k?HosvC95jjq1F@k/N՛3YҜ^٨۱U.UI8%A6dF<8-j{mlnUc= |]_"Z$q&Ӷ,YDnDm]Q-=As[c4>F׉{v{I<`i|λid{U;Ʒ'aZEb(Zb0<qq+b8s*}V;hՊC.?'Fgx}|O5nE2p*_f~Isu7 [Y[[i]]F{yQ71,r, r YZf9*Mƶzv=q%i-sA+i` ;1ai}8;" )Ylwer8^ϫB1ў} U^NYhhSzҝaTTc+uo%շ9Dn"T ꟬JO5_IV`v xa"Zu&Tؑ S_N 0@0 LlUbx"P;+1J9Grq*Bz!/Irm[nIMAP B }"&܇)IMQRmR S%1t(JD{%j@)Jm)HG)FRiH<)J[R)"BP-[a-{p9O()zcDxJ))@PaKօZRSMpgE~mO=}N gL$P [i%wW|ބޘ[MBbRc^"*x,oEco)&{P=(?y}l://jnBM.^S:ՙS j踎mpHG]߈dԫ5}qGI m:BegBw~PX?nwJcx*z!Y:OwN]ukȬTKz԰j,{XQhͅC Ĵݳ>Rkce :D,ַȂh+ͬF9HqMd<=pm4 cf7FĮg!ϪWG⇹!eZ};)zd/9gQÍ1]l i ah\3Tcӄ'(r=lWϑ XuGcdOn|~9?5b!i2),(n+_]e?D=%Bt| ?0 ǸUqMbKwv?b BznHdnpux'ⲛ2>Ezec9őr\QNYïtjkÜ&Y!nM\4nXBO9U}Ja_ުB@+2?єe~Ox55!s_J\zS?à 1r#$%WCyE$;B]!?Y2:eD=PO[f[ey#^Sh7P*J?EHW4tNeԏ~jmxcw_GLB?7SZ@e>> \'b:f1C5r~H/&xu¿_ zՄmO z6OvLr$vW ;"}'|H^:1zA=2TzI+E;SgIw +v{#E@C9S˺J YzeK!|2A>(F.ptV}Zu3 IǺcT}u U})Ewk?9Z #nv^OQws{ǜG4[2|gCĦgLyݰJ_vj%MW>ћ1ɕLjqio?TY2l:Wv~v[C~RQi"7vi7bLSd/XH9o> N=fA{"X>Ȁo)zXҤJL?uV\)(?s}۾kN+|կ }XQh)_?= DH.x .Z# /Yg |ԅiŢPN) Oj pRBT3˧W4CU5oWo*Mh~L¥oN SDy+)Q6_\}y>ϭtuvGwKk `e`d> =t@[ x$>`};}cր&?ZUJW,g̺9gE?{`Π:$]W\KzeO~TA:U^kH%]slq/{@t#U3UW0 ~Ѭ<y]6_L,+Ʋj9Aت R[30~fdzv[#%kfulLl@:[}i}owkx]>uViqk S^mo0"B:?Tԭpԃ+`dd{V.F)kX'A]ݸx+Nf_{NqV}HPҫMcjC\%Xogj5D6(\48^"c "^VSo%Mϕ StG 7jJci@]$,"I')D&T ! ip|sh:)FԋA6{d+yԫG n, R-(W٬o]QeTf HF)ͫu9 UރeOh3]oU)!YLZ/HPߒ%;m[JDUa ah%-&H4#X+R68rbO+lhmXEʐP ]ԶO(g (?,7EIR-Oxa\A1`KhZN'!D( SpBV$ 2Ѫ,'PITH uxBgPG%Ci&{*vVsRT8T,ԑuƐ6?pZu]Ĕ$mF'FW#:f J5TέDW]pU%8odp:,l?D+L8bX> SBIJüq١a-J#rDo*\=ڞw;zkm#@RO)nC.*kCBtM&."H5BM@)4?RSoL֔PRLr* Dۼtr]i}Oy!浒L'5(f }+e3#)$&畟Io*:FR5R5W][J Jգ&BnncחkdP sdʫsMTy)J-s7<z[gY։%H1p AL^RJZs˵׀7uNA"ԶDseCR dGu_ivG77햓+Jӱ{,-ndO!Cn m֫7'EރS7\l{\ZncړZ9 "|3hWXuF94\'TnWJv;;מn'U+3>p#uVզpU:+bXϕrXD½Hs\Gj>ǂ{B~u6u ,il/+I$5I$?o^f}Υ8nk=^aG>S&5 OQ4&岼a..oZ3֜|6Ő׿{\Fk[gA.D[X%_H5[Jy-$dğb mhR4}?u\#Vmw*qtTĆ ;tٴ1ľ q}7\[7ìlJcomNxޡqce.mn4qWRl"Y {mk5%:9Z7؇>!h{0֙GqXN¨\>]#EEւZGUw֗4~nCU.RO5jΣo}el7m}QN@mi{?H_gggSZ4VoT&s}QeN~c=K :_<ph+c>5n3߽gvX!Zֈ>ֻ" l5)F Lx{wjZt\]{}<[eu7On+k|[FEp9[Yֶ}?wsF?Jmh?ŷkzs_jyJȩ6>nOM:norq[2띌8{oOE}2eǸ {~ [}YCZ?oo>,ȪzZX#[nw kE9%$o{QÜ1GV"6uc'x޻Mk4aĵد$ÿnuSUƲ[ 6Xc~Y_[q rȩoߴ ?9H>h]E{ì..^e](m>e hOg6(X;+5?}[*5dncG1R̺0VٻUۋiDeU:]-c.C1.;t?w 1kcfHq$z~Em֗c=Ms-+,?wGVz5t55,|SYht#ūYnuY:05fhc٦>tQ5]+%s. Ztع v˅v9Ԯ6Yo`iḗw.wS*TN%9??Ʀ.aiZDg?PHd=ǚ1myum:ݰ?u ;l{EKG>9V_M72ߴz;h.߾:t&׆3eK;]sӮai9,{}Tm߹߸)Z0Iach>od\1*qԎe']^(e0鸝da]w-#u[Ϥ}A*OAkEi糧~㖗Rgٯ}͡ ?pvFUv8Y@Hlٯ,ts ͬVhZ #8ealB)5?ηU9ԭ) =95b22NgB:@1\wQq~y5~KVļ9{szIXcn]_LׇS}OX??'Uu2=B^a~A\lYutjêCgMNf.NW> 4{\Yck;0Kh:BN2p^5U 4iNj.nqnpGmFX\4l-s=G'%hipn_cgg7S5TPsjp}};ed;_XhĠ85O'ϫuL K H @E^>uWc1z]c"|'x<ʣsp6[oUlkE!06wZ9~n[5-?9sY϶`n5@QP}p 'dD}``:enI5s}ekJKkeUJlEhW bƐAwOo/&r,hsw bm$}sm]s20mAѶ iY\ :Uue;kNa=+k&>Y8}mkt{WA*-.!cƆC ımr1slH:14fZtO\\fEդ5/lq _ﮏi&^1ˏ<ٹ]9vcxc{VF;{2lCL{"TepNW3*Y%#@kIoWeʣ m 'k]n$оa\ɲX6{vjf"X@;FZmlkc庾_KqCa%ߚVoUCwr, f~zB=Oz͙V}\~΋kŜ3kg{X]5̩ޛI-IsfaNZ&Lx+콯u@0'eY~MAs`$j۝Po`JW%Y9 kle;FK&GOׅok~w鮊\|,kkUpgaa.={~?}5tc~mW8STݖwD":x[pݝUXxnkSxQb6u=չ eYw69āPs.}%/ }5_¢B#ݵLg˞C<^-(#H AAt۠Z]pf[mt+[bcx8HԒk+ni^cogއԚUDߤ߹1ΤVնuWCu7dkDFn?cAwޭP#]qlm>k2ƍۿ#BQ8f5J#_Y5S[J@[)X#ۚ>ZuR;D}o-S[~HO:JQT$>!Vrޭ V2(>(Ɩp(,wO CI"xR89 [RST]Q.eSKuw$(Rqi~||}KNM>Q*K8}$$ےtzVZ6Ω0RG n ) LmwzrNRM)rXBtO  JRd BR;$JZ-LAJa<xI2A%->I? Jt'AKJII$!PI$ JRIAJO)$& $$ਧIK&!I)<)LXb8 )nRILKSlDay ) (q%$B~ w`Gehd $2ΚrG#Wg`Psz:Y[@SR*#/L&5jUuW'QCƿ'h5Fλxsb{B@=(+uXuS`BTD8 w 󫾩 B$|D+N qr4qgBFfz揹kO[9E@]$}[ޖr3p8\cz %Tn :,rmLm*2\EH)GR [/QL(a 8N%* pLvI82)JRLa-pƈÐ)Ovƿ6Զ 'NR3XVKS)n@>ua Ԯج !U)%Jh:!;{-#XKb-N-U7$P r"<AW=d%!}wM gMB*{>8/}(Q4W=D/QbGd=zz旨1]8j,b)g./ !j'Bp]cexXmH\M`%wMݠJo3l0B==~pEeq_V4?V[i7##Xh9C|J.wI˩1B%8<-OEX9|.p V4uV,T:M`N_ee u)3lLU3 >`{8A4 |֣*=!*IC1]JD9 lb1RWګ5U F= &} &c?8ӢAPIG'DkTA l)VI^g%ltJOe?J}ZkyHFJ$U5 ՞Q|[%zt%(t[%L EاUeZ:I1(0mtBH(tQP%" K`+D%e)AiKӞTSޖC% RHKQR!L<9B%)FA k¹^L)* nt^ۇ hT]T>B`Q )9~@5#A@db9@%T&"ԝToP`p)ȅІܖNOAY98تᲄa[8]IcNH. r[$f@i0_]C%= E6TE;%ADm/]W$ ga@G^1()MRCXbiaVD^PZƞ0")FAH(0j+5Bfc·*.?Tb *M18P}4–n21R)cn; ҤR* '*R'ۧ*{ XQdj.B)$C>Q-E܇Pa4SbOzbMa"UHIu"SRޔۦ4ʫM0^R B$᧺ h'E6M r'[Ubabo X:"'Thmi* w$EP֍jOQu+zE3F^Zd'p6$Yisnn8‹1]^aUnFMT͇7{r(?^XLSsB 0"&eeOk{"'#" +̠| 0vЅ>*&{Jsh G@W!m:Q͍<T CF-'f># sJ0;iDA7Ή ̣A<-#tN:lw:+tj4ISԅVf9M陀E^!S8Eu L'72^t*F.q ~5G &&U n?VjfuT\F։>bX&KU9HVUaaIM9)l5'^8sYlUn揄f'lq}`_~w't\cf[Ś`@2NSVA8cߵlm.a !@Գ3oA3H,FzguprfHzOVTs?%?("%I%mI?o^׮h}sk~ǵx7CߓXִ hӗ4?r7|Wߴ@h{I вGRlqkHtmЉ 6:ֺoi7&춇%1I7Q&eрpƸo/KpI1*]C_ϴǰoiz.u4n- ?,RǷg{7cSOm%*XWipdGxod݋KZ@߸O_4֝k\ށ~ ۙkA븣.Ŷ `kKA3ed!iݰl_¯|6H e}sRusK A$65m@`s+G [ !ߵBcTQRGM8I=<^aUokyٯґԯgV//V-ukYiC\KXO5~{L^gia`t絕1-lptOX,] s?m;\'F`~rz}& -e;Q#l]{C>7 aN+pNtٷޫ*[lܧnzupkcnfv952Drut2vUPªXhsq$qKCj`_ד>?W5q6pix0$2w_/cQ]gVIp.cޣCYQWvaξZ<uէѨki&g[S.PwBvZI m>tCetk{}GEᮣsv4;G4&gbcU1kZ졤ܫ5~'S+1+ @kA Vv 0M|MWќ>ј\H0}hf;ak#So;?=wL{_qo?F@[v}mq}}%æӬ Eӕ_ڛVX L=߸[ }Ojz9WU%L Aiy:[shaַxp.gzb\xnvZk_1%7,iߟ}g(s0n+50@.'Շcͮ77 C;8KOC3CLVK1}can|ڢI>}[W3^XX^﮺5ֹqV=s\^fKYL@c3?qf}fʫuuZa އ1ۨp;"9 ݨ|Qd1wɺ}h8$OPTŲRj">E /µŤK&A&HBQı7*5KJۻ".{k>aYeynl3ĵ~E5E ua\ʢJVw~x( y0r2qkɫie@0X]uY 1nv@] ͎TXW:Y^l>m{\fe?@ןn;oqL5QiVS*6_{qZS"9xѻV濯X!?lH?=CKY;w}I@71*exߣsxǺk(;X ƆUy- s 7wpv)tJa$=Ԏ]*_Y%{c{?=$uEYn^&G|:VI4{۵.kǷhI?U>6c'_y7O5W]b r~k6zIk.w%TY Z|-]sbHk ڢ-GOx-iF