eExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:09:17 08:22:36 _ &.(6'HH Adobe_CMAdobed            r" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?7='gb~7[8X5S%X:<ns)HkGe8-2|{)Hou8{?+_Q̩sZ%eQ4F.{I+*%4rut۩{0Úd{B\C (`>ǘs0ECsk?.^VFWJ̛m w$w\UN:Vkbsz+U˳;c>_R ڹ9F<7^/ۛwk37[69@oC[9 $v-ˊ"_TI $I)J.xl0GC𒑌R I+-m9Zdr,/f_kJ\m{KHv=E}Rk>G;4=qL·]gKc[@ܮ@_& -%g W#` Z#Cl~XLȐH .Ԉ:}OGb#1c&$jzTXtLmߺ6|j.#ockY;t6aq^d!o ]oAv_T1cv68k3d;W^{"׋^AfKy ]~IEƃp@i;/ȮEh@rOR_,oٶR}3W\7njIVPc,ny`";x9l)F6 [\wզ3wZw]BЛкw؛qțayn]ֲ_UydHؖ F8 nI$j$I)I$JRI$ᄈ9՛Cma,8[]\4gIt[12:-c>m`%v? =J.lws,ccTI8'[_Uso4TꈬnLo+f6Fr>3+YOx`<<ZH\<oU鳰ûc~@p͙5sg]tkㆺg])[hҺNIv> pclqqKk'5]I%)$IJI$RI$I%)$IJI$STI%)S[4C\-`qy~GVeoV=hm}[onoS:ʘNwV5][=;2&Ө#`7:b}fn//YnK女6"1"mfǍFm=vs,c.y;gbwMm .&~3uX5˓F5w2nG1q61du&V#s.Ϲ=eSߎV6ey9oW}JĻSf'2&`CͲ?:3b<ܦcSn-Inɮг/s7S#@0y;k2,˹x`8~t~s*B&D]F˃\ֲmas}.jql粻mc_c=k;wb[I}7_iZԪZtQx3a4` b Ï2!+Sy51̎]꿰.?ުEJI$STI%)q?]rv &솗׻k!SMP'lkXU{iQ_c=ޛٿ_7tLcs>٩ZqrճoŶ?Z7G_v,OO쳨`QeNhۺw+o~rΣ93hK &4dKWubz Éۛ /)N(~-A ^ؽ7eA-m[-wmWNߔ٪\O\՝C$WfF=VC,{[j6v ~Wٽ1-߹_Oqb#S3<)pC#PHŶڭuN'yC_ U(7Tr=s-ﱄO4Տ[ vmq -Fa3 7%ߗ``eCqG4g/a19H#r|~G[5ieWAs U}ptۺwmޠy5ատq%v5?mzɭњٺ:Ozs,y}_7Ysq金w0K7}'lWG֬*pX\asGjλ5Od5k;-fݺQ]VV;&^5cr$~œ湜f'T=_Yі0nS; ^vsci}EųMlp" ]/ H g|F6ۈ545}ߪ5ۯ}w'u.l철~$^{%ՑK/Z8-p&eK;Dp+qLo0HI(TI%4Qtot/"˷3"̛_kOݷF6qSa?~ưve41 d%iqp]?TŲO'cn㺬52(90Et%iy'tXWO-\]7ifwXc[ȫZz`ew? zWz,ֺ;}jtjV |زp0ǿzdX˳Scoer=kje(Qqqn {$I9#`]9T]svZX^7;_ Tk_-{O}N_O>c/"s@|?uQ$!c :6;k;[&?mzû5W׊viG˱$ a֙]L:Qm>M>1w͖[OgE {r=[R6Ͼ>luKڭ`3(OOqV>ؖ?yv6wŶmw+ A8~ۡ1?gS[fL}tyJ.S1ƴm dw]nf5v=gy3Rmg#kp"8&Zya*;`wAm]6\6mkE$?Ud-o[Vf}ZLƚĽKwWWn~zI ~gƷq3X9NZ#GldJ,f.c㍘9UHtx)R[DꗂT:#Q<.Gor+:T#L,{ Sged>ZXj0/;-n]b69ѳpFާ\8)Yz>s;m@#k]S6?R]ږ/ y03pDϫ[]ChOJ~^ӻlSFb8?T~KzrmSl2[ͯEPB*-1UV8yz9Y㍙}!:"[{E Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM] _workbase_fotoztcraft _ nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong _slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong _urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Cr' Adobe_CMAdobed            r" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?7='gb~7[8X5S%X:<ns)HkGe8-2|{)Hou8{?+_Q̩sZ%eQ4F.{I+*%4rut۩{0Úd{B\C (`>ǘs0ECsk?.^VFWJ̛m w$w\UN:Vkbsz+U˳;c>_R ڹ9F<7^/ۛwk37[69@oC[9 $v-ˊ"_TI $I)J.xl0GC𒑌R I+-m9Zdr,/f_kJ\m{KHv=E}Rk>G;4=qL·]gKc[@ܮ@_& -%g W#` Z#Cl~XLȐH .Ԉ:}OGb#1c&$jzTXtLmߺ6|j.#ockY;t6aq^d!o ]oAv_T1cv68k3d;W^{"׋^AfKy ]~IEƃp@i;/ȮEh@rOR_,oٶR}3W\7njIVPc,ny`";x9l)F6 [\wզ3wZw]BЛкw؛qțayn]ֲ_UydHؖ F8 nI$j$I)I$JRI$ᄈ9՛Cma,8[]\4gIt[12:-c>m`%v? =J.lws,ccTI8'[_Uso4TꈬnLo+f6Fr>3+YOx`<<ZH\<oU鳰ûc~@p͙5sg]tkㆺg])[hҺNIv> pclqqKk'5]I%)$IJI$RI$I%)$IJI$STI%)S[4C\-`qy~GVeoV=hm}[onoS:ʘNwV5][=;2&Ө#`7:b}fn//YnK女6"1"mfǍFm=vs,c.y;gbwMm .&~3uX5˓F5w2nG1q61du&V#s.Ϲ=eSߎV6ey9oW}JĻSf'2&`CͲ?:3b<ܦcSn-Inɮг/s7S#@0y;k2,˹x`8~t~s*B&D]F˃\ֲmas}.jql粻mc_c=k;wb[I}7_iZԪZtQx3a4` b Ï2!+Sy51̎]꿰.?ުEJI$STI%)q?]rv &솗׻k!SMP'lkXU{iQ_c=ޛٿ_7tLcs>٩ZqrճoŶ?Z7G_v,OO쳨`QeNhۺw+o~rΣ93hK &4dKWubz Éۛ /)N(~-A ^ؽ7eA-m[-wmWNߔ٪\O\՝C$WfF=VC,{[j6v ~Wٽ1-߹_Oqb#S3<)pC#PHŶڭuN'yC_ U(7Tr=s-ﱄO4Տ[ vmq -Fa3 7%ߗ``eCqG4g/a19H#r|~G[5ieWAs U}ptۺwmޠy5ատq%v5?mzɭњٺ:Ozs,y}_7Ysq金w0K7}'lWG֬*pX\asGjλ5Od5k;-fݺQ]VV;&^5cr$~œ湜f'T=_Yі0nS; ^vsci}EųMlp" ]/ H g|F6ۈ545}ߪ5ۯ}w'u.l철~$^{%ՑK/Z8-p&eK;Dp+qLo0HI(TI%4Qtot/"˷3"̛_kOݷF6qSa?~ưve41 d%iqp]?TŲO'cn㺬52(90Et%iy'tXWO-\]7ifwXc[ȫZz`ew? zWz,ֺ;}jtjV |زp0ǿzdX˳Scoer=kje(Qqqn {$I9#`]9T]svZX^7;_ Tk_-{O}N_O>c/"s@|?uQ$!c :6;k;[&?mzû5W׊viG˱$ a֙]L:Qm>M>1w͖[OgE {r=[R6Ͼ>luKڭ`3(OOqV>ؖ?yv6wŶmw+ A8~ۡ1?gS[fL}tyJ.S1ƴm dw]nf5v=gy3Rmg#kp"8&Zya*;`wAm]6\6mkE$?Ud-o[Vf}ZLƚĽKwWWn~zI ~gƷq3X9NZ#GldJ,f.c㍘9UHtx)R[DꗂT:#Q<.Gor+:T#L,{ Sged>ZXj0/;-n]b69ѳpFާ\8)Yz>s;m@#k]S6?R]ږ/ y03pDϫ[]ChOJ~^ӻlSFb8?T~KzrmSl2[ͯEPB*-1UV8yz9Y㍙}!:"[{E Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$$ꤗʩ$ꤗʩ$8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$HIJI$OwUĩJKI$k<^AW8O%RI% +5ܠى:IIVI" I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$jhw )I$30>*4BI.$J] /%RI%D蒹ebyU^$JI$RI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I"cnxonI )I$p{w:TAhѠQ.۠.I&:jR<{!;!nw%^]aJ($:SnFTU$WSlr82TI(HHJ8@ɫt$I*$KTI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$蒔I#cKGU Cc{~'O%%)$JO :;o6F_= %IXMʨ-IVI]QVI$Z`~# I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$i-0NlxI#iNHwO`Me$I2I$$I$I)I$@µUª)HRI$(9G~ A$)$T\6=#WGc@IbL$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$qsv_Ȅe%)$W@^Ȏ_w:~(vJKRI$$IjI$I$INV\oZ\I$kox?gAIRRI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$@I$I9{LI)I$I$JRI$I$I$Dg;;xI2t.I gŧ1*_ ʫI$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$l177?rKIx?*ऒI.Ktq%[HcPTI($I-RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Ee?@kGu~@RI$HI$U2I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$H)(jIzuy:tΥ2,I$m6;{I*ӝ8U4dI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I&)+G=B?I?-I$&Qa?BI).I&Q{?#t䔤IUq)II$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I-⒩I$5]}粼KZ[>OE 'JJI$'E*I$2ڶj冾s *IdRI$I$I$I$$I$I)I$I$JRI$I$I$IBJRI$IAKiIJI$I>RRI$'wIJI$RRIE%/MD蒔I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$K99vYN?^^I.1I$INJޥ(ޥ(I$*zQk[zQkI$Jom_G҉m_G҉$I)~J%~J$I$Jޥ(ޥ(I$*zQk[zQkI$Jom_G҉m_G҉$I)~J%~J$I$Jޥ(ޥ(I$*zQk[zQkI$Jom_G҉m_G҉$I)~J%~J$I$Jޥ(ޥ(I$*zQk[zQkI$Jom_G҉m_G҉$I)~J%~J$I$Jޥ(ޥ(I$*zQk[zQkI$Jom_G҉m_G҉$I)~J%~J$I$Jޥ(ޥ(I$*zQk[zQkI$Jom_G҉m_G҉$I)~J g,krT<'`64I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$5XZ$%%)$AI\<~s,$IRI^ R85qI\%I$*JWRW RI$}~ OO RI$$?W RI$Zd}$K=%Z|ޗi?zJ*I$zKCx/~¤Ig>O->I\*I$zKC/~¤Ig>O->JRI$ZeMj|?¤IPIh}/S$K=%jw*CI\*I$jKOҨpО8k~¤If?U`<2> (AI$t2-tLJJRI$iH )I$bT/s7&{RRI%5Z~O%p$Y-WS}%p$TWW}?%p$TRW_ޗI\%I$:J_bgI\%I$&x8JI%M%o-G~ +$UV?{K?U$JJ& EI$؝U$JJ؝BJIWIO }I*I$g_cITTI ${iCI I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$H$$I'kKU@n"p$UK*_fVBERI%[_z BJIW#Gޗ])BJ$J]+B BIIW+B_e>!X%PRI$|B I$ch$ I$>%o?AI$هģBP)$A0?rĢtAI$[R3|ђITI HP$AI$f7)$$I&NSJJRI$A)JBJRI$aD>[HRI$/E [[JI$&)o ojJRI$7/M ^SzIJI$%/Y)I$}-7ްIJI$%J>K )I$y%J>K )I$y%J>oY%ZI%8J=o$djI$:I$ 8uNׇ$G RI$[^A[s7Ii I$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)P_T0dkI$IMI$I%)$I$IJI$I$RI$I$XZ~~`9'7'A$I%;/:k7 Z[?Ժws{7I$S*;>̚]C,ƢAukG>7$I$\Ol]Ef_qKFk=G$I$e%Kvz6q!ĻQ֟ct\u{7I$%}Nm+2׹ c^KIk76vgӰjI$J{䗞\sw˟spI$SڤI$I)I.W&[D#e?s}F޳e]s#rI$J}9%x?XrmqcăGUk3;t'z;.%=dI$I/5m]T8kDͮo?zЫ}bsu5MI$IOt>3.Ykxky>uEu].a$I$Ip_XzWPxsXl ns3?Uc͏k@s$I)֍FY΋ -vMω$I)\[u~=l hYU_AՁ%I$SI$I$$I$I)I$I$JRI$I$y^K=$I%:)$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$Ho%)$Vhm`:]璓)II$mJ}i󵀓䕕{A)$S)$_@Ijw܊-tj2PU/V?rJI$xM_~Zx*ԒI#J=ZxɽZx*ԒI+_կܗWjI$JV%WjI$UjJJ$JΉ*޵K֯I*ԒI+:xv)$ZI%kDU}f)/Z4jI$URRU$VJB3WjI$ n RI$ n *ԒI+{!S~!RI$JZIq~jI$6 9;IVIZ #{;jI$ CUOXxa-I$(*<ǚJ$JSia播I$>5So^IVIZ5W)a₭I$-V^IVIY|R|UXxjI$-W^jI$(r旫jI$(r_4jI$C}_4S⒭I$7/r|S%ZI$YpK{ŪBIL[m HQ)ڒI*iay ܺxr"RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2{ nրBI$AB@$?W)$R_z} I*ԒI+[ψTU$V}_1Y$jI$[%y]$jI$o0IVI zIVIW$jI$o?1AI%ZI$_\I*ԒI"z/TI$ROI*ԒI)/UA$jI$#OJI*ԒI)'mE$jI$)o)IJI$)o)IJI$)o)IJI$)o)IJI$)o>)IJI$>)n>)IJI$|RI)I$RRI)I$I$JRI$I$I)1 LIi<]$J#V*@|BJ*I$I$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$*hcS&AwsQ 7IRI$돢Gʶ5 Gx1ۂHRI$w0%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$R ??UCfOƿI$I$I$RI$I$I$I%)$I$IJ^cekZx0|zr/TߘɤI$ҩVژ!9`VK\e2״8|7-3}>c-$I$?[j<5Fw7;!א9u_׉e#|?Ke,zv vI$I%=?88IfTEGl{+TDI$oEgr% wCGw\vFI[/s?jվΥq=1xYY?VsȰjӵ'I$Y.823Of+es٧q.&Pw5lw_>f6R Y$I)?Zi}VVpmzr7~z>;I$Uw\CC:}xTFoR푶n$I%=\% 0CWEs?gA6%/4PTI$V*]>,jgLKI$EsBto8bE,{\].Zw=[l[wُSX"GI$JldP̊MXAEy~Uy?Wl;gfׁC-0 S&7> ЩI$Ѧzŵ_EF?g}gsĒI$:վ]mڶvǰT_oSfLzDCgq۽LۿWtuh]jJ}̤>GlI$IOhI$I$$I$I)I$I$JRI$I$y^K=$I%:)$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$cW =T֋ִyEI$uZR\LzU~.(i,+m%I2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IV$I- :S~J ’I$݈YhB!$J)$KTI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'`殻R>*tB$I6g7w9QT?RIITI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-5 YEFU%RI$8?t I;)$UI$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Bg  nIJI$i$FZIJI$lEE"gTRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)P_T0dkI$IMI$I%)$I$IJI$I$RI$I$za!޶I$IOSM 6xkExVzYys~TAI$I%!ůH0@ FmTG\89kI$IO}gAMضԁ#nI$#@m05e-WGW> ''I$I)侧԰,v.M.2b,B>Qqs װ'?=w)$I$ϟL}C 3>-oT_`͏P} v{}ui$I$$I$I)Ks:? k?rRI$IMf. 46<8WgtӎvwI$I).װ3^s5M;H#?ݤI$KN7Tli;CGFc x5kI$S}cV_ں{ ˯a=>?i$I$uWY5mK*jEmѦ %~]I$I)ǣ]'B`קeen}^_F{][ $I$$I$I)I$I$JRI$I$I$I$,_^_Eg}bI$INI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$ ӍxWdBI%="R\T{q;BTJKI2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Zy< 8AK8Apd铦 [ ⭪ٝi(줒IVI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IN>*ڧYQ I" jJIItʢI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$1=LJRI&QI;Z\a;c_ILI$I$IN,|JRI&$TVAq0~ )tCpVUG#$llI"TQѲbK@`JJi(ʏߊ3&'b}*'*$*6_]qO8, v!FH"[IT%Q M7RIi\6,trO@ */iwH^5xE%#LxU&}_q u(XM%Id0u ,Ėh:?M9.14*$/is[ZլP:m9>x Pm!M$ 5aT2vRI$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$PdI$%.dI?|0yGH$~RTkfYp29lhOUQ8ޣxVRKd}T|ET2\8^9,$%Yc{Z$:Ky#7a-f=^>!옔hl'hφ}u^y"UC{ _񒤁۔-ˌIuup[/܆,:^{6AK*^Ayr.TpiQ1{>{~)CLNŭ=6pgPth^{3ICo3^|W:'yQv^#Gs?: PxX)-}UPp\qs?EJ"uKpX-|n6rx%3d[Ik͌-'0L{~r?rLQJKWm{, -&%>RZ/9L^Ҡ:5ǷA3)XG3]$Ғ΋`2hisH$vK.0EIt%+-$EI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$aLR2~5ԤI$I$I$I$I$$I$I)I$I$JReb=qqyin)nԃWmGsZRI$S0]cpc^XH+}(g]gikGv>{ {k@S?w!6 2d~_I$IM~~GKź]k=GYqeO0~ŵ:MyUH;KGkPBAIƂz{I$S}^]ȵk!}/{Z.ſT7a' :ciͷ48sZ cj]C7:-.-4?xI$SԱwZf5x-oEY7lŵsX}-+]C;+(fU{W@>s?& EdK.szI$JylfCjF80],~Y.ck~^vũz82ia jzEc*9imI$΍agdn/Lֶ5Mz?κNCzGCf3I}v=΃? / k.5ۅp'4I$ts5YI;ɗ{]M㱵1a&߶u켖es-bMVu 4i$I)ꖽ[q p@:o,Σ~YK [k?޷rcrr. Ѻ}-bfvSs4I$V/uqqpVon+}_=#c5ڛz=O5/CYWgGޒI$mv%y{kÁ[#`/p=ދ@5zWOoLf+\\:YYWs>SǼcH]$I%!ӓgK}]Jjkud^n+='p=q]S1evfe3&oem!kyKtu1I$Sc,k촌{ߤ{מYq*a`}ěAJlIc$I)jT~z5\DRNes~ݍmђ6 hkHu켖es-bI$Jk,L^Nmw/pjRG]}6v7z~C?ixC[?}CbM_iiq4~kk$I%:I$I$IL/vmpk$U0:Qqf5UY Mv20c>JOQYx/ 1-vI$S{;7.ϰ`Xồ쮺z?P݋5}V,NXZ%=Y]K ,~Moʶ^LW^̭$I%:wb}˚,]ͱh:`u,6[}|魣s!t2bUM5I$k;zYX伿/oCI$SI$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$R͏UI I$vBd.RI$d7mhp_OCB<Ն؍F&*uRIHol8p4GRI$a247h:jxP8T~I%%l^F RI$B[OuMg#QTI$ńl; O ~I% h FtiCY)$XavJ[Om 5Q5τ%Ke$KM eⳗ5*Xy I$:P';>.I$ȄϢ`O!.I$D$݌(6jcHFy*I$RKK6LB ~I$Ij}B_e`ѢINI$Ik FqS fsOg)$YIB3y;b#D RI$Z—Zy$}}’I%3;%FcRI$RZtggGܥ)$Yq4-f؀ v~.I$IjL&-~ #SI,٫a#) I$ZKS앞Ɏp $d$K1%FɎ;, I$jJ‹q+tRI$ܥ4lI*+`N}%$/e$JJhNpRO2)$TW_NxTKI$t~gG%v_bI$$~gg㽜tI$4IbI%k;X8,!|iOFApI&*QVݹ(줒I $EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$0AW5T֙h>"R]$I֞Oupw1Tí<5'ںL]nq`u# U2F9:hkD? I?5_onsq}V0s@u`H ;qe3l&z;OM0\u̧5?AE>=E4<p]]q4}ZyQ> v<%{"lN8KP cOTu <뷺DGl6m;CGO\塤w3 UZy39Wd߿Fe5p!Ψx3l I3= -g#p ({65=8\[d `w&5G5ˡK|evɂ6?jh.ˀ?Hqgջh`+S;vGu0o>ַe[jMD}V<~d߹U[CO*g,?9ƪujڝ" oڴzaeZZtyoOC9١?GՌ5qkGD꽛 {X ʩ5V@:|)dsu"n\_Dk p[?;]s}[]lK\rZn'sv>ؔ`hdOqSb s'6(?-f$4o߷_C?EAy4 %Oo\|=U=_TKAyM!uN;ʩoV`CnA?DXLũAq7{R2@vcrZ}s eKlny Q:!yH0NKuO&HǨ\b5ޝu7p$~wԝslqC}OXV~gOl蓾[nu[-y %.c#*V,nˇ?:A宱 "DNDDo蠹0/:;\TlKxes&;Y] hӠ%@NDF4gS{Px鸟?8H7WH\AK}64yw).}Wq*$i?tCD9tAkx'ziŮ;~\ET{ݵXh,. vߥ^De69qXT}_B%^l+ۅ~fގAhoĸ9n"`%Ei2øUKhe&20<9\ {;1cZmh S7bn~cD'88H{\ETSLg- ͸:u^cd[֏]e-ȏ6ZSasy?j/?'_Eoh#VA[$B/KY?.=jF7?ZԀ'vGT{7ٽ0ѳQl!_5ɉw򚯖z:7{gQ w;;eM϶z{u13?R=Y"ֺ` oTkrSItvOMLv?Ǭqb Hsd\KN7DRCt]+*o&㫡.Ns߷kQ c6v{o)+"NXԱ>mqVCZykQ_mCs"9'Y)PYdhuUy/as}Jze!) .o]oYѻ +$52?xhHe$#(|tVl7籍AXckti$'kovֆĒϠl AE{w *[@ Nւ?ZA}?i)sJƚL6I~ĻoZVQ{)>9Bufڝږip"b??ܠ^H?bVuߕi=2ؖ)t U\MX[˚v4@ZX kcSDGW86V7:Cx4V-a$".v{ 2]8 h.?jwNƖvO Ɔ2֐e fv(zKø nΧC*sZ:aY ۴x5sOTmv qU=YOc[ 6ނoxo$nG]8CX;7I%۝C}UH?~vdXeiqy[68w %je^KYx']8hv ~繎NѠt2ZudKz`;頼״.+t?E{? }C:"fOQA}D'YKk_L~wϠ_]XKBڽ|TntleDn>}ܶ*s;BxkUx5$أc7ӺϭN&-0, :~n\TR@SwHhx&?䫀ΡeTƿ=hPeU7j!Qtc{֪ JI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$VP/"fv SLah4ZWM8ZWIC,q2e69$#8?J9s~;7=ē+S1nn c `IKWl|@HIyq i}#ܮmqE9) >s ixU]Ȑ?PvPkkwu57ClvN[S˄xx)5I'4#S?>G*,q,md`$ۯpGbժhKih#9Jeh`R-ht(5^&6{D^y*4 F2cNjzqgaLhO>Iqx+Fc^Qn߬6ב1 AdmE þ?#C'dy ŘF2(|RI$81\x=>@ -J^x`w`/sz%>,>r1˃2ˎXaܼǗLJܗI$$s,hskЉܫߏӅpc |yˇ =կsO I$n9tϬǗUcKI0GzouW$GRzC%?/+ێlF~9>x1>9c#I$:i$rqk x?讋[[]I]I^`r''/ǖ9O)p{~(s9?wGRI$]n%X?KYÃOXbc,2f8FNjQ #3pIrJ?Ma-R8/%~m6$֨~Z,ٌ'p|٤&1cY$8_,bIs\`jJ){z#Tp~_,1X9dxeRI$G-:?UG%+nϬ 1bշ!H'ť es)Lr3/*y^I$E$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$ôʊI)I$vJ-\ I$jz^Jxh:8D:$J D%5m;f\HؘPS$I&2УS sIFi")$Hjd NgNgޒTI(>dRq'B[vE$IȏKIO4F@RI$'Sĥ3M3RRI$9KvM?AiI$fOKhT䟀>%)$Qh{Ove6%I'8OtI5jI$H^ݤNxb=%RI%#bgL@<{nI$\nhptRT8:I$O4 xI(8ӆ~*d= 6DkI$n tOITíҒI%3 <nq%)$UAcu> HRI$+<& #S|&~'TI!aQD#LxIR ^TȓKIhI%œ~ .1RI$G))HRI$Dv l4`I%݃Wh;Zp \o Rd);muj󐓓) bJ.g*wSEiRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$c?svwn~z- I#E&N-4nK ]}@f̗l̖P 4)^Y0@u q]T ɯcmӨNPGcFC`"8Qkˤlh{Ô G>ĩ@axV$>{3j]SZ~oG"eCI}(2} K8I<kfAg9.h'w̞C75l}>Ogualh0$}/} )w(6K[~??]ׂbA-6( rORcse=b{MAshi%uI ŵkgMߺr-t2LOo?lf98k÷ۿ{TK fZ[Z=Oo'x@s#Gyʜ[ Oť`.o鶦uu.G҃}i/3b},i-Ϻja>c^;p}}Z~{~[Il^N-oopt#AR 0fyԑ|LhZA &=&մ^7~l$2>qZ3Kln8v5;}oN!ZRvXS÷Íg~"ָ&# }D8Rn>g]c_UT48k-IKϩi&%Cj1u{?s?;3!{vv̶o]bl]Y5D[`m`lhpF?L84G?'y0X\[[2 RJfXOFWBK2$5dG%DHm2_߻4k$ogU2\47M})==MpiqTDzXCq19ދZ}u7e$g3gDwu=`ku#vw;H8vptS%CY'QJkՊs d_՚,6?i;_-.r,kCwpYvmƏk4wq3 D}?u\ 105N8,.k HcJeK,kh6Zgއ̶ZPǐC@s#E3^E Hʜݲ#t/&*kl@ ϬZU7;S^o7 .:DK4Eg8oC} 2TmH彣 f{ol C'WkQ |Q +* Kw:534['SGRZ,w D{P=Qms]\@p#9zOYV@s\g6;kl4ov=Ϧ􃹛wmR@pOai{ψRR.4-v3閈?w |:9黗jT,[@\j1+XlvhiME€t(zMy5Io)qE^cU65Šͻ^^9$p?Ԧf:+;w\WT-,ko=eQa/kNӯ=ĸ>< $Ǡt1<]nWgk2d=nI=b$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.ϻ7O[54='"m5:UKDY^7܋b;S_/g]x %ө%6uh,KQ)p?<'h>l?5>{ܓtJ~~j c Ocw51_>qܧߕH;932O Q78h5v9O.?E;8gl{={$?t{CďH.ԋALuݼ?0i>e$)p&`Ϻ4 @-OҔ2@p/Gm50lRMth5'$n|Gf&IMOsUow~q)I<N)u 삔^, ge?D#7OkH x!y~%>h.EA?o}w(H ]M#cI$O6)p6N"=|M$0HH"ÄskPggb@@ h;$i٩)<J.:\ K &$w|?5@٩wJu> :I)@-j&&?-;hȏC?uCcO?D~rDH)sp <{oGI>ƙ ECi& Ё0 Gra)&H-cE5m p.4&mP󮐡 d"hNc]Jm'@X@h_4޽{wHGʟp'DݔC;GN42DP#RN>l?5\uy #or\ANz0\oo) OpC@ts┎HװS5$y[9<'Ե;7~?ěkHݦ?88t]O7 1!YC{I%$j?"UMLcK#)E!& Dnx:kK}đh43}n` 1RsǴ#hU.K,a&GSUW |̻ ݻ2ϏTUѰy>ctp3xNI$ I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJT0dkW ??RI$S}$I$IJI$NǺÁS#ev'Re #$@I$ -܍G#:[[]fWvo_EKusJ2;0r&qr^RI$5`r'MH$\mmuc1'P=?MeZ/6+պEY.kt;'VS\̽9gN{.nֺ{Y]kA1:H?V'''/lp{>b;˥}uYvX?Y1;Oc?K?be\}r1AY' W?RI$V=.]CK$:ܗeo@XËa}Tr>ŝ[Gs[(yœyY0 !\>~rg[qkkA/h=ۿٝnX|GIj?>^/{DEYqew1f}`k# iuh YWd=%͝ 30ȜdH:1 ѣש/:mUٳ:3" ѡT'4o*s?o {u3U!5Zdӻw=$I5-}㺊<$/// P> ί y^I$E$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$ $JRI$bU{ijt\-<[C۩vI$+Avh D{bu$U'IT]}ԒI(mO m;ByLwGڥ$Jl;]f>* HɶfSmt|MI$11"LƐm :' |RFRI$ |RvdS.<\=3΃Tt$NA矹3@qHRx' 0uAI$MgM%6~䶖ѤZ|a$)$NևqP(r>)($IZ5gu1akj>L%k{x%降d)L}#I_E$Ie'h~i8POI% 4:#}0DAI$r)LM)@qd)"KI$gdGlcrR[¤IA V7k7$dN&kJt S[gQur'$R\Kb^I߻k^ߣBAwٽk #+rAhaob-y " _7_ޘk:O;ʎ]t1 ))\,kNC?؁Kq`5/v] VeE3~0~w~gIOt2oqpvꨳial0D=Ma{}E$1EakAo.ze[I.KE4%;Yߞq9>hf}Z-pq/ݮ<=0pxGhDOUH};a%'kmckj j 96?)B ֺMj a?vndƳa[6QC` hO7;a?C_67i'?ꓴF:zvcJO[ {O7 nZA.#s?m+C'{v۹ ]mP6ѼFo?p]ZOtLk Hz9G}!#Q禮H}d0E~ѿc =nC@tvvG'`$v =^5uM c۴`4'G샵H*s!D`0[Q<׼:}^6l/lճ'l&\p-$'ԯg紲^noao7~kkƴ LR8L:0,m:<}..':=\`J?Z֖ mD+?e&kѻ{-D;ÿF+sA"~K|Dv3XA$ƜԨ +$Ho_`9"'O?jsdi|gRu -G kv~g !sZ\-wRTZ>AoЍVp546=?;wѨ5pDfͮՍp;ȟ'8m)Ůy;yjICmNR^-v?Vz4+>nGmjMͅ7ߴzweMsNnps_ߠOaQ}vx# J9ćOt?VO/oA%"~=S]n"?qgT{G&ѽKd{[+hy߲f?O?uugi.v?꒮Kc~Ji7CGG%(9垘uf@.3*cgPcdd;?҇h ͻ n{pEet-I馱ki t-?@$[(;ȎAGS*-u/ sF=,챯caZe 7F' klǩ1{iO~þ@|uD Aq;A'<wj<)j5۠wV=g:s ׼v]&nV7GϳvAc\iߟ y|JNeCckuʘZ\`k?;NRRs{"nc}I*1˷|`5TK5DiAV7H\u\ G,e]Į=/x&uAI IFqè2aAkƍ?ܳkv-UI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$N$eHskˣ[SG}G 7N~&+v#n,IS}F(\[0r> 2$/R̬1vsXbx$AHNڋFfU*d:*;gm$;@cNSme]`;y{=ibX+scc il;Ѡ;J6k_"5Ƃ;Pt~cY_'i8v 5ͨ;Aq:m kE6V-@}ۙRɾ6li{}?wOgtUF?(R584'jvVuk|JaW<:-dqh$G;!4\n捻V9a)斝S;g$uP+e^ӵߩHLq NډGxE "4 OF+Aٿ~`s{?Zk.vDvoS{Yc@Ã;@Nz^m1rKk$hvlbl< xS:{dݪ.`f C#o2`HRMm[c㬻?UЇ3t浻ZGgWߐ{%?o!G`Xk!/Oh3֒c] &SkqĐINo.ou;kezn;-?Ks?}/2]Pkw1YXevk{qq[ؘC@Ј/DGߵK >vZ.Oj lMu۰vmdž-q+Pdz ?Gel{6Cz-:X-DU9f#EZc@ܘ[;۵+Gf[ɀǸ6ڜcЙmݻnWO \lzw 1,Fc6mkxzgEgrZ]|EѠGܓw ?iasfE:42" `ӳChZK%.K _Qْ=6Q{vsmK7bkrIޜmN"bD3:ˡꑚ88F4S5xyor7!n 6t?}ѢzkPf<^Jz]Ul52^6V3}PO~ ѽU=D42Nl;+MaKE3E{@i&H~V3ck7W嶺g \L۵d[{r^@6umk}',FmvVk[~PVI3R\ I}l Nߡ?:cg_OEXƼBFKIqUhY J5iɀABG莣2%T$F">&2- cG..g=Ƈ Jcfߧe߹z;%l?ڮ(q#۷$q3Lj ǡt-S49wI^狥f~Ékk-,=.3,`]A1-Yfv!WZXCZOԯOShcOPn:CA.顊vj7{BV3Է2:Ʀ@fc+n+Dm =]U.kj^6kh;Ml +Ve@gI-Z[ow'Xk?k#BDT{+ ne h'OonQ{@vwj9p}$SѝU[7'5XC3wT1]mknc^@wz5]56 kϵ~CE{lk8G ǸݧIwN. Ij!ή 3)z}`kC΁??gЫ̪8,/` C\~VM 3诩4P1l>6mP,=o5iqR!k Gm+\h ېYnnᱻ=gJ&ƺ7GHmu-clq=&õkt;{?\ׅs^C\=ğrkkNDe"K떴8eJ]l  ?7DK-ΡޠkOGmOs-ay~d=={ݵY2u)4 :1ͱ3't֟fcgCDD,¯`,n9=Un|T+ySI$EI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$*2~5ԫ̟)$I)I$I$$I$I)I$+2C,p!y$S$e"(HPI$X &%I$vԤV$IAN^d!2IZI's$BI$$IL_W'AV90 ?TfQgLǿl:6(U)%6/f@sa"0KG}]G]Yh;Wھ..`A]5uxM'aon"~7# ťḼ_ U=K/{rN&[oLvu_վ?cX?XnqveG\ =O͈]Ct2(k<5%S$W,!GV y&K-_ou Wbd7>68$H Q$]YL*e%ٻbh.c[S6L~zD1H7]eT;mg\~SwM³20$'q$qy,ڝ $zco_gMTjlfE7sAIr},ۉecl5K7kk'A_/"d86OZ}6z_wDu*tPMCsCZpw<7BOn;|cEwDQ=GDȝ͠6 PYfỘXXXќLX ??¬tI}$=a" x;2I$I)tFp F=-\̶WA%{=ZϠ H;TۋԲ)6SMϳ$I$cg*f=-$cwݗ8JaU`U[3s?(ֶSYks ԇhIg+Pg}o-i$I)G#WOc8Hv7=?ϷoIvEnsAq 2ӳتW0heok-.Z=޷01=xȭ $I)LzL%s}'N!}bZ+;zI$JtRI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$?LNA$ı<y+aogДA$oI$tv'Tk$ 1 T]0I(ϰDv`JCk)+e$IShR L<đ撷RI$Gm-{A${e-p(AJ]$A$T6N)m'SjCE*I$hR3:D@ PPE)1)ILAs*mkNvIR,dr~I$X?zMᯟ)kH n|UjL^qS" @kD`xRU.`Fy:y'$LLQcS^ I$m2I4'P!ęL5s(cdh0O$)$N\%#A)ԎGw$T=I>JI$ɝPAHNDqn]&) LB&> 1{$ 5S I@ˣ]>6Ϊ@ S$$I#Np~De7tIJI$͢" ?۪s󔕺I$O:GmY]I$I$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$hH:ZkԂDt6u}RѮ#=_LG⹋DK N]N\قBVAkh|nlӱ}Oi;n㦜jѶ'Ǽ %΍(#}~44!MQ,]f$)8ƤXM-p>Jkf^dz}OH 5pCu7w"aExwV\vRc+c5OYE±hD*{cUq!ܴ7}5>v7k"DdBw>@8i)Gψm'@|%2A-v:yE!2{nogDBuH#wу63 I mpnItT mlL%9 bEv/, >{?5b9y͘zzC䥽#gM lה6:A>_-nf|RM58n}*_HNsvzl {=mWZxi~ͿCzc6?_멍ǀfSs}A @s]I3rRR#\[Qn=JlFgPC/p$wwq5vՔm 8757bN<ӛ@ t"4Y|?XLa"l'bՎ?~$jKn,ZI:r\muؤ!xh #R-G|uR4d0`ֱ{̀+QWE.fQmK\$n]]o vjn'ZKG'IwMB,:tT h4'xJo[HSmA#WG#]N9}uA:? d{kt.g)= ~{ڎEMhb{K4(jGH htF?褖X7aenkqikflKuIv8LѱP k.;7!u-gzmCs],9i-H *[#Pu0a`'FO s{DƖ6!Dym6L=#YXax͍N$$ NӘl2VVI#P{WjJcfykKk$?  CvcwCvYORvCp56owJ>2Ip 'mpv ?E;DTwGkJ]slX͝fO=Guvg%]es%۶kߦ }F,'a_Ow]Yl3S98<"<i[wPu 5#CzJYZZͿeXV HfR{ߌ "#qjnYko@"5)&HP6XOvV IHΏNwI̪1}?ǷE;7s[TqLkdzwFZX#Tmd֞ mN.$/lm>mw)bD0>ƍX3QC߶Z}_QxomqgS=6@q?IO~N n!;Qe:{G`e%"4}&A}-KSTXƲ<7R}"eDu;*aѺ4;Mfcq`ُS{.i`w104S<)֍k:6z'ioĴΉ) 7\{M4ZZ.wA>n)/lm-$F{=,i_Ǩ#[cC\gLn @Q$hy>)4H#ϷR}OhR2*/ XUoGXQo? 2l|Ok#6d:G&[gCj4pp=Vi*.] C~eIk%ƺAJɦvc폤Oz#1k{ Vwnc^j5ָ6uh?=? /γCo#oB!~wX4/ApHad6f@EM|fdqwng")}Li@^/T<;g?h uvOos;1dsIgMGR!H1?9A }I*"N*ZO76I!nlw?@̰^S@{wr0X\D9nڱinwi0T]gݠ:A3B@WmЀLH~6ciF?F[h-/sH;OsYI8ƽۻvw?Ldi↑?&6G%6keuPW$Ii}!)o%*6eglU \zY[ho;|%p x]}p C<%> e:_fH#i ϸݯ`\+KsAn??t TRI%"ĉ$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$v~'n)I^kk44RZ,cocs˾Εo:EJ{F=b_pԣkrOs^!Yٱw'>5HP -؟)״It1N)l۳ uK^3o͹.>K7+oe Ϲ6s}[Ur%e{q{?蘤d~)=Ӆ\*-1~%q «j>]ov'&dcddf=cCct5~'71!H?+a/s9o}T]Y1 TA<Q/sI t@\%?i&>Mlkk{macjq4 &ZKCk+ykVc!E 4: 3CQaxsF疈1vhy_ɦkl:"YAQi˙=I]od{kL O5,֍Ѵmu;=Yqvwo ÷ۻE * -{JuyIVR-/|<ţA#AlD'k 6E}=+K^6KYXZwP!a8ǵW/>{dk#Y}C+i=w行Ӹp>I N9n?؅VP?ꜙi;MzI\4ZwSiέ2f֗}'{Dͱ>a d[Xk7e/!%1Jla?ig̀Vs3L2,$w>Ht3doۚO9Ga3?q^גѸsVy8R?3.iea?P vv?qq;0tsQty,h0={Ξ~$;( -d?h>뽊i/u=Ej}Vq!k.ޝv'{ &7qh, paVCXglkE6wcQnǼ}%%WF=\"Cz+:kh-FUA/2869c- nu<'m툓F̂]OǐqIiݡe\i,&Hݸ~ZjuMyǰJXZH;?w&Cõ2^ >ߣ51AnkĞL =ny"80d9yx0$KYᵌhykM'Yh{)d@.^F3*ֹ,-i3o"&naz,SuM?( QrֈI9q:7in8:dC1E{29:Qmy`3߻W]c,&àv*-5hn==h1dn&F@~iG"[k&"JCwnq=I1X0 ѽ^pWY5sNߢuUXmpnn٧Ee8u$MwTVV"~_+ `-s҆_;SUkshLvI\&i2vֻpM`?FM)ֱɗz˭ݘuRK9GcOw~K'jn׷w5oڊm~UˬS;opN{x8 I#O֮em{|gobc(P}-Cѱ?{} & \7kF?Iz.Ƶc{LgίIѡT@ .:oܦY84< SrMKЮ뛵'qq7no{ڪ$cys#'qbs! %?ǝ}u]4RKMD7 zScZXͅjRMn"&{=y<[渂ƚ,ulLNy#|^šf I$aRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)J̟*3'_JI$JoI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I#a8\eqYÑu\C\XCBVsbÆߡK[1ǰ tkg-Sr.}bփ`,<=z3 A 'F8tTe{&35~G=,CO~;Kk}[2~LY@ l>z=7Kif%:͟פ|΢Qw] CQs"QN so{?Ԏxɣ֙84+奔+_LOgP:?w}.^*-T×Mv?=z2MзZ[?,yO?ԾF /`3G5*+uwH/>+{6vb͟JMPOOߣKY{:OtÌOO>tn #tٱuwb][Kw%Xrkz[)na[XۿO,oOU{`@ 9LNaaCȪ~67<.s[k}f}Z=]W~S.5P=k~?~[R6nA˿&\YS+zc&Rw0Ouu[ *7cVXV:ܦZ\ko_1,ƱTvA[;Ȥr~t}^-vQ {x.H4rZWN|=d]j_-yVeNǽC{1:g[YOU}7|kᱟՏ+0[ wذ_[U-v#P;{=_i)j,岐K9,_stLwkci6pn3kX}Cw[ɝ f?Bu*E[6lgVz^U9uW[]wgl3E\cZ旙tÃﹶ?Xz~nwn>m *O_Y[sjH4U.7}M}'jZV_EcY=?MSvF==zTzXXD}7Qo^Of߳_=Jг]CO=@5kv)}pe[)i<\}}K&_ǑU^*8v?mvm%[о0]Y6Kw9=M'+6߶ST}-]#[QTUy[ѓvwInw{2ytq5m*s~S,Ϫ~6K'ߦg/*qLZF=WV q6=zY6xO?{z :V k#% w;"۝U[6z_ l}}Γduqj^ݮ?./GE̼]i2H.hq[SWC+oznqqgv;/#u.ne{Zvlъ쳪tF[վkZ ][,kX ^8 ߡZԺwU n]n@h[X};tqe_?WiU~GCҳ=%_Wf?3Kvkq{XKֹOnSVzoDsHЙsY]Rί76K]Ql~cj2kշU[:t vȎTOQ8ۃ;nAVH>ʝ^[m/s/k%{6{~uonmj~+=BdkHtV垠+$a~YHI$I$$I$I)̊`nc׌]- `4@DI$I%)$I$IJYX伿/oC֊%{I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$o ^ZA"@ D}QH$JnOyj:M\@LpijRILQs@SD L1?5F[;P]$O8Hk4>0৴l` e%RLwH uFPA"?4Bk%߻z ]4'LxEKu.st '㺶ø(5΂I('Q'I2g^Yo̙JAv~#Akt0<U.$ ݱǞIRu7'q1R2;HVK50E/$h{%3!wڢ\7Qi !ZI&ixCLj"w5Q!#D~x2Td `>0>)}ѫ[4$jfe|̍J $F "ǂ;Q:(%HI+I"a ns'N÷Mh WN Hw (i:V8F!3l,v5?83) t3 BLnOc庙ӷT' 4wJM aOIJRlP{>J{1ig|ˀN-5%)tL xʐ&ic}G&5UdL[A$rfGi'64qRu@wtJFtt3uqt4jRhv<4'W&KI"PNtN`85X-~#q=礂bR4gIJ%D DXNS$C !ԝL&s]iLgN'r6mCu1ٽ$R$5a܃N)#o?\t$Oh*l'i5tIE8$iyNa3D{RI$"xNƀѤIP: %$Jkl$h{,rg\ +=4=>,tI$I$JI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]ձ[+_68YmswXv溣gpjN6k;'64#]]h'ɋنߥypkAG?O}/M(ՃP.nSv{7 0$1"ͭ?9x#G;;he@D~ ?o}cb#a }wÉks?)7H@GAEby}c0uj ACt^`=&e7m6p} КAhhsIl밇6c#ls p=ޓh'Iaf8>J,S))Xusik\A1lw4LzCXͯl3оXV˃CԵO#k\j\r݃;=kC543윀\[ 蝍6;YRpk=;7K'^lGbYZ{ a蹻P6 O-(\Z,wdn۳wU6owH{}mkt\ݭG rRlwu5w6~BKYay`t[v@kvmqipk?δw)-y`;GP?Q_cɐu|#EL N-68w#p;}LӷXD^v9 l^)kv |j ߏwԇ5`/hsl (5 8mNv?,UjaJO2Ç& w`^g^ZGkikH4RILoE$K$_?NXI.sjl{`6ּ;X*m\i%ƿL`.t l'se#;fG.j?"_`\RC KǺ{LHc+~?cD۱ۜC]kY{hle89nvY F-{'>,x[Y) }̐Kv$G6s[s݌`{KU'a87kuAg!yq~]] ]~Or[f- Ir+d4;}`,䒚c=| /pm֖9cdoJl6_ I3W1i],~96eޛi%IL臸nQM C[;H{GӮ\g?DBð65сcC-l IWVËcߩW"]_y铷ۉ1Y!Gon:aFj.s ?ܞ ȏfԔ.X5ݩY}q=A UW=@p?wP­;mI" fRaL4#H*;Xֹqi@ͥQZhH=-;Apt}ZӼ?[17c@h& =OUlֽ֬i1ݯdkɉuHcaÂ[KAvMU8mCG@ c/t:N/<,6ۺ?I%xޔ8u9}zֽ[YtzǘvQ1}/N%ioi?IlC]:Ԕzlw9oAxDkKwj#3,~w;-G#t_>Ʒ#!=vr}N"!N\/Lf ` JJ^f86{g|Kkx&4rcSi+A2#3Bxh.7ݻ6…ֹ@7P.sØKA?]4˄jLI߬6k vIUMsEn35>\KA|81Wav=ω5λqrkPq;;\\w nILUu n.vD ZvWc?+o`gPWLΏa;EԶ6d~wI0Z[-`mDdK>rY=tujl lXcw?G-APu$=2Ͷ]`zvS12[߼ݷtkc/7O,$˿b{m7CnGnjQ/{яJ]"m_l_;X?{ӮMKqKf1$9轟{]˫l3Gh0F6Ll?:\4 (^4NON`"o}:^\ Bt+}YX4X70Ѷ{3q)WkC jG׍c^Kه=_Yd=v;e;g罢 čl @CA ywȵw`h!%6! Z^Cq=F:߸~9`< CdO/V:T=k<}EZzu; p7Ap{ A"oT'YX @==@ּN#K |@X?I3na^^2vZk$?dquciލM-SwʋӲcﵿ{ԙfӽ LG Q`c..?^4 N$ɠEel}tAxpi]>?^YU׺=6@.kǝovl(麭~}hW8ǵAt 2tmO+Qńvjí{7o`_]pss{ x zs*x5̀n>s7wS[/nƇ{w7NJk$jfݠO7#ܗ?}w,n}=V{]n^]ov#U}FZ@t Nץ0<{hA'4:Ust1D_yN}*s"{nVDa<~s̃},hvQդO߽ xkX%?oEvG62tYZ_%;&o*_^n"`$F)T!DišI$,JI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)P_T0dkI$IMI$I%)$I$IJI$I$RI$I$I$I%)$5gt̖c{u/V=WCJc?$I$IS6_ښ1\_ޫgdTNJ7$I%$Igu3s20S8zE9 xRI$RDevQ\<]}=w׾~}W_~CX{ZllI$JuCE^Nz @$5$I%$If*ΰmH =ޟٓUL^uZI$JJᴉtrhw w} I$IIB5懶Yoqf}[:0Uҗ{GGVI$Si3ЖE<:I$$6_]cZδΏr\R[ AWĒI$$] p !S]o[\,vI I$JtUPe{Z-'(_]BlsZIDI$$7U[=W$}u{@o$I)"HoȪz{C?xz\APBI$J]$I$IJI$I$RI$I$I$I%)g}bZ+;zI$JtRI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$CTIo&T+ - '*h!9Vݰ~ɤy%R|;(1w#k0 {7{Ma t]I%rI=I%';N9'F^{KZ#lj))s9'i9IPhȞk\ 5+[\ mlin] #In5LI3kAuFݷ~~ưC d{iM)~H S>:v?)W[̒X}zLI9.qtoIUkHg)cE$ig;̉2|;@=O{>!M5$>ƚ)qNů5r@AkDI(Rn2Iy%kOHELj{wZuHA%PI3D5>jwz{!Ҽ0?iq1$'I)Zvˢ6g㴂7I)XH"tN$4I$@pԀ@R#`kõ:GnnO 2>i!II>A?n8LNcDVc{RM h N\Y"yp m$:R%J2dgNd73NXP-I32$ΰ ?T@a5u}uRpцZH夐IwX C!4Ly;߿B`Lv1\yI$xs0;Qmok l%%/#T'y:Al|&'lIcT6mOW۹+cJG'9Sk)Nw9Ѝ, ~h$i;@s_;y1OkXEl5- ;L'a(^XoIcϧ:*][ pS-'u1wٴn$*ca &g_h.ݠߒH(S*J L1)3KkZҤv5L@F $uDχ q;;ӡI03®b85Lݭ25) I$MQV`ª<Ѽ>*I$I$k$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$In}VƞHO1vUI#Ғ=AG?]aĒ2kC統\叵Dѕ "v\ݻֺ :(!CIn0]wH![ti=OkIGnjXai@cӖU-s& ?*s\LLH?)g$ʺ2FmkkKK@2K]cq@Mn.v?ߴq>?ԃAtp{DOi&GG 5n/lhv͒g헳SkK:`2Meq29+;`>pln5 Nɜt%ۄdW疗0jܣC1$7s1- up7ݯ}E{t[.:oTh wHjL飾`sMAH$̤3Ƙi'PˉII FK^\<>kbT^6c:1>;= >[l@MmTC[Kıs}Tr.dFfܝ ǺHzviYsKlI_c=ZMZۉl6?I[ё娹;gMtOmasusHn:FޒX948ic}C>'e8 6Mq8ؙo5 ? Y;FAŤ:j\!ςr6Œ@wZ N )mcInZo?Js)kxwofɭeuݭqvN,8Tyo51뿘pb8O]4 %c0`s\ 88X˛KWl?=OZ;wa /++Fpg9Wڕ;ۣ7?lhPs{ W"s@*bHDӍKD\X\G>DVc|<IW/4i}oq3svÈ1NvË'~o9CT^6Q#D6[$6{^w5 +eM%&!}ߡc?Qho[C7Iϲ;g穸ㇺ!C p~o"Yp&[(shZuR;HΣ*`ղ|8ܜ+Xw5vHTS}{al* 1i#v76og{,#ptvߥ??nh#p$<9Ly'qۮ`cuoǽ%ߺF꾏jٶzfwon:͏ Zf4vYf.{DQ]Gġv~m~ƚ\&~ Lu;SgZÉ2yHp$4מR<~9mwgw=V2d5 76$dC-qUF;Ɩ$Y;=?5 DGsj>#QDrD@RP )%"o-$I7ݏs? -44o}?aUZûq7E|5ى?_y0=$ؑAPǹ%2k&7nz 5kLi" k\3oԯT8/`{dVO{Xpx!6k]gQ*vx9iR:%!_}&Mo,k1v09šmpϢ FZK}[k~AF9FwCnǝg(tmԁ"!sMoҳG`rRkm =7@-V'h  ;rb=?_߾َ%h>{ӑD>| `g8ma?{um߿#2dRFLp.!i1G=撚o-?>aÚ{®=?Q9ZwGzN Lpkpv7ݽ~vgEsǴwH^?V@dY[moeoM1Wq{wg$3K`H]{nk\Ol9 )>,@95N{w:N?HCH?-`0-y{HR:9\$/Ϡ.{JlC5<^I.pv9v[&h@XG2䗘#?˓ %:HiHsu$xi}gH17ӡm&54/l`pI_XI:dF?Ml˝%cBI%+d$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$kL9䓻~tl{Y_`s$k?6!T=/(?Us c\HաgA1 i?35הf̸k&G(Ak>$+;k~(BY;Hq 1`ϥng@#__{K)ccء 2`I=&nEM๒{ ci억ѪE>XH1j^`!ִqkm &Keŭ7h4ٶ6πZ5\ָ=K_w_Z)d~ lywW(3#а;qS(\ksvA}Zckac ;*)ss{~&OMv3"ɮ)i ̲~Utd[͵j0G,! 'ڞWUA Ysq"Ikk KL6Z/.3~=E7tsk^^}F~~} i2"K^m:FI-,nZ=JpIh 5nReỲ翛#R971SGx3b#2.9CDZk:i }gR =Ԗ6 K[9?tJZZZ ծvI5[]gXKZ>zb(Ʒsvkc_b]LMLK[!5Ukmqk{*"7[#Ts4$͗:Z4ԏ bnIgO_Mo&A c}MԾ>m`nl:_c Qdk$c\'kKk?19ՠL'·yQKǀ<,"F[オ8 }*;?¡1L㍄˹ ݞD<<&'h.t{~"&;_lv5ѿ)=}[^=Hl{_465 u?8@kֻfnB(:M{կ Bi7ͭLwWѹķ?5E4HscrOcj%XlsP}2q(1:ԑ2ˬmo! sN?ܦ2ߠ6/vGfV,ikC&YbFE亭wS4sgg*X}tH"ʝf[߸&ahi|$b BvH:_*=WܒcLC{wlwD.ɫm~b% v5XXwj=+Y-G6~c"νv#A? &Fn%͙?R}6 kΜnNAWڒV}lk*nsβѩ4}ݢ}~g]SK0*jjcݹ4X睻kOcFT\kr[- Rȭiwno~z]KKw),|reY! \}*zSf3lkKms{ߡ9MNEL{ef;^E#ҸtL,e! :o1 lyХS~ݬsupMA)$Y~UMw4@q?g="i nvuޯ3ށzͬ !h`/s7K} V=hdkRk+^Z6nB#!kHhMҒ_N ֐?_YB}l'ok;>,K >R/ nMn{[Nn5O-p ϵ5t֓3Gks]g OH$&MeX,owA/X]?KlSe/4MLk;D㊱K@k[6ML\`҈\A~e.mU-b4?I:ۇI&F~{>"k,s[{UC*۷0{J6Whˮ̋AmտU{(8wn i{0HCM}/6àӻwmuFFC2Z/w[ŨTCl.ճtMv4iux3.rl h`#h*ȹls 0Hה%|=l6RwX,Q$I%VK-!R7Y]lI$Վ%CX+7TE}~Z]Xag=?TzYvk{Ŏ%6Gп~ڽV&gl`.{GTw^7nI$IO)׺V..vn+ve 6_*gn^7R¯-mme{XmVzu%}{KvT^57ck[ΰm͕Ec}USj.ma{kϣ[kkI$Sg;2>ˇUU RbaRj̺Q=z ~ٛ[n`e^7EV.e,WzjQd+];Ls^U[amW^$I)>cטf6cuos+TΟӺP'eU(kپep[E񋮷Mc=akDZ>Ց]=OS"{~tq5ms*{27ٿ/DI$x|v(uxev; +}=_c-z_]OԛqgXuֱ=ޕ{|z__V敫~t1vA.c8dc27GΟUA}Z;kϳoQ$I%:i$I$JRI$I$I$I$$I$I)K;zYX伿/oCI$SI$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I"c7uhje1ɈqdI%гdDCI=֎eQpmq3W2x0DՓ6p#= w>(ptH(LCi$!;$L2u { 5$ lIS n:s<<|#A(Bc^R B@Bؑ'?iAeuJph2\ʵ{0 PRi {yIa)8#Oޘ2 ƗLskK#U$.I M:^'lNNwacy{~òvֈ8)]$D j}IZ 9&,mDŽPgZl%8Om?F$4bIJ$Tclxyh?ؑ;FU5`wq!$Dc^J*sth=󓹥kCa9` ϊ %ieL0FĤfHdIIMZ" :#ޓc!SK6 b|U&#˺ 6$L:_~SVݡwOSZ8u)-$$ f =ԉ,:{?b۷<(< ?z&[Nv;H$]$!V@>GzAsEb H5tpTJJNaALf@h5I/2L Eu- vRM,Ioq`ѨO%|`hh-<)> pO?jJ^4 $L*nR?h 'Rx6GuY%R0 x`xQ^l釀nsdx~3e~7 H#́J|ƚ)^ߣ*w-M+ڞHrIPC"`PS[{uޙƁyv8H'aTxI&sO(1Yԁ:kK$p5՞"d5Klvָ#bp:|~PȌJl\pVRDp8ABt&">_C1I $z!N**Qp6DGܪ&4o4I$I$k$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IjtX.5Qw8d9WD̯@vFG2kh-$<+Uŭ >/p2LV K ::{}?M̐9݅g^l1`h4*a 3mQ`/7D~{l%!hn;O𞢍ͪ^.#q7]w\eͻ j}2i1ʈ{s!LO -om=)US]o'[O^Lq2X[Yqsx1Vց&eF.vٳ?FѻBL&$1ԝ;Hm>P A)){^Lt-3jX,shnmxcNأnA78aa=v6= {א;HݯC/H#O$n KA*Ft|۝RBv084N=Ռtͬ2?gG##Ӥ4}-I[ƀ8plzYY|pHIFgR4!"pvc۲D7n.c3:k L< =Q<~kʽB+ub@4fu -/3 TuP28>)Xy;3nHI=4+6= wO?{<%jK;Hg=n۽Uk܈'XLkxpH|Nŭ q ĭ%!h;w^zv?øZZOo}h}&-}T W?迱 0<-'ZH5$4=ܸ1c#B>Jd㺖>@"AFd3Z_km[de݄m/ ;Kk_;}8-4; ;nL@hhtm CRAiLI&HFy))k--caݛz_jGsZ=n>so,q̂68~yMSkXCKvƟgzlH,w릨Ok`֘=kYt:sܒeͯ/a Z}?(f9oOx,? X5}C n[ks54wT,-t>bΎ ilf :F)UCAkĔvMs>˽?eRM[lcǾ1VmkѺAq$A vߣzVm@p1"qG@i}ъb0KXըkOQ)qi$lx">>?1ȹ malwnRcA!}}?IL 7ir̐{ufHgwOk>l_l0 X } }V:M{~\/qaڏQNfaD4Ʀ DS,\op 廽γ"0y%ս{?&ng2͑7Ehv}Po÷j[J#,=@}lfp$jrJKh;'gj2?E;wu kZY$H-h$.W*۽R`ll߫D>*7#w$'RZӸ4pSzn/ht#[I;\CdFͬj櫮Ɔc}t`&ZL7b}CHA:-lsDOb7BJX_^zfltOoRrc.h57co>T^+k [c6nyD-X=w]ڃC-:wLAd)q1MBx08DOp4[3R}WZ  qzX8@O!(sXʮm%H7n(c2O* x#~3isӁ\L1:$Ɔ]Yh=6E9D$>͞euVZo:H~_Yi{[$K?{C'5nK_?0?I9tԵOG/=1b6{Fwh{ C+5AK]'EpH`s@Da$S!NK "JM>Ebs*KCCj4ϱ>gBCZ/ko{`6 B.c,F)hhi$)O5{AMvKp&Ok[BE;/ н7Us{É|Fv& Ḯ5GsXG`bs\@\K,Y:n۰S{{DGI[=45>'ETIq e( ;ԮY$RӦ I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I)IJI$iZON] -bF&{˄U a:~]ϮCLI*XzO$N ;k ;k6~pO歌M0Ǵ%d3p{hHݯFsxm87i&O̿b  (LOm|Q7G en m0L9ΓEVc9{Ca?׿ՠޟk=?o4VO.y5=@Fm°\`L~Ӻ` {` @l~OU,~77ڡU՛6p _48M]+$|ԎG< <7t7Sk"1&R8YYڞ}}2F6w\N[/`>Kx*>la?ښVIۊw@.V4jM0 cY s#mRk}.mT.tnApȴ;0=5E'&Aq$#vb?7CI$ɥUpṿg3""N\Q]RLVnXᲢ:[Àoh,,,PƁ0%IyrKLi =3WvAԟOp g?ꨵxخ5pv+''d}ck,Ӻǁ `?̱H6V]d1_{?jiβ kJK"5iwkI=D]T d 6ƐlͰu?wՊv]c۸hciTF9Wq1t|fE/6>ւ:IG2|=o-~~Kh{Y'@P1iy-?CZŠ́?p5 Ȩ^ōkh/~3s eaǸOe`UUlݵo%*˯u?@97دz.i8Kh;\d,nX]drHS܍j3BdH pz^f7#.rYVKZK=kp.T؍53Wq 9یq&A }VFݹX"OǏtP;Vܭ;29ssu(PYͥڿojUm-C/qv@6.m\= eY?&+ ۷Oѭsn&u-QsK7 OUMX:&Q8!{$u/D8725熽?ͺ}Mz[ec_>ʚ^w551Eֲ-V,a ^~l5ᰟKl;9W>f_NO1,~{k!Šj&? pV.Sѥ`m4=1 rJ~-Ⱦz2 i3ijYbKn% hK56/: ^%{5_?3-`seL-TanIۇ'7;644OoMmuR6q+-<5tK`D]{~.NU-$ D kO 0dN-}1`xʧ2)~kLi?I(ևW7V{hYF[?=&NM5Ϳg qk_t}{=ϗ';c\4!C#kGڴkv4\cE:wT2(i|x}'G=bQZ\f,7զђ2 ޭ=j7[Q x6 oh>_+'#~;p3C+7)䲢ۯPg \ ?5G]W?=6n";$:#@f u {\6KKg8鶶iUt1jw{g?uj a7QnK[gHt;vGVm?o{Uz֑ϥoxDc 1RG1D>X}D=>vKy0norѪ-s˞9ɣkvK#&H?IA(M+5Z64WWv#_2t<@]7M5vls`<ߏnv+XX-aGحEr-D?$z~CGO%[0:bIUh#d8X]aFΠMJʉ-cF~=Q?.FwCZ7A~$95k*o{;_ڝ$HzH3ekuk{`iU CE#c!0HOj7^e:Lü"TwGf8}NeX {wz>5d ; vFeV,hhh1}QyEsO/)۬qy<;6tI2c@%Bt:I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)J̟*3'_JI$JoI$I)I$I$JRI$I$I$I$*u*{5 GofྲcGO"jgsǏeM-t$I$ӰuhƘ&kq[o/'ڝ2U+ֱs ?"du+n?YXl1I$Gri"jmcǫ]}lGa]F46ek4tnP}cKir'KkͽGe"1ˏ}؉$I)뺯>+̴1it0e?~.ts6X\5ޏ7kwQY=:]Qy>he[.2ݓ0455 ˬgz6cDI$NZKv3;u,ez[-EWLp5\HͿzVkן?_{y}s1ڟd;үkԺvuq-Ԇ2ku?h4_~I$9u [eO Ƴe5ќDL;w\Gz6ze;'ٗegm9?OԞ~ڭztտԯ,I$IN'֮qƢ!==,Ozz UpʟF'= pVM36csic+eof_m꥟~Ӳ\i$XW1ۿUI$N٘kD9ʩ[gW^im;XZ=ߝ[(g}[Һ km'mb1>JT0p:-:Ƌ gMw7һHI$Zz[1uZKX}UnWaVoמ2[vZ?}'\۲hh湞UdWjXcGJ`O︎I$IOe:k-e3=UץmU~>vWS까iNK6?N( nkX쮥½Gf2yU]gTMV[[^lAϯeVI$`e,k^z驕uszϭ}.*vC}+tgcZz_YҨz1y`}^OZ[gGަܜ&7Novm"I$J{a3E0v>lGz?tȷ:lcpqMAC>7XZz^hdn=]rke6'Y›k3 +~ݎϳs7q$I%=?Zee6*5ue嬫զ2zѡHeLN9!%le~ge?!nwe5xvUg'%WԲ(Y1sjvW[C-Ucٽ~I$u%KvA\֊@ٲXnߦ}jG[c](kkCvz~7ռSvYow_i~\V=VX̯g_z$I)лvOInm]QZs [˙a+n˽K*ڿDz=BYHvENSk}m2m_luN WF sw4~ѵ{=[gf Q}sSFEI$JzĒI$I%)$I$IJI$I$RI$I$K=h_^_$I)I$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I-\{xB$D6f>aI$ٲ&7 U+`h Zv]f(Y1эؒ0rcU)cZ '5<4b%&z{Dw[Cƥ͈HRD$JgeFGm=g $"C9l;^6RX'CnTH x >KZKqCuE$۲i$>j/%RR)ҍe"R!^tw bÆ?ZN.~DܢډnH!C^xM ;@VëFR/5 FF10pk͕G!6dSL8!4tZIwOPwt}Ʈw5Lm.sD`q{(9[?L%" risZ:)6h- &\8{X 4')ZLBxIyku չw@B++ x(ێ(8H2y)LO 1<41 ;'Mct,i$_nZm)La3Dvn#(+sm%טei\~O3TK yL*,cIhh3Ɓ vS{!'T) I9 F 5RP2p׼G kkwfcMD~K .RM)ݷ]E 5Y&5o`S~o>SI('c| ub:H&yO=2dg|CX)GDQhۤ%4V_Lm.`iox'pN'ǵiag%lIƲwxtiTÆ>wKCL$(jc"5P#l1#ܧ{7WF&thRH^L4H|a;qI4EgFZ#oS`ykc՘sܫXX]k` lw6t;Lv sti#9SGνXl5]Hqպ=6S/wj\d;3g}K1EäGv sw86N__j-z;vs3-!HpvTyGHf/c5s\YߙztAut3:m{ڛoS}?o?PY, \@}%v u?:$ ] .p IlTSǒ %'!KCZ?Y{en!iukx T`jtLv#wT& ݔݥY]l'4!vHk+1&e߳\c[/wÿwUe@ӵď ?{ZL?SsR> A]-R:d Dqc]n5M~4ޝ/owoG;kD8؏mJa2ݮ'cNv9RY[ ly0A?i/廦5E5tIIwcKk<ͺӭB1Y6sMcpdl%Ӷ7,*~9{] ;3zw9Hڃ-#ȃmJC D5a8ݡ$0iW nkӡGn#wg#?>c{eƶ ̯Oj&#cn:%Z7:hTZ(2KvksQKe釶@ [f %}Vnw{^~fѩ_h@j=;#oh{Zo斠sĸV%KnӲI.???c~ԇKsCLp?6}UkC5ͦ&u잗^Ij;)ָ#YđIS?EsA6?*ZM{ y[}ϩƸ,ۄ8};6? v[s>A&a# DDbAtb$):s@$2io/om55Stdҿ-QUlA%]}w܆SѴ{w/Zv0;93\=4T7״k(=ZyJcfcc%_ԛ+q^DGmn]6?!$1pa$3=7FI$ ^Nha#sBJ^ɭ۟I7R nj\ v464.-N]sΩ?g56Z[\D{,q/͉C5Ԁ }'J^Du~z{,~NFJGIUNKFE"[vl}칮\/6 ?&k6X>ѷg^c@ͱtp\$8 8 rIK뱬s{uѦbc9~=;`oGe5i%{6!=k?6+%{s?ۆ55ifpgg!Dq2U[mcw[k'E;j u&.l}ާ)em*k?8}g}51>$ BAgI6֘wZVZH _%#-cwXU֊ms];1_eK`ϦJfikGdw[ga}.Z|M \cݦ*%/흢~~7]p O);!՝4P h2{.?$g!;@}K1ˀ2䱩'4XO5Ϥ3 jiмu"(vçV@wggW/G78dofB45cĞcoC.1hAI La#pkdT:e82>M_OnuvO4M2HkGK7wn2"X[;TkxqEYGdW}`ƍ2Fk"6jG֗*kcXwe/a>ջtdH>TI??>dwErkv;]E< wѨ-?Goܟ?p[sr[,y&}KԦ{zg!@UoCv-6 8iwif6#?bX?蜴Înjw?QBB'\e2[`Th;I9JxGvAA|Vk:Y˱r}C?u&bCxb1}Xϵ7oD8}/'Cc}KiOHI9sYA [PrZcȘXQgZY-o.^䟈zQ^;=.?b'Pkd:xz ~Xl&W;\?iYD-us2yПxly&4١w;}ev!FΣgW\t|AƣkohtҵIġ LvYFjen?iqAߟWD?+)q~6Iav 0y% X@y2 xu7#rWZ+HqW.~6ʘ-j{<6~x&dt[0i8=b}kES"_^Yi=>ۋ Нw>??Ӧq WSMMdJ=XdGʞ$h I4$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JR3'_JaLRI$$I$JRI$I$I$I$$I$I)Jpyh.lD-i$I$ &I(ja $I$!h.oGSzp,l?h=DI$R Vdž}ME,Jrm A2I$I)7ƱV]qAh #$I$,׽sISQI$IH=}2%?Bhg{$I$/¢Wo%f%6辶[FI$I%#5D@G4?W"I$I)u2C $sFΦ0W7w#$I$ǧbC4Fnk%oRI$IHKƖˁQ>W͎HEb:I$I)hSߢ>;nRd?EI$I%0mLkK@iiKfOh=sbI$I)c3ӥc?u4bȢW?،I$JRI$I$I$I$$I$I)I$I$JR%{Vw/// PI$褒I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I-> [Co~?U&)-0L8IUt9m%5w@8cu)N??9Bd@'NԶI89Ѹ?տIrpӤGu]Lk[DGBd~>'A)ݶq)R`0L`- znHXƂg@cg_~B&pgh;찍 H֓[GfxyT"!:P%9.@:d9$sHmpq"d 6Z:(+`u)5ۧB N>IhLIY:x'%$HPenQGLDS(C.BC}ssR8Ȇ򔔳]|ND1.Ӧ/UdCôSlww)a^II%:$\4k9"pSq{W!>))I$WY?Dk=9Kpx)o;@?5?FAAN&i$pR.lƼL`O4uT#ISj[ir*W:IaH8i0~Ƒ1?l0 :=y$)&HI5;kL|#js[YS@ f;rJ]3Nn9SsէY5KO\?9>-sa\Z\tEHi2JɉlXCKḘ-m:kN-FU2M\eI0q'QAC!BTmh)qgp8 <$%t=O)XN'@?'u`L3۱Y"I3:R\TIGy$eOqكtx6?=ak=i3C`& Cy3Ai2$vW~oM9y<1 y~j*IB;Hi߲Iu$S66>?$|@I-la9hb@IR muL[2%$2Nd0}E"ƻ8Պ-t=JI"8#p$G%+5,~kc󿖣ZA]%_4-0 HN ~α sfcT⷏t('I a~T_T͚$[}BA!fIEn@$RL$(-1RmR@tOkS2״hD7XWI[()&-J`!N>+FOm mh 褥:I(s#?(6'XLOH1MAޒI(μ~h[~I$*/[&"9'"WI$L(:"OtB8xo:Ӳ$'#Z-']UTח+,I$I$ĤI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%k%J@k~lVƘ΋}P>;S&($0c@-k ˁAvVi>K~Z^GnUF;`l5Cd$'7*^@! 9;Xq'+>'e7ck\L[h-k,\!Oj?iǵ}ki-m?ԆDLE-qʃ>[.w))X#kmoFT6kf4 7EjvnԨm\͏OSi-HGF0$ˬTH?AK@hv. k%~oGmfa]iw%&s4=Ē\OL"&4< ̙'ByU01v RSYͺ:׶Ɠ= Xl~XMma46{a>mg=̷YCHq>oԭ 4,<`n,CvЃJCSeg-$85?o׆s~⓭f}XE~,Jfi?Ca=8]` ;O}yD;> >h$ū@;Y?J]}NW5QqWAnց`5gFZ6>o wи֋$\;(l$$5޻fH\ v_wc[oكZQ:r?W؈oykd gmgHe>ƀ?&v8:ЈKFct_$miƷX//.wtI(ʟw݌*S4 wHg??%2_p6ϥgwW{R}{wjZH[=-=O~ N\v8oO1ͬ9ΜGTbE c;y?;?ѫc+{dl07 [J,q?Q^hnCel >{+ N@5*3 $N1|Q5iG0-p-3-wI bNk ;~ (9惲m'ltQh` k] Ym/d5|gfGiBepݱ(έ-bG0Sן~)tC_˶26z)~Nw{@=WĬzmXZ;6oݿөo~)V Z k U ^a0sJHip{n]omw5YlmHq%}6[+9?#q KDnn}F1T#ӧ}~K #AƶtjԐ:C!FPtIIL}<{[?G 9sXKu,G(ZA->r u47] >-?j%A`!3 vGH?ڗͅ gj%)%2ٽm3oVuy9CH7nd[ !i+=swoj \ NH3c{\O#6紆I LK_qT{k`, lۙEP0]$Xcsq{jŪ}Ѩq?Kei3 'qiQ ;]䙏B+lmZ6ƐuߩFo9I7G]ù̏s[;-e?r#-ޫ$jLGSLDhAa+pF!'kAФǡ[ iTX"5m-# à8S>YS8nz8?t?2g tO=;}Q>?I$/VSYlz V𿹿ZX+i"d7i%[vekm/`~v??ZQ5Fh}&E5<}KEF&{wR3$=gTZM4D=?-os_7kCLL?gYF 1Yk{kb [gIE}yy]؁ۀs@[oXAcWKvX\ ,-pc NNepAq t7&6:X ]LNZ$L7ih<Ffc39Ԕϯoc6DK?gѪeu<[\덭w1t?e~~]aOLM}"9(͖A'Hf#觰 6n6,zm{IFb[N8!phG XX?nhq'?I]*斸$9?}3Nh#(;-oxw uwԔDZZ)x?qߟ?+ʏv?Ak}od~ {ki1-vK!cd@w\kK i9t ~os_Y-gZ3f5O1,i}=/on;e`Ę?XE4q?AWCcQ4IJ$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$.NcjCĹ??Z:{ IڮtW5U9cbd}[{@.tw$2c:Q!Q~0>wE@ O G97KOܭtVAwʩڰ) ;r/w]ib I!'،`O\rkUq =U.{lwIto{D<,U7TvX81;vq"5ؽɶkE!?shhI:&Ui^<XAL?2nϵ{~eU tᶖⵓ}7È#d2Rڰw7$%_ʛ{wGLԤMsh܆H6C VEmj/jjȮD5Bʾ8]-[stCYu!yAOӅSh̺OFd?uw̓eϑ#B70Ɗ@79b籅̱;>}e%ƝECscim識= &̧u'+y=M!=/nd|?_ӀɹJN>@hTgFo#͌@DivNƊ4GDB%%%7/9;lAx9>I~w&]" ?);k}2u&U3.=A$k ,MXfEq6֐ ݅<+B)os) J:&f:Bvxm0\% z1]҈,bn#XVC-' 1n~{/f4`tu\/ :{,Ԗ,^ޟAAqq'qGA&w?JGt͗Ͷh@fC0 BK k8ۍ}ۅսKKN;LC &f+6L?.=vC'C3_`H8{n>ᴁetmʮlDzap$|a5h&>i?.n\ݫCG'(교$;nϴ۟c[8o_ےCAo'ڐȊYcOrE'~3B/?eWnhc+=;6=c3 \rWXql}N:Q$nRdVͫeߟV+Ū Z  ~⽣w~)6o aB{SkS4orO wp:7l.X+>4ݿ=UvѳrHs>m U3Ҩ;a- ?IİlCȢ2{\Z/eNqf..1gqeWu?k~[kF.;gV~ve^Ψ z$߽Łѣ |eE̪QI#WVN ȣW!R̖ _WhUE%3$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJYece]eta<7荟I$IMfcn5/fcn5_I$I%4>ٙqԾٙq}$I$fg?Rfg?UI$SC홟ۍK홟ۍWI$IMfcn5/fcn5_I$I%4>ٙqԾٙq}$I$fg?Rfg?UI$SC홟ۍK홟ۍWI$IMfcn5/fcn5_I$I%4>ٙqԾٙq}$I$fg?Rfg?UI$SC홟ۍK홟ۍWI$IMfcn5/fcn5_I$I%4>ٙqԾٙq}$I$fg?Rfg?UI$SC홟ۍK홟ۍWI$IMfcn5/fcn5_I$I%4>ٙqԾٙq}$I$fg?Rfg?UI$SC홟ۍK홟ۍWI$IMfcn5/fcn5_I$I%4>ٙqԾٙq}$I$fg?Rfg?UI$SC홟ۍUĻ]mo`&/kܶI$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I%~ -\ӄCs~?)1Nl0nq&`U9ɍ)~G)\I"?6w)0895&cKu$E;hl%bb5ctד襎 IO kD'JP)&qx9}"{o!wʘ/{jI<9Q |S&:rLwoR/,ys`2{ LE,8#dN4I$d YMqj}D:nbOqAJ1BtS%5G >=꼖ڇ;eHq975N֐!ΟMHkۦh5IRn&p'S7aĸ #JY@Gp4 .~:]0< 5p"9'MZ @=sRL)'/eu; 5վup}C#L?'a ԓj]#I"Z0 wYzu$@ P&cL@#K׺p&Cyh xaپ_\AI',n|k=~J 5p>jI$eN6>;\q%tQ٤ttŶ8VLh0NP4,wV68Bc Ц:\#oJ} :8p.qea/"{*kcL8ϊOZ x,sO|Uv}5%t$C4ri{F 8H;cN羭7qPGRklS7 O{C"Cn-I JRL5:HLu󔪱A(g@'}451%.)Dp,<Gru> I?AwY:dM$șKVY1inč{c @A RI%::'YYkXƃ0\xsMdr`۶3cgO>u(fIӰNyJ5,Ct߮?0H2HnH*TXNR- h?JF 9b)Xᵭj|]$ RH%dFLh|1:$}'htIE$0КOo#CZN0AI&N%wO<#EI45ԒI$I$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$.-BZO$^@ τ9kkHHD@ײlŋݴ {䵰,i5Hi#ryycC Yik]u!iAuAcL @ה``0xKn*դqG7w+ poFn؍M7: qqi>?E1`7 f`Zv{+Aw:뢓/`n\g}H`<)+{]~FK?F6O~?Gޘ!tΟoOY0{]3@;w0X\ؖ}Ѩu` 'S M!@AR"S4o A^%$gy4_w^hakS cYquh{?V$s\ݮzOw?V)kB;v&\CvKIQ^=o'Q%9ُ}TeRpc6n],5Ch oOv7bm`-c^t{O3ֳGhZg?Sm/$# @i<*{==Em{ZEͭ;cML*P$Ǒo~~K7yIGV 3PhpxRwf0dJV;eO^뛴?kGu=0d'X89]˚00q?7?Sz"R:UnΏϮAE]Sihzkn~81$tq;nb3N@  diJ{Əo/ 9fAI 0-lz{,tL2 }Gx_x8l\z[^=Q2~w=ڛSk{Zl?oQsܙy'$vMvRz/;Zql$m[76zN} h<n-TUgx-C>U5W "pfKjŠ/#S̒!ہ=樵ۻ@x'"E:$aҿ~ `Zyߧq3]xk='1{DJ%WMNw7趘=ۛ5;ja\;b?!Z7)nfi:)Xꮘ.tmD^X?Ӑw,paи tlknt6֐L}/{gF-=Me` 2Lr&ZiОw64pa6&<=o(yc!ծ-ݷշMߘSMX$?چC찍FhbypY=Cl|N) =Gz.i5uh?׫*N==G@f^gA/M5v9):woR-;atsƪd @H Nk'i?c ;. oBesۜǻn#m7*xi-xtt[_ؙg?o`v{¹0 <s$%${mZH\vOSn{hk&םcZ[7K8h k5[isfd \:AcHGڒ h4 s?okibV ݷ_L:6Z~s-=kf {=J`N5"8Ci>bxђ";S٣HjNR`(li>RQSClykK6~fѪfPA;]s6+OBI\%v?~-1s ^v??=Pռ<^bHiOڜ Zu#YiRRO ]Kk0L5OKYS65ց K֙iĢY~C":g{E'% Ls@.{H;' >yP.b$[^vö>Fw`ZVʬkG ,9=]~pẐ B8/~Ӡ@c#XݣEl%0Ms/v"ǽAocK}b%;,t8|?VRKl 5Aԇ!Iv5r?w<!" HD;e=3%"l;8qico%S+x%viPc{wԭ,L]m p zVγ#[O)P3%E6HJJJ+76lnAWboUU`!d}&n>lB6[q6[E}kӫ?7m''8HДߤNt $x%,punj~zw?kFa~ng"%vՑ #i}$Z $:~N - | t:\w:`iӂH״?{ M̱Rw4?=޶:uȬ#f5qiuvM\bI$cvRL$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Ikt^,pY;-ه |JS "M>s6(Q[HY="н-TlS[ - >7Dõ]~'`1c<;/gyv5Fq]elMV-kQe c*eB ѺnSyچk}뫛 :wKqƽh;;z[bK@{b3uutEB\DR\늜K2wv[Ѳo浠ZI@Ȱv=!G=N"mh ڐU@s]D~<''͇p${ŚCWPū}spY.uyT9۟]&H/k>7_m w89@=2$R=kfOL H{|:'0#9_ z⻽kh'q'yiV_)]]7K٧_Kv_qC:Sϣpԟc,sdi>#P8L*p4ӯ)X26 H}"DTQuKu֕QZb~U%1ۙa#m;mŌ-k\[ޅsG?m6ָAll,64%j)70Z;Hiա_!KxsZ[Ob j 66?3rg]-=nuhvD9S$MknsX༏5:_LD[Wf9k53{BmVE.ka>Em5YL*6+gHvK~+z>ٸi8~8}Nǵ]@?Rs\=3y'RHﲛU#Qq2ǣu ˉC=wY(_Mmb ;yh^Z.q̥ͭM0 O}VՆ,q;],IZUx/!M«q]$)[cN-cmsNǰwTk4Mb.UKik w^PL.rZIVl1cFOچ'w͛Ai=ڒ?,qFkll'خ% h?8Sgz6ߣ~co ^-on2 owBI@O'vI4~i3c6$7>ͩ#}huDa iqkƷ!fQ>;^I-k}ޕ.jah=k vdoY4c{sg̊wY ȇwvqNqhFchHy.Ok)kuk=.gO: 9Lcnt ;a?MJFEY`v8Mmk=vWb}Pnk@yq(˽$sTG[]W1xjgj)5Y^ƻf6ֶdԫ a8~nO18ƿDA H!If1`sm?ڌZ+6.$476*`wZcDH${BJ~ԕ[.kooZ9# 4s{}<<">Gʭ^]=M4ӯXڅz@1&?k욄3?"~yoJ1~l/7oٱMNx[0}M5 .8[7p[~z4S=I Xqtz(@q!FSe}Ԑ+v7bdm}&2?«f`?gK_#Ԗu!H!M`6ȭ)=L~iqto[{wXND+K.<}h( ƻ[ 'W-aEt gv\?oKxiev_ٱT&w{҂FsEZ6ZDr=7tĐO / ᦿjH 6),ixq}m9<1syZ}gD;E@<6ߥ#w)RNXᾹnsEoVSnI%W魷')Z/-xl48|%=yvN&Ϋ/0IU*`@$7-Ǫ55չs%jԾ$W~򬦆ZPAʰ 8ª*rED$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I-Nn [tACo~*L%& N8]*Xu&~nV8D=ݏ?tSuu&>!sms |?j- hP)0t)w@zMmmh̀\cN?A3!J^!Cwg~tOgHHDʃ8AL_ד$pmu_Z$#I4cpQ i3:nh yɫs\aŤ:gJ@N@<X ӡ9 L?!]1!F~I9iKHCJ`c%w+TK7iѳ*_ n>&SEOysZgicHOqtR3Ν^Z{ǝĒ !5%ٸh;я)<= ^#Fh?RhD}!7k2G r@:F ;Ep1r TG ')Kʍΐ\wCnծWYuwa2FWߣC' C;edLwGu |‰s44[}{Naj=7;mE 6=ߤZV=x.06d`BKx)Ii[PS5p0H"A=[8w}3%hv ,/sc^\׽ߢxnsl$mmc۹pq-Y Jӡχ }nx# R< vi &X>򒐗%?68NE492g{Ѯ&Fۚ^qyJH2xHӒjq53){d ILMbEU $턙`Vt3{ELl!zovh6n֠;5YNx k^Pi.sZ}Q4ÌďIHKPۤLܟ=]L]  M5m&ѩn͵O{w[4Α9 cnH<5ߣ۩?Hj6<%D RRu+釱sc~叭Z{+>ӯn!ƃM,Okئ_[\ Cw]qE$ ց]}H[koh$4/Ŀwh?}C*tYcgL!G6#isL+̍6÷C?@X;>>ԭgIS'΀D %'NL%&a"l-yik61~zl[]õ|̺ζklq߹D78CǨk ]} ;ڞ-<`?- 'XUvQ2Z!ݒE\x7W2F2KnI{*԰2׼l7w#&~eZ۬.d3NB ~%GfGɀ;Z؂L{ضpqyA>7}'g{CfyIJ?XM%ߦfC 7axs@v1ob}d $~> F[ =54@$^J20\}?c{ՑIm,yHS!)۶ǵ,l6][W-ɰ=::S7T\wCKx?DU;۹Hs9ہlݨdjZ@Go~D m77g$:,,mF`7w{Mk^ؓM]@v#6kKQ Ek{1$x\-ph>OvCkZ?A}9 {=.Xf5K[_͍`9`c]gڕe f))-yOʊan~]okmjn>o!772,`tV~e蹒],Ávm?Ҧ84qD(<\~zi#]J\^.'a sefIw&nS& kƩ l[g!o{JeG8Ga6L"ndi: ^  e.[n?65m73xw?OMٌl%߼Ϣ?Rzhm,e$<omc[T`EI>2U4@#SrJm)e5=h=7 9X :Fm*񃋋 ݴgR`-oщצkxB5L-|4pwʾ<4,q?ѷ?}=ZZӹ-Hn̲ުd]U}%»\eÁ`~u[kq5{&_4I"4; 4'*pdOv *Q}mF}TiiZ#iI Sɩ6]O}?9iOqmgh\>o?q-sYSpK mgYE&>ƴ``$s˜l1{ٻ;}5\6\ѻ3 5Qmn[.?ٻӆ5\ZkXȘ!ᾣA-?lL 7n0#B,\p ݴ?RPvH=1Vfn33$#߿=6a-"3ǡݡdvMՓ.-ڧ&r{[TCh]9%6C "?~5kmA#ѿnA@-~ҩ%併h^zpoi $|qo2 1]%-c[[DhAt:Yw~=OA~ƵAl W +0 A]}O~.Z`sC߱0{G-i\֛]Ad:`n.Z nX?Xl}-$~:;=^N굻:Ke&{ܰ\ 5sSF:emk>kGˎI$nN'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$VuV> 0,sG²:G(8^kwhl"Un1,gtJ[ܲݿs@&Gc?Fms3}'W^Xʚ !ŧ?`HcXIcCc2 y?Xkte"4:7^v\0};{hedAڙ^?.{kA-#Zo?E6Ӭ1dHq&hkt=j#\k-CKOXZ+%>́v;c=kKukDq:U@Yݱ{AehHyɦyi'ݵ&RO˲ݥ8k6lZ5//v?ݵF]G!C mLOHxk XFc?=--:wAGꨃk528*nѸhxdASx>/SG:;'?"m%d9akn+K*_D=A-v8+Ѧ'Y]^\ de(ht'G0Ai 8#_&㺰l9oBv5ևd[;QŹ!iڶųgmG}mcVø D ~49#yATY/61űkAbh5:m"$~? ~U9ne}7Vvخ:W- eSMw'v k+I%ڇ;ݹ=DV "cv\G`kӡa_rh54^6?7P#1nppv[ʪ=Cqk~'lZ-?}o4UkSJɉAگ-=l~84:c4"[SZAhQ!ok`n |R\5Si`ko؉muί+r*TֹC{o,M+sw8;+wcw;YL&w3eci 6I#@)Yə>?ĐjN[ mvv[9 n;c7ko#~֟NƼ5ۦFK#kd>KZִou"C<q-v` Hi&m,0}{QpAX6;<Mk3kVf4P2Fѷm4g%?vgz674[:G`ZsmIZ踶[joBg]v2=KNgaߙWSŏPIvi#g=2m&Z@l55Me7 m42n"?H O!=i5@IA.mkȱޣ}?ՏI~S A]f~۾[m$t˶7V4Xj ~9dGgoth5_#/{P 8s칏i$@R{L XG BF1۶1꡻@5kaգ~O}:E1lߦ$<4:H-ݿ:+KOf~S}Pi\b9 Na0Ik5OsCDjwJg6aptm'w;v/$~墾6] _?M ]sØw}/KQ=1htaƚ}I*ڧB]>gS75ڍLOܒYdcX i~e/$ACY2FH ghwVv 4wا{sqDR6iӻ>J.dL0 B}nȰe?<)_ڟڬ͹zksZu>"M-m\_Zq$үދgӹOnRZF&I8AaKtnkcYk`e`NߴwU۵;6+;.msft>o|MڷzosKDmE≵5kOhO'Pa?(n :4TՇT{mhvWEdX\ߢvݵcF4١=~&@Hk'hnH5 yPFh}/ dv);0,sO{ >ֹ<ѱ*J#R,%FW'0ӌX=FênUă e;"0YÌ%]pfƆ1$H)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I-ouado$g!lH1 emlQmăC \,2;^@Uam!`YЀ>{?R}A:CE{"H $k*I3%Q)<OIHqhړw; MS8:qthQRHsCMuZN\.?y-Ώ$93">*+ai.$) }h1?I0=:LF59>㴓Oo(4Hs;(<$P)${mk1Y k4$_H;N%M̩-t̠*R H&c\xheKO|Rsۺ{?-sHHI+f8& >5Ssa.x(2t~RH%"}Os"gE}n58:Wdk'&al @~B52M!; ېeĎBA+{{'RsI"`4L~ 4F>sDhI'L?CdkcYe1RI$I$II$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$HUnc䟣 47Z5/9A/BW =ȉl_VrK/8^tppA\Vq~<~Wn#"] h|L>*&:8*57cC A# Z+1]!q;EgkVCl!4v?۹h֐ߡ齿$ִF~|v&{$/w2{-ݿWdY-töY_&v)\ Gwm'fVʃ/oxE S IHme̵ğa>[(ZhmbKH dn glI1H-?詶Y;;cD >kNOb0i!Yc,fAs]O%nc?;l,$ o=4SE N2_GhfHw˜28iHjy>sk}9?gF&%ʱ̴*g2~"o./`fI/5Nk&Z lO9M=O;P,vۢ\=! fѳ7^ma3b=VVg@~[, 2}@d@Qsw4nÿ$$= ̀ Zi?~ qF|DOk 7 Gs*5~clP[ \2;BU:ƒzM0cyJFq`k~Z=ƹ,n6و@Y.S5 ŕ M:u(&5'M|>hi"fF%%d.-hov/^?I*s C{]fEI]_ psIo?g6(: N q'9 5Dd.!}$^@C?=-??Dk\|% H&vS4!PRjj աKvnJT6!3&3zokYiKf?+k5qp~wUJKM~Q$/bրK3Skh9IKc 2}DG `ei&D.s ̴Ϧc,ᑻqOv}.N)#1iq>_sc6\'DMvh,t]l4KcRDKcC;ԘI CirI$ $I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Kwy`;[XK Lv&-WyJy>YU:"Jk` E0KDgn 'l9F{O/szPiʲWa6i H5HC\@ I?uP{XYƀg5Z]s/i?c?sKo uTݭ FL/}gN>á;&OF_s['.aL7p{ʴ`t"?4{|w[mm`Ѳ=ߤN1NCmO6!΀S}S[mOcHٷsZu3Ih="ɗv2=V,ˡZ mn"\?GJ ѓ .[f\iSM9 A?iHsqqe<1Ѩv~$.BIs\<ĕE[ #P>{?ڀ6\^ ls 7wF8%pcAXb[=_iv[m:I-.o?6zM峸?~rk\w0tIHNH@?I%k,vEmc\oZߡ]?iNQIEc}o~ >ָ/so Gh%O nj$V]5x[Cc IZ(zY$=ŕ[mm0u oo"^*ߎZinObo\_S\9^gԃ 톇;5"\ Fy;9! ]c- Ǩ4w;n3rfim m e{-oc"K5o-J{j۬ٽhtwޚC\8}`a?j 1Ӹ󿔢0ͬv|P[]T˛6WSL&^eٷnz~`yy=_"]m, }=7LVMYup\wzF A>ַ!Ԑx)KA_S;@塠}fM`c*[K' ZKyqH\sᬥq.>[ -r!FA۠._ĕV>3aC#__"{7Z 絿l&j!XnZ]TAai_IokLm<봉)0׋Zѧ#ؚB=W4qV#CC;~驒QKGqmN6=ׁ 6z+}$4 52r! ~ME˫YsqlcZCC GcEս3{w8VT tѵK+mŏs%6g(ϳ4ői}z9hu~Ym&3;rK-hӰC:ٹy|O&}vo+[YKx+l\WaCq!c{"<te$I9I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I-_n8YKWTak~4:b2y(0^c^yA LtzH TM N?Xv y-:xF :lW<0~dyӯTcAII5ݱN#͑̍ EJHk)";@גB- ș(RcL8*-ԃ @)a:Q<;ܜT6Aw]3+7>֒gHCwR{eun 'r>;ο+ %"2:3ra$\6˜nip@P/%Iڍ?8{6Z![;& ԔNi Ԓ~ʁq>hS@=yeIr푯 :k:%Yf"ZGvSmE ;$tLO L55!6>4?=lO֣Ww3 J@cD J縴yAs==TP xOI;3 N'l78MkÀv7~Hk ]ln3$v %,熏va>$@&OdeGcc8ϗ@ޒ?JÜ7k$}+++J% "Ot:9q7n|H"KFצI-0)Z1:DLwx{LCaDT+ ;+k]%E6;q-{$@hNH4 m㠃0ʃ>l|=3h/]lmM l̑E$LOmM. 0'84e~_ 6%Zo&IdGHYN$ ܟ5Xp3h񵠘?5'\$~MQ䜤57>Ө: HʖݰA%yjr"$RI$ۻkIZ gR Hh>V8Mh;BM\D1$ #OlN/ w0:GJJRI *%t1=ocTִHAğwP*Ԙ4O}S !.p8 %OP}O >Vُ=%%[DyUTO$_JemHt~N;OakRU8TL]B7pr۝(ƒ6{ݸ $eԗ:u'ژTDBvԎ5qP57i15Ot$okca?H?/p`+u4eD8;Qaoԝyf0 ~{kVږSq O"3rb!ǝvuJ#tp,hspQVIcP'ywINu \8Vf779ĝuPÚwIYHVNn[ܬyyGUI$I$*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Sk f6ztnLW4] MbbW9=GZ[gE~\K.uY 聬u1p``t\<{L{(uh9COE3ȴnh(w@KGoZheCv-hpF iHw^]Ҭ8c?Sn+ d:[^c}G]Gܺtōh7? }#0xQe~MTV۟S3!Y\;J̥è^lp?ggÊl'KuSM>>o[Ӿh{q',çiHJܺ>L\yZY9]10 賱\]mmO)dtfb˞?y.^s1zk^8$?g|'ž{Qƫ 'LԬ2^@>SFHxplo{9# 74 쏡Tt[",kZ ZL5f#??ekZ6(xӜ+pkC#,bԵqE'X%2v6T:S,Yl-h ڧ7 5SUlil~k+7d㸽%HOܯ\aWw?Y@R5՛~Y{t:!/YܶkarnC͹`NaWH*ǹSNk@ kΣOV2z&=َ̌h x`"vܱ[ u/Wk[l2ϢGU\l E*3su]Hw5r?=Pp~c>͂n|~}.t+fSAd/M \' Zv3cNZmc[ =;!ugiX7ћht/PS0ݔ[Y;Ap? +s_c %+f=PE_0}kn]h}PkKcMaQoXu@w ?m磷T{LM>ֈFd{7UU} ?k4d |1e}0j0(>񬏧d@Nu^ՠO_&V۬`qh"Ij}26('&2 ?Ej=Pk}fxǘnC-aq3+_b4 4qw%rEfHafhG*6#S^OOSF5mDY1 L8\q?MvtOp Yd33!d4t܏2Q;K 0q˭0?joZyhk;\G!m?_$B ͳ7JF}L¯*pP!auF:}5b˟ŦI-/_gѱz%tdJ}eTᑸ vZYS; 4 {w jwWcܐPl{ DJ>5L6[ Kq c@HjHu<+Nfu>w$W_չi}aw|b?ySC Hϸtn<$Y_Oh.'~\#.W؈;kDOptQZ^NuVm<aQ[4- NKL!SvoW$~Uk/~gtoE^Ν\8Ǐh9tcq%b?=}U^]ly ݠ7r=94' 4:: n/:~k\tԉ#U2:FCtĨ_ҭeYf3kiU5NG@yG?N_*ϮgKh_bܭπr(`46d}C'>ˋkym6{+#18TC%CM{1%@~ Ձk}^w#ЧVk^+:hu:ۙ}n;{' 71 9y,m>/Q퍠-PS\Rq\{G}U[ϋoљIo=AUc``~rm[ǧȟ)!E̺=ti\T位>[5jŪX[@t ֿM=-iH!=jtn;{}UTII$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%}FĴI&kg"5 βaS2|=,1BxZ SshܕK_N& -1)4$5mT95stL4vqbgYc80#[)y.ha `iFz@-t eŮ[3qL6$UX4hi~, bʶ.$m=eMfhiOfV-`ԟsf'UF&$´vdG8sֆ_=iӟCn1_7G^\; XX ziynև<: kQ Lg6+ 5RYNQ:N5#ii:i4րmqpѬЩ%S S4iouWaVi.-=O]z){I-m*ls[Z۫FLEWv$;O?%'X Jfݳ~b- ,hLJ=ȫvw>PAa~ogm0lth[V ~asm's K5}n.r^ $Ds4q$DZ9%0sƐ^!a~ǷU(S[Ʊ0~uHq~~X Ycϋ?SSk~ӸcDzhHrY~sBL NFDzx"sgK],n"?E#6-G5msqB׸AʁnCeY.$lM&k:|ޣy]$N.ҷA ?IE8XᕸlPzϱIԌzٴ=Wk%2dZӱָFFϥggO e:Yp ogIͺCnBev6P'wEѵYO\夑W hc*o{v-g;w*6=ϲ% uG_cCoi]>>KqY{֑k}ߡbj i$&pA٣h.+ḳcf̏幉V*u:ð,F!5qG~?=W *&kD{RM˝ #Wb@sA9M  Hr{%,iWVW7um-{ y'~Da`eoYmq;zJ5eCAvNql" f"uS{Lǃ5D$u"15!q"["Kl5ؐϭ!Sm9ی9;^ߩ\ښ, -ohe7e?k]#>wW~* lw=Mhx'IޓQ1/ukIײ[+!X6+ǩh{\K I=Aec*Qv1,(׍qYeKypL^c w $H1?&9& O( RHOSl9ךmtX-$l?Den} !Z?*1}oy80h 7lm05#{wAs!=Ė1z%ǀ2y7f.o碑4 q346[ꭵHd}_Kh檫RIu{o>_E7eRZg_n7g]ioē_)Ȧ&f0쬼<lڒH{C ljA{6o3{_>k'"ݭ`Gusw([+sXۋ?NQ--q[? 6q۠=u>H'B>l I ؃  k>!-޳`'_=4|s} i^68VI 784}&/Iua`3?D@SWV83Xׂd~]8YK/56ep>(uwdX! サV+E95G>~c2)Ok]wTm: Fg]`!s{ !5[x- >QƮ_/@<{?;e,uޠ7ZWofiHFamz|G7z`&~hϞ-g; LP|#I$I$$I$I)I$I$JRI$I$I$I$$Iea氂YT̞nJL:& ;{Plyʴk{ IKuc薙琥{WI)[6.y[{R\ # SSTY camĞw{Ii<:5L%24L<*.sCgM+jk^Y9~ư=HX <ǀޒT3)z⦰uC4 hnO<ӴҒI)hI8H>JV8O;C%Mտh;, ~xIJЧI(a4i.ihvKe;\fx?1h6A4QJIw#<]cPh: q{o?JA@j5sB X҄Z4i \]3Ri{I%wm"Ϗ"6 Ɖh8Q>i3uu6`̎9f1jdzmL}'KY j͆?y ( 1Q' ؂xpI #B?3*,Gܙ'>RRt)Rh3ickZZ0OGk7?w$ wA 8I.4De.'Yc#Qcpcpq#I6=\C(8Cܒ'$gQ_ Ww@FL 4P2@ >dIw>S hO {jiNQms.s' fn)ݾv {c]SxLt";L7$@f_ai.| t`k^8zN 4/%1x9OEȭ.q6scCK`"Llגc$yN I@H&t{,"$H {~8 ?oR$DwQ,l9rGO:]ɹڴ@[ꈐ"hIJ8 Hh!F[.C0;7^H  $)RA!ӨDΰ8=$08K4h#jL{R)۠N z#走%Q)rv<6T}4} JS)8=g"kI.%ORQ](8NöƠ:)]#@s}j|i.:3I]2t0P.ądI$I$jI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$k^s |\?8 hQ{7q=yv_j+ huhCoU2fsDé7f؞6 pGu56ݛpz]ruҺ6aTݬhR%NuaḌ9P-T}x3ǻ,n{FM-gbS~NDz??(8d\ yj oj{T~N=ktH%Wm$&X ,l5Rxe+i )JUybdXt$s8Ļ~Y:x_ږGg8'ȖP'r6Pr'P6USn#Eڀ[/7~A$jskQΝJ!7$'_)?ߊa =TcONmʹkj'R`0nA,z!QudS6)6A4]6 A;?x=vWVH7b&~Pٻ4.эH5G{ix۷i| lɣYCu2%Us&%ĩn>OneW7$F_렁)3-kA>>nUf5B߆},{,:;I"=9;wYa]8J1-.%xQgĈ(qe` HEsr7R >J ~MG$ uZH[aFc0K25V%U]>7ǴƛSsN8!;HQ;)ۮ0_ԘMp@se}y!dt,ݫDu8l;t(z{SU'wNMY{-n5[TȘ:)T̽?1!VOK"{}IVro mV@VE+ui~VXSluON,S> q%*k=ZG hSmLC,}욱P_oWmT];nwXg GQ'KPDzzv_9줲~EϮ{?sbz{NK]$olO${hTuH1CYh}m=Aߺ&јE4Pƶ׊l0YcKYƱPsA?(5xXѽjmc7XRR g5?WC\,}͑??7br|` ) wNH?/+9-acv*6lV)T}>\?j1\~crs|u-\ TO[6q?Go&]H䏤[.8bX(:+>LbNiynj`s`Y'A˛G MuRW[ Uާ- 3GaE߫n<릱w+om^h6}YV0i.$1]GH'j*wڋGwKe!ٳtTLȭ 6/>3ٚ}}m IuZysj7SohcF;rKw~ vL޻>tHOG6}} )Mq ;78W&LC4Ǣ~{ꡌ E1 t~j}#lYQ.o;IUp`Y30 v^Wۏ4>VAwE7ҽwm'j I)I;gm-mlDtwrLL6NI>feXpotR5jhi?\uEcұm7ӍdD<oǺ+KnؕM Eu?ғ~ܟɸ}8V On̥_U1y}}tߠif"X`9MT }8W*ͨP],c[GoN0o Y{M7@BjoݨAub&|qC5@?(7@`{Y[k6ʠLb5nꨆeQts@ 6Zۏ.5OJHIiq\´ 6Ƨv%ـ܍m`uǟhnq9/vU7'&ZXci˱d!CgPu5<}W1V@SI$X$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]_rƗIq:7EN. 4%>RbNa]u@6ȵ_YExWUhJfv`&Ƹk;lkKIT K Hoxnj#us^ѿ&=49p'2OZ84KQX᧙)4cC<h` 9Z8#s:5_HZqD7'mJix ;ww(&2;-wڃ( mޣ?=bc ;I>؏zq[,#DK(q.. .#LK up:AmqkMcD]]mO?}l\^Lsl \Y~@Yh u[۷<@{Ca;薴w?Ԝ`L$h}a6MqkϷ˞:nq -/,ZA;Z'F ᱤ ~nh lQ.,19ԠibvĒƷ<1#Ek[ ڴ_Uί!h?Q9 kgw3}mkƦH$բ=3BcQ(;Ia|(̣{ n(T>Z֖llJ ׎ Y4_OCZ^.g/ U_llҪ&O?L9sb-I27_DHen.qn("sXhk ZCmi7>VymX=@6罿(mu-cD9w{Uέ՛knilo= ج΃jgYLJ?):#p@+= w#bJk6mOT=6Iq;oMn}ܗ /VenݥH'Qµ5F=鿜N5k1y;w@iHPv;As4'%h5TQƹeiڍ mVDn2m{?eiI8XI X+3ƨ Kl>ߧs?m7D(R+lsSFOGCOoXI`{?;>2]uK lZ8bUNM%^0`wS)ۿka; oo- :68n]I ^sП}h9=h Zj076wڇB]齅8.>~;Ѷ[D{g-=[Hnp%ld[?G5 n8cHAA?,֐AqEKդA:4D}Pu6͚:~-W\MUk"^?YH610d;bSi$XoFw^g0ikۏ*D6@AhOl} H!ScZ>zn]EuvRCϸelO)쫬iq5g3ҨZ}rvi|F40T@%sD8 hvccZa--Il'轿U]:dž~u>R?Kco5YvhuieC.;ItB;El)4SuKKOTjavht%tU 6w>DϴӷFI߶7_o98ׇ47;td{@{~bvo~|?#kdAO*58dqJ hu%ϣmNn隣e Owb2*4l1F}67+mn:bZ Zkk{7R! _.s\D2riH?iU-uY?z_Mg썿lzw]~V=q$__ew[ g~r/i0We4 v}iB.4<<+I$I$$I$I)I$I$JRI$I$I$I$$I-{>g-ϫQ#&#Rb1Z%6dKs\^5;By!m:'= T)JiJ㼸 q2`b)n;,L;CGIACXHx8;}.\H4H)DB_e-׀~ . *UdtD6=ڝr^jc\R`Omv;41۠hưp/W BEDǚ}eb@&msL;@m/rm-hb4I)<; zn$|AZ[2u1,%Q$;l.?=8;me\] |?95o8/RShPvL^]1L ywf;kI9좕iNmH݁, cI[Xbc7S;L28wu&y@Ɏ3HDF`L%=nc 8i3=$EKsH꜀tH4 4;B@J.f$<bq{K; v֤)&(Kak[$;H{$$H IM_43Ɛu:9bt|Qii.C%3 : nNK G?GcB1Rny ohK gZk]d@?h)U;yNtKB/w<̝H'Oթlдg'xCh IKZ?*,&~?jB QE~~Ĕ&p-tMX %3q<\T fOn߼]DϒEX FRR< rٟ$t2LKO'R|8 Y9'RI:KX]Jdc IB(gҔI$I $I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I;bDc8 ݵrOk a94:BEYcYpnc1-a-)sC UnaOZaԑ#Y$~иZk]'(Ǫ_oum~h{+Ͷ kuxȺׇw'd}6Є7Z-\|zỻ@7C{kT8~*u174Ӓy'k}68{5?ز/^Zi0Pu>n{=\sFpZt%xqq@?^CXAOM5>u18nԂ }[F=ɍ{ls-2u O<'5;ٷAgڔpfnPn%OeZ A'PlK,鶉p:I*Y]^"5,2c6cmtozSQes>RѝK[\\:իA $cO$ʷGIJXοu=&I%dws^3.F4KApF7u -cOڅ,ޭ!:p yvSu oi5HlB&gU]pƓ?~F#";~n}dR;-24Qv#s/f i;Թ-:a ?}2{T9S@#G )ikON2s/WVr5vLU[U{ZYp1^l{OjCu?5N 5_ŹYe%\/hV;o0KH~E1zF'IeOg5I\9l:?5!ZcۿoYҾpq-Rdg{qq|nk![)%ԁH GN?_0?xSꋽ'ghq @kzFPqC2ao1| tjT!*N~;FK+FDöH.q2A;-ϒƓzN^🞨 涾(qDwŲ XLwYh%FtxiqO2ܭ7ͭ,W Xs[[Oll&zm- $8 9V@;mggUOl0 ISFikA8CgK9i/tGunA6l'@oLE$͂KH?pUWbeoW¬_i+Dq S5x.Dԡz)(̪:K3E^w*BIK @ 26+okkNߥ  *[面#~յpfcOT벆Q05stN]ͩ nnnms~rއKov*f@NЎ!+!IEZMQZwO2U\vV$FGCWSk&uU&tqZe2Av\y0)܊[`'O1yglN ,e-&=.cYYHҸl{`Ө`}b鵺өpN[-Ch=`Zz!s tqov2^+x-i\I$I0NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I' +hsäK4lޱy~) yqhqg<+YeuF<!zch1SAQ^֚~NH -0AtO>۶T.jY ˎg*hpnݍg[lC6yC0 2`[zMiqlFe&Ct\Ps `x%&v$~>ƵH.I;£^+,uI 6zMtf\ʝasA{7P~M7d:lt$k\w2Ü $6yqyXwFK"k $s?mcG7qp$c>X4=2=ϹvF5k~?-}V+$1i=T2lmI'[a8.f4A?sCw#}RIwտEL\77U95k#ړ,sloH-@d;uEZ˶6+1`m1>+i"͏}c,ZL>[0;gk u&God9~!~qIW{2=͟bvv\}IؙNlG;Aphe/۫ F"O3sC9ӯi쥫G}])zpZǏ$M.|{vيV[6.tOw-Ԏڙ;B k?CnLǼ=:۹!@~tVd826Ru 4A\ B1\$NLΰVVx|bR>5mC^l|psI ؓZ}SZ?&Zkr(˵Xqk%ɝ|?"Ti5YeFcIK?) m}=2DYb,//Sf kwb~IYkSHq kոÄ$G%Fy3hkJ |{q::uacǽoD\Z{ o`gJXӴ {}!< Z]$<9lI-?ApKi~ iyAJDx$F?,ִZ+9n{luvΒ~=2eC!l6zAB=vO۳ӵD鶳n`}ѱ .hO'=ϢʕMs],p8$l7Yx4}7?o~Qsُq/XhQTاM~\ K}3bUXգ[\;tvLf>C^-`,.p0|,HF2 5jm/k6?s=B]q}Nߣn7o/D",. ?>;P0;[?wV'k7:{[[t'c>C6R*t~s@3_䤣 ֊-hAmiFR2jsX1O־6 \_:{S7ٓ~ s@F-FmTCNp[Orgֵ圗A<JC:<Ƥ5l{i=KgOQ-YM h,s3vӎYk7ċ7񊽯i!:2}ޭCf[ ` ߻ZٴebAYFh@&9.V>Ugg\Yk,6e,.hxdTݻvz]>Xc\^,- cs\mIܦ;C 1 G<9E!Sc <kIAkPݹoBҿ{!a'nZzy~,^Io!KWT~w &5ﭰ7Ƨ#($HkJqvŤ#cOΡU K#K蹰u{O(^}8=n`$1ƽ4>QRZ"9$ 4mq1;I7?~z7s8 5{l.ױ1YyVV88i=j ݌ N˷;7ԟ&F1i{FShP!؍sƷ~zmٱZ~ILn> sZOgP{j=\6\ g8jDvM6q{,ُtCގ߲ Ffl(a;OiK23t蛧b{#TQ~8kVKSfU,`5{X̖]K`ݷkmu;>uoqק}i{h!འ 1=y$V(8o(]*ѽ۠h{L,>Tv]n$]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$Il{\Ad-[^KA=$eر/О 4MS;5@R'vQH'Ln?mDq>ptϙivn3ۗ ,L$&|/Ly~rP Q Z֝p 1n\(IF 5KFS>`JUﰀDh)SA@xh!)ew#+6A7|}ɷ8[(4!$$)J!=;hx3?Tku}!5&NQJ黦xNLv? ϋQn5$$DI!Pm?:?4{FIO[Y{`OA" ƣw4?Cra d(V1A$&iv2C`1Đ6]ϴjE{B/IBb$Bf44m5l@a56X t% F&觶iF.9xHL)YPy{j&0mp4)m l3_d>i%pg$Re$87SRxz`@|}>bw`v )i<(4N4DuSkGmO`4; !O=ͩ夥N&А|f7!-&e4i)<nLqPl%bIKLHH'`_gjO&L?J@vn3 C?RI=Bv5t9;p$:-EK}(<)JI"1Cc^XQ.cۯ<C78 5M晧I* cdG?k $Xk2\b|ړi; @.?Rb):O'IInk#h'&ɂ4#Cɚ9tGȖj׷ДLƒ,4 `.d@Sskp<NڬFI_pSn/#q#RAy 9emh8Ly䔛S{H$ȔL.Gi v@ЍQs4x>(X$'?FZ@i t}69hO SD:S) ΚkݿLArx-!7@G(q!ݾ.?rHXxK -vsKKZso l4fyh^A+#Y)?b\AFؤI-q l73BƗ{$}tu褅 Jo S{4Kq.Hqt'N~ѷP{I.@R e!@m(2p ('S3NixcI<I8$$diJP/7s׍#WAy:\ץtIE$ARI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ Jt]CeiE/@eItV+7V`%~lѮki,i:WBLhN͎qE;dO"5B#QhZAH{?u7$؉c45q' o-TĹ";;o=5- %'f{~ ֶ@lJIHl~.p2Yg?}Gleq>ùSqxnicZㇹfs=sd i0;mFn$x>[mD'c%6ƗŭI~vYU68:5!dZ90]71l$eoAđ,Q {<<uL{""xڜV\=5?9%6ևma. ~m [ #PPoݻ-߷76ɮ=0ָU?J6TĎv(gR$cQ'H)596Ɖv$_^= `o}1 kq/kKk1'=@A?M w ɒ`7^|"7n{fT·7!Z%-tojNk=V)  ~~_Zq/hFA[nǨN֘ƣzOla=1>I)u L8þMl%vi5 nvF5W|68}"Ncݷ=Zqsnc@hphe*3騵3s&ӣH<8h9@클ng ,5E`7tmcIձI5 ?'Q׵6% #?6VXvqPGߔc̎ S^5~6$̺̆65׵wԬ9׸muq,ippvfQRYsw]$;kGX{(s ƠL移w9ڍ;0 {SFӯv<S3"$Z\"i\w^Qб4kВ= =XAJzϺę[ݠӈBncN&#> z@꒖&?т\aۃ#Z}7Տ[.aw5?`{Q=X8pW4:C~gOZډ-T>&9)쬺Dk(MD΃%6ܖ ōnUoQUp%O=(cd]ݦL6Gj\[?۹5k0?S,;<)CcXILeV+OC= =΀=`N/B7 g.njud@Aߝ@dLi1: Z֒ 2[$.ڞN`}~)|Hh6?%Z ݒ=?j@߿,}p6Mס~ n'=SU ],H g{q{yi}.nK5?MI?G3 9s`;xɃ]Okn'SAL[UN{^nFZ@ճMnpqsw W3 @s=oسCdsKD ĀI<qQf Kc'{kւ[EoܱEYtƧ-kjhp%c?%NCE)FFs)=I1Qxk-$ڎ?2xNp=wnϦk}_譯偼mjt1-߫Q6nD rL #)!8xNֵI)))#*q}o[],GR(m.;C- ݮq?[Yּ88dihm{qYNCAQ􌘄7}immo3FU q]6?۳ eחiog7?z͊c*<4pv:͍!]pÎR ;%|DZuΥ꛹$];kސx{R i~c_ >iGZ~D9ĉHF)L t?~6Ϸ[+hߨi0R~A=W!9|L)l#=$t=S`U^ז07r^8' q~2 _oNPn<{C#AVGֆYc{uӏo"{_V[S]`W5ݜG+~^s:~}.: ;i>'fvzE!.I)X$$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$p#; @%w +-ڶuK:Sf=oa'A,: Fsn{tV6ip<`nZ6<}$ $jT_\k4! NhUǩl:]C) Y&+-Ck1`D{}f1hȤL{<:wV6,\DΜ)X +'@yLD$,րZ`b ofSc2vǸٽB#%֒K@[s juָٰpϱުbٓsk۹~0?!s"d!'?7g3Xč?Q߁M$m2ʍ-oAYѺ4l\?h]}njZrF.%Wn,~#A>9E?aM1m.0}w'hqhihkR>ͮn1:i#3$]Nve`|9=F{>q{G+2}Eٔ^۾;n?k_chn7E 6ywIi9ath=cv9{Ke6}@k ѣK.q絟?3 79NFОu^6k7 u2tp#Lh*2y 875McH:?=CJ;6ڱİ7te^Ǹ+UYgms[Ap-C?sȀ9sFO؇[^O19Ke2DlxGklјk 'ؖ 2dn#q-`~J}sYDd_g}Dǹ1k';۵A?`uRWq?_ScC6&!_!)9$']n&Q$!&MKMͬGW(dgu??064806ѳg0P7ҳ!s+0F[S?ya` Gz`@};;lqim͍֒h0}͏4n"op~/m;n\ZKM$~k e,h}I/Ծ`ϵŌ%ݵ<;^i40iH'W"]2R=m#ڦlii:fP[}zkpg?ߘhkKi2}6jd{@ 7fEn-kwI捤vT;qsOcH'mI&c``k->~}OmzQH;Ok4= M?yT56X4k -s!đW}78s=~ᣟ79ѣ'}eT :~}czEmZK}mCv;M?͐tCG i.~Ko= c6 IJtu4U^0fy-hƪ^Zƶ{ZWހv09Ŏo?ΠfZӱl gmsŢ+-nvΰ6#hѽks}@sG?MqpD?(Iii&&c)] !'RP?<5>~jxck\XNOks(Zۚ_Asg秶sj plvÚm I)cwM OPs}&tlj\?G0]>?zce 2CW-;f~ ak'sK5{}X-T%?(uDpϱOm.0֐H$<i y;Mݜ\v[q(mqr NߢFwOգöI$<&zXe3r;괖`u{ia| x& [Բ)X%ā3lq$i{l/h=3hD#K6}/~g-}o I$I$$I$I)I$I$JRI$I$I$I$$I}u'?* [o$?]LS,;LGNոi:ˋbAh)@I"DLp;w5=裲1&'㸈 J.YDi1kH=('m*w`qЉ}$T?}q,h%pEά $*6l;iBN<x@KGGޘ6JF4lak[EŰgC^ר]V3 UwL8ZTmkaΓ31 i9;];)0v?>C../b[" 8%yLlJDA2> )F%c YۻNTZ]̯tV{=dx70#JP3OvIP ̑ʅuǸZtl@~8&wt6ƴA"8g6vy~&O$9"Oapm` ,9»7 GT.獠LΌA;Rj #_%'" 4?Rơ$?J!DIJHL)D۠%7n,lzL!+i_Iհ-v$OI/ uL^Ɠd;)i%㢐uJkvk̺_IJtę0kbU`yJ?׹JHyqk?4Eu;1A-q%Vi4q✾ }E~Iit6i6hh,;Sn^b&vrN!T:v 'WϷ%9w?)ݱVv$xbr-':{+GFx'Bq:CTs65 Ozz $<DpkCݷh!ݽAd7P҂-i):7ݓ) #79?& k\] A;hr۔)aΟR (GGI$$ARI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$%^q[  ~pLqao#Pl /VEbj'sU淗AycWDuX9 .+-'E96457<멟Nn^e}0$xx ܋j-ZcXu*ޘűa-?'qlg6۠ݧi]~&Lskbݘ% i_Ӻ\]?r˶..kNcHhu7C?Iő`wS_[gXC&1 ?=ld aP?K6F`?ShE#nn;!GEc'7ܩ`DnQ>~oW壟Zb&DߧgtBNK.qqy?- 5{D)>m~;VV5\r xAyT/\[y9.SWFc.'pwPoM2$ɍO[Vxx;kV:;sjn#p?]c'U~2q syNUޥ{z~8kp H:ca /=auX Vj~Aμw7ov6e1ƒ=PV_T,QM\gCIM"DNp6Z־H.u~*W}]n5espݩݽͭ^6ǁo&u*ۣ`~;&Up w`*Fu-ђ4?Zikt##)^#f4.?j2|6i ?~uwTh<AHrF=  B/T 0nJ7e[{ b5K+pmh_T7׸@$o@3MJ~lZN]kq5HyT{kq^݃Fb 8 /QßRNf__@Ii n!Si:ZѦ?ڷra&}J|rèGUzUvCa l,o}vNDK2;<~oFENSzKh(K wwVwG.z:lcZ@~OoRǁ]uc n@lÕ`.cy]X;+M%gY(h5=Tٽ&elZ .rWռZYuΤˏ-G492/eeoG4DNU@#Ur-4whYL]^{MOj8)<ƚ#.{e4CD IhQڅiNtZ f}Z?թm&K sq>̖n'W#, Yk֤UVp s} wS;ձ #X32%5`=ahtJc`B̹w+ }%sEtUfKw41#.[9ȧέ."BU]feƀ7Y]zs`-w~͟F3I_ܗL=tЫٽ]awE_vIHc7 {8jvQ!K8'PᱦM Uԛ}}_zp[/68 ?OUajt>mM߀*uFC #E]ղeĆ ~AXo.κ p ^qA̟OpsG~Y? D\h`οrݷnYPO=Y.&#[OxӟJ$a :j8 pZqN}VhRl>n.:y-&e븐"#^A!&LA婉*i"34ư0'͜x>kg ky13{[Fo'(`xdxBO @ZXld_ݤo&C.-d=VWkrY$R7zX8.)7 d=E&u;֯McKKN!]I '͌ I$II$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Iz7Q8,c$^t5@K~(AVX]ͮRZYlo깾'V+u=Q jqr$?Cla3TËsA7T.ӕnExhansr,f[ p\oHXZF:K@Y!k!° <=߽ѯKiGvhl't5Z{ZB}^aqsg?8Z.kAvO:7Vߦϡ-*cvLtk="sA>{=YK?XU.`vG 1z詃sD;u: IptvMem3'{"ݳG(5fe\[3sMm-m+ׇ _Ůpc?B M6S6`-0L䡖2p<}RV5 ~?Q.ѣ }M6179="Y/Xq{@ v=WJ^X=IjDFA $!5 $}ß_"uo`JVOk-ʝonr=4=5{~khxh{"mgbf{^}{7nߙz\Toゥc _ L`.!@1gtoy-Ԃ6S+wN5?{*qmCxe"wms?J3wu])KwT slh﬷ko{>ڟI ߼qLJcGV״@o @u$}W6FƏXTlut@ ޫW]#qsn?AOeZsHcdzR=NI{~b-/iΰQSָq!A[ 1:"7ֵ7ض̊,cnQ}\,em.? 7۵l+H`xoSX VZD~m`HVSBJ&b6'vݯo40 n;s[Sx.ocwH??[^a^x2ogKɃA[wNq"}0vDI=ݳ~%jl5hel1 cA O7*%Xk[W֊܊1*p^,]W1W{FSu5cG0j6Jx-I5O}K!K `2}ӹ_w~i˿6Xk{o?~Չ2 $XYEMq9mi>J=~gh͈ \T7zִ8`[$כ+sND)QunmFI@VnvK,'wk!FOѽ/m9hնj}OeLıױ{Y @dn9WPo-,DnR}&Z=t4)2ǂ5^quh= ^],d]n!t9?oZ :s%6YuKipnNyU[}ǠVv:A#>Qaˁ?u \ \@#3v;IY=Nƀ {LC-#mainzϦ}N Kď_{Z̻Z׸ &L]s@^evV60W1iXu2>9@$.c榏sx)+ǰ.q6tٷ7۽Uqȷ%= e ksA׍V$VswշmjVhsw3ۜmђc7`o3ah/ >Ƥcjή~xmn-u9Ikl@v8?HF6}+ج7-i ?loz ÃyK=̙'"[qvLII,kՄI>nE5EcC/d~kCoo6!w.ݾ1'6W`fۻsS.Ǵ@ 7hCׅ0Ys?贘JsYuaАzIp./~fZms:7qkD =68,?ns/k/,x= 01mb<}6Y2t9ijMI$I$$I$I)I$I$JRI$I$I$I$$Ir%bЭpk&%.Itl /!'U'mN5= DH49-=J'TJ.0 N"[;A,0NZs`I 9ۋAi.Cr&ni2@Ԥ$NJA>78>NǓ]4Yc 1IKL ğXvy:h>D˿60 )wdɛYlwڝ9oKJ~%ݒ>#X#B&'On%S"}3`sAqqB/-0~ R۞3JUNRRsCwc)ARݵkG硵 9ޓO@i*vk IKE p~l$׆0m#'mM.!D.COǎ$\(&O :xFao?bI cS[=G6XwAK5`Lknkj.cd< $e)4n4ᾣc.KKW&4@(644[YcpV,?M$NwK>8ˏވC @3 L;&a J@'[Y#CEK m1'TdA G~E)f<%)ԃ.Aҕ {NNI?S>?D2Mb{@:0~H.߀ܑIkF(Xjk$sHN'E: i1aVu.rsxkxᬟZkpf)1I0< "(6lR N$\ݬ~q(y O$&#Hs%dH(s x$z[A |LIhsv{ 0>:$&|Dwk!;=65$#hulti')>6EdpOVKZЂr''cJ-u i#{i͍dǺ㦎D,EnIKH:Xc)H$̝dwAݶá4;Z6ɐL;rֿw84kSz*gAGݺ#Zc/ceKt1>\ p>' L {wpIK Nx&Shp (1-3>}/멐ѫ<ΟPkHit!%R{HRH$|GbJZI( )Twgh?j}70`OoA C\5''m6Z(RVp#OZ>) 5N{uDHgJO.o#C ̈́$O{E$N\ͻ[!~+xat0'q~(=QRt$H9JI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$N +]x2׷6.5vƿ40 FBtwX{lk3#Ml, 2d =?PGpt_H$|5Y>yɰtkE ԁ"E^]yVϻһcqjVHqͭ'uj]hȤ8#rʪt&]}JJVSI,x&q x~T u~9݁«]זA?}=կV@xU)>- [75/hGBGw+_da^`xY%C05ì|_M 2?Dj;4i]=1E+8R:~pUz^ţG~ꯑӿğHtBTꗛ(`~@~iVz~9?P5SZ5c-["d'yߴQ:#_#_[z0a݀=~;춂LOduGoU|P~{ 'y["\Io* @`Ji-1LljcTzɘ5pΚ5Ñg٪;G?=9xkɧ=Tb=S%(5*7: 'I%CRzḀӬv=mh=(6LlsN2X.W۸V:ViaǸIAZOOM1xʨ'UgQhԬR1/ğ {G'|;ۓW7 07X:%K^^S4ұwlM5LXy4|: Ԇ5VBF僸ղhƧ`#@NFDwq䁬WǼ}@̰L]Z#GcN;$P]Ԯ-.I<q0(/OQN9Ȱ3>R낻XfԲF B>t#T4)`ƪ#XM^"8P¥O6n[ݮGɺM`75SYDߐzU{/΢Ps1gd F^K+5s?$~%szC!"{EŸjq!lH sou Z]EoҰiGN#1E9=)KkE­ ; [Yqݻ(G!׿ЧP4 DOR&VE]/mb 4y5u:K,J,M`Va빎Vom;^~gI.F|NzNp:hUMKƻ?td 9'+/Ke N?5:v $ w0Ӧe1'lXXw*{UNti _&>tiY&7?Ԕu kFѺA`YcST[өԍ緉"d߿ζdHP2靳 qE Zsz6r< Z F"R .iA~?TYZHTkOOsE:>'GM 3#:^K.8Dֺ)Ν)|\bY[xs>bgCB|E^dt=ߤ~ղEMeR;Wb:~1sϺ$1V'!%1RjZ0hpOٯiAN]8vHx¨QI<|u,^w*=+-}o켧)qV:'%ԐcD%5; r;v]CZ^Rsu 27ʅ6EPF̀ :QW~~c =S깡 £_,d=*ei%b 0}k>{P2q 6l qo"ϱP+a$k#:v9'R`z]^t?-v~@ǫVN\0i i[Hr2]h-|Lz|xUU9ʾQ3ZܺQ+9,@G\cAmg_*+'7;|x *l`]2g-[ǶbqϴO+m̒85[nΓ.z5/̲d Ƴ9S;F><]?H6c?h56}S7 nJo Y kq+jP/P|ART#YhuLk?Pa=|q*gON %2O{ߧgwn607R\>ǖXƹ?HKHLѺ yi k$~O{K4Iȼ v*u۳u^kȭ ͮapfzd1H5U3h沧0/.K)KG ?s=i"@zlzgyӞ߼(Ap6âLIU99ȓ{kިwXdkcln렷fKa{AzmGTo1 XwOfz$Lq$4nA>ilp%s@$;qC]k[Mm,spn?^zj"a|hSmV%{?=sS6kn:xIFa r?} s,ORm5tKԑzCw7#K i9!akg+GȦ1Ϯ\_H.6W*kNֱѿSev^_skkEPYktAc6·^OQl{^tn/xy~$No*nak8K*sW{\ǖ=Su~4csZy{ѳ`R-3=6z#RȎIZ$~&hi?NK\GiIQU{E})ֵ3s ׺Cҷz_O)m|Mn~⅙iuʚm7k"m.5==H``F8ƶcX1-> ,ml[g;Iw?A{C75Lbpe7 @ȩXafJZApt4?@;[ RD-;8G?a`kvn.9Ex4(6GI͎s2>gZ6s\aZ*@pv}?mNqMF\\1NcMn;k!sNq,-ISY H\+/ >Xc=⶘>Q}nR}[S=_ CXѵ85WKMsfH.d[.xpi'jy8py75ϓ e#SQUz,u-oܥn5csCSA=fs[& $GIXme-q.{=}4h7@vr-Os\Z5ǐ6l&{O8?g译ak\kGD#\$o7۹f㴉nαVn9ޥn+[hGF[i8 [CtP4ed Fw CX[H2?!OIK?New֏L1t2M=-plt}'9׻{B[$G37!#m$0OݼZ>weUOi:CGb֐ <~eMquۚM\7aGg?WY1 1D8 %Kś.:] Y&uВ?4-úɑ sb;P|NֈފB?KѤFdͅ0%8Z_kIt{oh/kX7d?0i ;"<ݛ?1-_^&.>}Vk-eG9!k7H!ûO^k]kBթ6]s;~V\vA">?O[C9plst{r ?}nn=ĝFlʜFH|czM{wImldqZ։;ӻMK82KO֖鶔9&Z7Ng-/C,u.aI$I$$I$I)I$I$JRI$I$I$I$$II;\A;9f-cƜ\ I$iTDtS4sH;|uYIm~s^lN~ӢP v>X)]^Ԭhi{$t [_{I}* $OBet ԯ:&~))~ !4>):ؒc^ Nާd;- OɢX)ofh=3 "8OS5{yN" JdDFkL?<'T&PFA7&6=ڞ=o \k}5;hyiHBu80]Z=W CH'i\#k=t☇] 4ߑ11'@8DCuqCjg".vgy} Xlc{[gGH)pvxI DTkwŏ & 7@hvӳ2@i ~j^'Hw5J_Gā:'JXZӴLʇX@857rVoC[o%,}úZr5\4N4U yϳ P?F40y߽"+,/qo?"{oMmnv)g| =IxL$ele`k$0C`Ȁ=LcG=BsF~g3Q&~ u=ԦTma-ۮDkI%趰}uXNѸ$g\RGDꋴ=F?Ṕ8lC,sH?RU(nxKϒ8!e-ѥE_n AБD%<&F3F :~@N$^CV%FL *7P{E*H 5-d"M~]B>eRsc} DwM![OrP^JMip?51 8CSX$4{=`v׷S܂jxN:B䵭|\t Dq֩58";l5nݏrH^{ Qq%cLLwLۚև$}/ޥᡅ&akd %qHLրK9%vǤ&ҏS0Éw&۵#;RB @dLGhMuסjq4g tF׸Rr4G:hk\d++ʗHAs"|LzzRdI-I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.ˠn}Ʈݾ%}/ WGu.ZR?-'que75~NqA#HCcmc xaT 4U?c`HЉ:u햇w1Q۞*daƾT=GUz~l@U\sn4'Pe[ΥBu~.&Czpb O;s'MR(E6Mתv?S>#!dRdJ26=F9@9:]1U_7Î?5 tIG[ۉ[G X)%5\4o$vU3,9h yWI~i-`19lcgXZLiCUϼbR(kG,K-/]@JLzcqy w ~6Za±Iȴw؟VۓWQi:nwK58[j/X--ˢwrHVcv~B94:@ G%}zK]XϠZxGv2߲UZ‘?3u:k.~P;Q.gQӳ`ɧ5#|`fâZ۠=dJC[md9SVUȒ4(b\&!0?YW$TPaHQq(oM%噊navI>iZR+#**ot 7۬ӯCȵF1_}NJҦON=l UF:m.m<%ĩgZ˰LC4cO1Z9UtʚGmz.U*[,{l91-6`."`Ԭi~}e<Բ zd9Y`c7i=^ʮ5@?v&NOO{QC 뇨0D?jmq%A[v =[-dw::jp;ݹbﳹ9<2ZMMζkXKȗ7lw*H%7XZR,X[3#k$Gy](f_7Ԩp Id\hookڷ۰i_vFwRAO1 2ʪql3=b<8׽ʥ;i&>2AZ ٢C#ѱ{kIi,/175 ۿ2hm+ϻ7?lVͶ>j;#?{zoJà D&iĒ$4Skw'YD>BIWV3Rph׳l8f[C.8kBv`39vyM{v"fdj#ߤy{?"hZ!KI>ּ{H08_*NPĵv=[[q ݹoU0Ok7o_o$'>mQ.$XNq!ӴDw3 {+tqž\粲w"ƻ6ZsOީ_;]c] y^d]e5dpGlM&{@1!NCap 27$;Ox_nVFf^u#-칌axc?/X湥 ,MAeo /A[f7]?"4lq=#]{f*&\5l-5۔iu;k`f$kq٣`8$t2Cȣ([]Mk_h[{aSi>w󬮛jǹZ?}U¦m-S丆5oCFU~Xq5p=:q=$6vi9};ke ]?dZc %$txDZeAԸV#%-YomeOhh~)=Ŀ>Y j\q!N Qy_XEN$nǻ=y'n+v;%[Z=ڥd{=}L !,t] k.UV;]Sd0~k>H{ǹv?T6unvCe_z]9OI$hºzv=$w_g+PF1~C!/o>͎[z<9Es_kQU:@^@EGolXe~4cO#ɩf:ˇHdn|~q=VWUM'߽ "ړ7o?v谺Dh"X}B@"G`u(Es i;7RKbQT㲸vםA\5cRoOsS7tDIsjTk[c\2N6VcH?.s3nLH!3Ck/ñN~yMA z ep| 86.7>l_u̍c7Ѕ}_UD+sKsWNI%;I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I-Np \' &/4TIEgI<$FV H%xv(ƍ?kvKp)GS߲t۴(%O; @Hsu)4@ Sfve@i_*4st>zjuhmd8 IL|Ԇ $^NjH_5KKN濾3I<"6梥)=Ӧ wE{X5$eN=#Ԯk+>Fca`ni'MC8]fGdT%`$=X $H5-8Qk鮱|R P{槑S[.K, hZdF<Cu1q~>$Z> L.}@D9KO`M1ݵ۽K@Q8i^- )cR'c\8KHB}Wtyʕ5%bVz$? O ? h8L}ɞ#F<8ˉvGHhckvId6hic͆@`}XTɰk)M {t@kv}#; CHިcז6F?/%.5הNI%'dc(?5Mc#h?=>IH۵MB ^I=(2L&h=>e;$rLPf;Itg]5%24Lj OtwQhxn<[Eit2HRJFbGW1)}e"7I٬-:ruF40=Z82s[e.6x(궀LK -|9L4ӓNMk&x{yDM0T%Ş&?TnC=h~uML2?rN'VbF}&N?XoANq&àn<ɕlDiRKYI5D@Z74kXC@Ss~c X5/9ACΠsLϊ~9)LC>IC[ ө3J$l5%t=4p$|1^k!-0$vKUqVHckq0?/ pQ)FcLw\댕e<&JEdI$I $I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%^`uGu>z'_ nK\Hh\[s.!J[82Cʯ˰e=(z"*Z=C B$j jGxvLg$9ne%>j_ج,=6?t%| ]Lc%Þ+93ЁːmgWk:}<So> $OU-O0ՌwYp%}(AGţ'=u x[=kd69wKX?Bv+K.NM8Չ)6Z$~ ;液N'_ tG梼b#rJsn$HE깁Rb̦Ll$&{- NN~R b a䎩jq pg[P:]ĽؖBH=/,X݇pXd?)E?@.iIBT2xRǎ>jN4?{~Ҭt$7cuw:cf72hYOWU-Nh6Q|DԮF;n!ųk~b[[1  ]컏[-eK'JߩDꘞ[FF `!}GL:7}Z cj:m~7H蓏q>?4{^tCy,ĤQXԈ{%Νu"I@;>w #ąk-cJ>/a vu b<y:Hƫ O԰k%:aJ/ CY&[tr^0Ԓ% ?/E-yôg)Od}h1.)u*Mp]7Pϴ?A|)a>3E=[б2ïB5JƁԕSHqQZn~QGN lzC\OsG'|tT-?*X3zN @K'EO";tHzsq_YzNOѐ055/n}#H6?J~kɮ'Z.%u}7@es&cCbz9&H+OE*WXA@4Z$ryV_kQk~T&?6<:;~sRꝴ: gj:`g`Oh*[7'o-o ѹ͙IGki.Zxss8ROWKxHSY8BRfm_h#Yf@"e"H)nUBs$,#D9NƷгc.gh:h:eNI*LלkO_7S :메|Y+fZ%&V$lF%"}";hn%_hxNCŬ^lp3EW[u9Cdۡ(NHȦKۨ*a-q O{v-"{R5x5-PC9g 5 NݵsAuOj0\x?85UWK4mh ;rc$[s/"NQݖLI<"G=?Xk%,]1hBPP&<{z9\9aĸmbO ~#ZgY[`5ِv8 5Iz;eq3.10c(v決i/VVK`c-xkmkZӐYa31w-~ѥen&K`m;skGzNۭ0{AgK1\]zz^ZK֏kA?Z9}-Ap:x>]Eco'*qٴ6u2 c:5sk='_Ul!CM^׶=ߣW_!@#Rt?S ѵ9C54I^7~rw8 #AR]_fzLv8Ћyu+pv ~S]]oWYS݈Kl.$9wj;sEC'OcE7a !:H2G$ȷ]fwz?oc?KՐ=-z!_w?*?Mskkk?}s2ks j9N?H-|l# SՎkf@h@_Q #Myrpḵ/뤝ifm[kxkhk5ޛ'=]3qmqoK_M1mla׽E~M;g!K??~+?@07fQ"ZG 5Bguh ItP}'ᴈsQ{6}3 [la;8f?ԫ6P+7t5 jHULmN66Ns+d8L<$q3@cXađ__ iƟ. ?Ebk.sKfm=/mt[?" 8V o(d7儃> =l̮IWhQZw4rO(.ZbG2?5ݯ y]$VE"nYs-t:=w oL{ EInu7Mez:ޥK_I i4ly%Yl9VX\eD9ٹ8 iڂU]3Iiϱ>:EB] kXcw1nk`ӴO#O~k'Xߤ{E)T[c\\{DFC"}5At K~({FQP[(YEݍ==? ޏzc_nX22]XGg_t7snG/#] hx M]xIrkŕ'p:ߓh uJ1ucE~b{̼8~o?H/nhj =}{~`8v\ǘ;guVK|[sF'e5xA.o&s$H$֖5d}IǍA&Xnhsl6c V~]5KZִX} {k^M6v!F-//%M 1iI{XiXGvYǬSn>3Fy{iSZ lw_ޡcI- {o~)2e6nlQhCA<­~ u'1 s`h@3=Tv,CN:};j=RۙQc-\703s6FI?P.l: lO@'XdABޤAnɳO36.?ćz+EysIi?3z4wC?>RI%a]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I4| #Pg忝I%Ƙf+`!JX{N9־x Q5$iʛK #^ѷ=I|k$UߜZ{ x;,ѪD)4w:H+ kYc+i?Pn5< L'OJB@4*SLܧʓ NO1n:H;?Ꭽœ!qBs*cudL8_r:m%)r7;@A>Bփ8le&{M"b}VSbN?`h8htw=i=clkq O ԎOM̀pjX$w)7mn܂$Й4L熉kN8׏X\' ]Zh4ws> :BSh|&k l?L\%A Mspt)c,qq #JNLni=Z\$% ei{Xϵ3=ָI;uN6cS#ELH 5ŠpR`'v8{>pqk:vSmHkC{w6{y(`x$-D#Nks r\mi__Pnq+^Xٰ5$xSv7 p%+BN;\ .m`Nq[ Ip A3d|t78AK6NcN{JR&'DjE D>lQ?o)xQ Ky>)%pe-Ov}$Ix5#PlI>'A15&8 a<{0k ;38 >kJ)$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]a 5l| ]Zn-He-,6.sbNc,Ap|Tie}C h G A_(`dcJSU wRq%^ΧmõEsu,־Uoem1gCE׆۴6u':Jt ov%ti殹#s[ 62u䈏-/s+]@mƤN'LJ15}.xio^1O)Ө^oyPȰ k#}˴DĩTbJ>Wǁ;Aǂ:^@m4 XDZne "HMJO;)6t˥ڷ>[{OǟU>ky LaiŰõx\k.nCz^1uuq|_]q{F?}+V CNh`*u4Ɗ]+=wv|Uuzߓ-:?yC?"@~wMStg܍TQccSc$%,*ηַrbbGb~Ϯ_괻!]ulya A(}6 cUs?jO[eҊ>eTqݮu.:r?ÃYIӓv+}{ժ}#..5\*7ĭj27@7r{H?UED #0Vq0h6YT:^9~;ZuU<~{jѧHyx"?yFVXXӬzO._xGOKaۉs|T+/-?+Bt7׆u }'0rrHK`ܟF2Xth5AHj< ZkJ@%gc3u\I>k.㸙Q+ W6 H_QT *]hONȭSb5DqE25 uN]PtRyw~8y֗OpЦ̷LX 86d5֓.?G^c/ oyqj{|Z}[rF_Xsz4X#U>qqCǿEo>Q}; {L΂xοs$!bm3%aݑhyV~꫽_$VUh<Cَq9?? ]05 ]v MuYnx?V81#sQ2:8O}_2-Ff<*DjgMg WcOO9&}ÿydʧSc\.Gq*6ձ|AJ\¾mv+[7`@][Ы=bs24Jt?*'~LhJ{ 3EXgPADZHխUrpܓI-`,ӱ3INV򩺡Nk䱟il!g}@.hHoy L{nݏɰ Ձ~Ukl kqIh-fKm?Rs+Smppyw?TR y]h? }?ŻlG8,. h"nѧck2Om?1$HNm~7t5;үebu/6j杭c?*n5]kkv@u๞h -cdni;9) @o}9aѐ}'GHXcp÷?I 0ڵ̍փϥMVKv>k|7vQOWi[cψv?=1{\[3vۓJ6CIAoƺnΉ#i?>X׆@V}B?I[Z~c{m Zl0ik,.ߣgޤQ+?CkuensP#UTX.~~Nm `CS"|J-E6 6vleܗ6ci">1BQ z7<ײ75=>YI%Oh_{5[&Zژ}W{5~g"g+@K; d,dUEe|4Oo$]UMT4/W[megp!5XḐ7!ְlsn K6DYH{aĈpw&/u_ :6L u?MAFb=~-a;#C!}Dk$WxX`Kt`*c2l=2 r \\4?;?K#{`|*ٷ9štA҈vն]OoH6 'ْN7ף"I?I[!cXkc^qq422_c˛\ճ_}I0݀4l;oSd@lmd{cS5@.*5CC ҝm986 I{T涿Mgs~mK&5:C>c=GMa}1jjlwѸ_&{+K&p`q$kc~;n#>ij6ceTq lV=FHakֹ k=K&@;H=M?I #kMv8M;vi A2醈wQHZ Ij#+,B'8IL/q$S{'ow}w[L48kR˱աHKꦲڀ3$&XZ״o&A昂繮!D;50G1%tds4Ac?}5N4[f֬_WYCH44;?G3ucM{wkkn$ ̀9O--I |0=#`!q|6mLzdjGmG砍Ukݎی\X:6Dʒ8Zl./7XYAkjvH ;X]־4?L[_\m5M d3㣿ڋ'y4,"X'v?([S #c~\?e-\7M1O1r :owhXdYk۷0}Oqi?}y^S\ezfi-hsKMٶ'֟lwg#HmTCt-;~Mum KXx ߼O]cxI+R$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I+ UA}!n^&Yb#$[MVG܌Vkq7q-pӺK$^,TdHSÅ",f<;9I'cΤÆE&aeI+r%'0!9:[)s\ @h$/A{c$Pv=Cv!fDx%1iHN\NB-y-hA:ԍ[  F398k@;=R)NxIL5v D}EZDPn v5'C06\s 9& a%)AJv|ILMf jjsHQc65؋h C@(N2@>IJ}|Y:ɏ4qi߸5=1[."[s ,{\㵻 5KܻC$ZΑT@; {0HqpvV;FzC[˸!0s/xORS'Iv;"4+t=WlpGG)AP>%uqoIV pxP#jŃ I0D߽^gl# Lx3󿴒8Ɉ3-P`?ǹ/qk\_MUki{y;&HrY6  GXI})r^`p$EAכ |8o}]'Ґ^غ㡟O4hҝ 2Otn oIkǩ5(L0Fnra$dy4ڎ5[A,f N1=McK'_6\wv$?1H6jz'@`"6s>V}Fg_@jS |i>$ Ɗ7\mnCyIꬸ{je@Kd)IT&H$ni>L*uRr@LOwO4kC5LDBpMsGmv+L Cpd{I2$$NJYؑI Ή)8Ok{ sv)vn.;>`G7>ϷRs8@2cX?7O240 /.$ Dc /I< p{cNR[pnZ,d X$ς[;qHPǼ['߾NCA?Y \ӟrJ\Q$II #X-ۄk%Cx[Yݠ-?FmqC90.8A߱%. Nw6 ?_3@t<R gtR }[68zCf1.W0.1R3Y|]N:q~)bY$J $JI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]O*XߤI']gAs-uMk$w$;d2#S;[ˆdfTk~2Z?yYxcVXв'rV |v5-qS}X%j3tSXm*nHW&bQ:QⰈ1+GхNǺ^ut,nF5=ġ/l@ycA0ұ:ǟ,Cl0{[%C+d*5ׂD;vUhղ,n瑩YwJ5kWOCdPƧ yn>m{1 5KsPP"<}XÉN??X]sp˯$*]AOӥ]P~4 ن47]`$'!9 s;06>#:k۴ry$wS7X$LEON<z7O~=g!^ c$'/Rx8;Xg^l$c)s.x81,{he=7!@. vc3}BN}.I)Fr qBr=v?8xJ^ǖi.PU,?H,T]7?X;2d]wԹzuSp?~z]nKSӷtHFqFVAq'8N3$!韗+o5VIO`ZKgtoۓ}e¦5 gEڰM;,kvhm7@'^|7jtyֽ@굿qtMgo}%l4 FDN0KdiyݿQa6D+|éMdoO_hkIxDL7j55#-oN-F ױ6~+[c,k?T0cq5?B7dⴋl/QCo?j}V_%_u"A voj1XF[]Be/ߩo;̸cY3a8}>ڍVӶP|T@/n=ß!vS:teߕ1r1|ڵb;j GҪe̮k#󾆿;mhDx)e?Qt nO5 3:IzRԨɧѶpli`ơӧh'O7n`x13i;?zh:ݥ -A<ݟXC+>K4Z0SƉG(sIR0I'߸ebcgcaUN~l,{WMN#%Lw^ֆsG,v=ԸOQLve"vR\ݣq̓PiI3NM&pAucj.o13?f`1tC};* ѧswgYb?{WXs?l|S9L3zg;'sab?Efdo{HfF(౼:F>k+K[*ȸH^ϩCZ0Ѵ;ωNPlCݩ]R\(gIPϧ 1m<?謺jZ鑶'k~}]#;Y}e #n!gzWܗ:X{k.\w~BBz:W"xa]:Ƈiݲ ?#.(n2`tΟ}`6Ls[$A'\;W'.=mNwRǪ[]<.Aiql֬:C+4hy}hﶖKkhpgYm a-4#tq44W@%`Jݸ j?M:5u->UwÉ?R,/sQ[]0t#s?=g.C"u-fׁkl? ?@fiedj_:M.V=ys Oy1&Xcx.h`38#B0=bSnN{p=POq63}5&&OzYveoxMCˏjqM'Myڨffpta^i4{hgEu GS=Ѽ=%iM~^-CNy{~N}?j\1aݵIۨw?vn+lǭw+Ctp1f$?Z#|S8>ib_<4T9WzAѧy۝ӣc(kcI&Ad?+5Q~9inx+ /ZeujM{v jDJսCS#YV~KkuHCw8?6.!$HL$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$ՖWf}m 0DǷEį?2Gy:[0Ni/Fc_'SWͻq qmD )!XO1g0TȘmBp#XѶb|;Vum L 9cwHip-$&?߱FuubǴ ;N;0T]-A#plgS1}n٬DZ'tN ax;O"bzmCZXK6'muߴ]/ k`~u, ĸ2?xzOf=V傽ޥnsN۽U\rg!Qֱ&%`$[gIfi%2ݮf&WF/3KLRhךe󉩳%5qK4:刺_7ou-s"NSw <]"ֹGO 'cH3${;JV+sme[&[So? kOE8sAi#kEO`Ů$Z$\_ĭt1\;kSq-<;J.mBʚm܊;k%Pɵ', lPǏv|I5A-?ad̝#%?MXt (GP`i?Gܒ66s\ߞ"6hF).8.s@CpӓO~ JNL:d}n9~.qco9rMUouey5#ؤ7{1k^w85UȭZ7n"-,;5\*0~=ns!]xދ,=7A9^F[;=MC;zClep={ C²[Fo*G2S[kg{c?Oqiah 7^sAj?@tfcy%S3p ׏Qcq`M-sxm=&ֲXm2GЖzo $6v#+3:q,=.SXIh9=?;E',#YWyeIokmOHee]fPc_Y fA?JR~2}<= cvSmiqA;6t'Z7|Xm{ s%-{ߟѡٌlv0t['|־z3em%l\!xcYskx=zoXNxR-=>bf4G)o<jHjq1Zn?Q~[8l7g;V7>[E0l$7A5պA.л,8TcAnn$Z֝.2`9:x{PY`?& X8C_zie3հ1v=f7ߟcoLK~ԯwV,@h 5?_"zD-57A.G36dBhs^1!n8ck}#KmW- ĸCv}/g CF{=9q %koѹ?Hpmm2A'%=0~ kZI$'mNnH`vwE'b:獠05-@m7u@&+dU{[|Юcnӯ5#j}^6sZtHwy.[\۞,cHt$:)fݤ[WXѩjc^l6ИQuhޗeo;0ͭˡC@TI%adI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I+MGp+)H3ƲI$IHs=tDmI6p$?{tٸ$rE/e#yo=~f.LIw(DJw=-sK.Mpk5ipo-hsnq|9>,.3G Ir4 jpNOo> B8H?bYv|sl-;m$n"7vO`1h=܂PŌ's <YkZ]I~&k7yJLk:7R|K" u'yH>h3!iہ@;{ژC$礥uBgh #bv;.wMzI#ֶ o}?*\@ ѭ?LƆ4,??ڗc`IHQs 3NI#Hn_8'}4w_18ZCZK|4t%sgt7MGBIX1ts{JrkP.8b| ~+jGR$&B8`~hKWhRccXJ4<hhs^oV>=t(cƼf@kP~{d G %Ry Js&!P 07_{ h,:uҟLHa}KIK%de7i::G%qn-04MMxx3I5R7OKegBxCJ LS1`qy$G1V9ߟ@`b;)cz{\5l贛k%;Hlz}94?hwV tS&kS>" GM 09>I4 p?s1Ӽ  !؜qC\`n2#vI'n|‹L7 c Q7uZf\.Q>#5WX"{ڤ]trBԩ&w"e$J,p۠'{P; Nsû'駳`?F## - yIyw;}RJǚmLosNdyV0Hw浾I(|͈.OܚKKKəNY/ GR'rƢ{)9OmS:d> sL};9t810ߢƞN]UEhu]G~jJehIFF4vBsS4 8÷#QHӾNsG{XH$c^Bp#De&[}wF=01~rf [@gɛ]l%$(i7 {)@HSQA@UŔ%ܢא"$ L̷ @ RWDÆIN/?G:y[v$IE 'L@h̭A^5 NoOb%+ok? q<~PRN>) u$xP p bFu"Z%|b/w;?@Yk@-Ȇ4 @u)#OyRn.tiO'9h%ͰwD[$?NWouK8:' H2X$dGls,-d괬eGm=sSC}h'`nOE,q ?bVh|S6@L'R> =?9 s? dx;Z5=KW ̝|K"L8|Rp*;$ ~ᵼC\DO%!t$I&I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IvV]蟃u+]"Xm["DN+}`b%q,qkF\4i vLF։ӟj˱é,>)>3fewkyoMa^ZH=[){X ZlQG0[$"Zm#MI0?8,3 ]ˣ~fS%d;ҾZۡ;rmֺvilrg{BkuD1<䁸#JCKwu/h2=4X? L.s~?VfjkwCBDoSs tk@vQA>Ny'_Sn~ -{| ?w3SnH54Hh~k` A9Š8LE2bA[I  vILC[8ÄmIU]s5wl.i64K<5]SPNƱI^R%xc2Mc@XI5IJJFK\_Hkk~C{K]~yD{AsqdZgwmk$wsgO)dd5yOT^\X7FPhqq%=- GLJElޛ+oފ]u`5:G\IZi2?Hwb h ڏ'=?nYZA{߳=sIWءV;cbw-1*.o->[l~%KL(Ѡ(Sc&H1Q-:Фjykl/qoh4DXD=̵-Y[6@$K]3fQ\=7ri:nOUM~>s`A'!hLʺmm ~6աm.e24gOMX C~1;bpi6Z"A{L4N1DMd e#sZ@>H)zws~ԫhUcg^@׽đo=~51m.%?A19O, -t7r9w`]cYP{IkDɄ~k][.1XZ 5Vz~?Tzn`" o6}4Zk^5&=3 |Snu}KmsH~srJgxpc]#HbsMxFl~cz- 8 oܣSCAoa;OO{'& qݭm~_^SD ڡk\-n-1}{}o):H2iϚac`Aב 1Y!/~R:5-A5G iYtUi7zf "5OJ܁0x_6ptHr#C14:IIJ*cP;YTzbޗo?TGbٴʋ qH>?pq{L0 $ֹS6!K5~آw O!k_ O &k2 E%2h]l82=ջ@{w\ eׁAePk: = 2uLFǚcL$ݔѹK`n8~vֳcvnA5i5Н ݿ|Ra{[nA|Sq">'e4LL.kӟPRfƆ`zo^1ӷC勵Vmq,ipi/~N5qO]߹@"!đ>}mѹaZz]:cTcG?Z$ߡV`!dH[ }߹k֗ۦk,9κ$4Jf'h8RL$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$ZVfw`Oz-L-l dF.9-kH= IkDc,ceA?C{Rkl 6K6wdgi3F`nwH/'O8yIvWoWP#e3{報Ƣ \h᠟αzLVi }w/l5GИٱѡȏ#-ܝyZG$ 0:Ai?9{]}3Yw&CIuP6=V?Ff; !kZvX;^;X+7qc15xt@w\f&Objpnw:44N Pa>;n wmkwޖFuBƾȮH0O+j+XlqhiqׇC,q "Hӽ6#ޡy8 D|~Jkⱖ=Sms 6]z7Zmԙ;I"(6Xߢ"Sn6s^4@hh?[bIl9dɏZt{, dI^,k hv 7[Q;sֶZ7DtasYzf[%X9;/O3vtDOUX33Grzݵd0s?ik>'hys vAwf=v\@.gAc-Hkv;-Yư C-+byo%L|\XdjJ?Vb?{{~Z+h-kywpy6tcoبװy :UN6;NL>HBAh3:oQx<'VNWs}_~f?T,q%$͉V^ͻNݥ_Q8Ǭ=Voq vG~Z:\\"IXوqB`tm ySϹtnx -}Dă[ŭi!]fEY2ƟQogRk}!ޠ-{[YB|:nh&"cp?Q;\Hp ;tv5ޘ9߼8@IX,5{Ms^GO:nMbsvZWH<k?'ͪm~q5>LߣrF K4x-I"%ݼG(kA$i2>A{DO񌭞3M??{zU1 486]kz8vc͏, 2C6;ݷm 0s@m wc[{}K~s)A59ᵰ{:G7'QuE|I:?uDm;7J0{I$  *IVSj|Zhmcw?SEYX5,ok~ hc{sϷ{=?70\ 5_E ?_MaǓ-jvN^/䨵LY6۹h1 45m@99Ye*ֿ! tX'菬sk`>k?啕{{nL@dvh#-0wOnh۳s$uV~ 7?ѧkhn8@I{q鋟hwa<=?K!.#pfAaZ;ȍ.y.tNBuޫlO})D6e~z) +\-g\Kl$H1 FH/nӪVj8s9_bKಭ=LKβ?5Q}`ldLjmCF3?#ڵ[ǃeuk-ҹ{lsGlߟo跢׎ˍ-$ַoO `~Rs_ms;=ބHtPIЖƎ<5l"\GյqkfH%CN˭-5?7a Qt`h|7[gVw+kw'?qJma}ob3hQ Gk"H!ء |i<ˌIж1,nc{ iW(z`sK'B«gc4anT\wmc[]n-UCx#AUϹY%1xsS>:nױ3V};Ik\;\7mQ*|0Igk+Mq[5^Q(s-l$rlXOgQu`.[ x48/!pI宩#EI$V\fI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I+]0^O р7x)n\^X)$];ƒ؃Eȍ`{=icOUA:H?Q{ljqzxSHP tw.a$OIM3fmAL^Mkw;kPqsl$!5G_N`viT1Ω%΁'uII4VZn'J 纒8 b#b7]$Gi49x)Eew7$€4X88&an!J{vV .4I{ k@3-1Yt .J!nbԇ3F?;U_Ő@v%!B8p@paΤ{lI;dOۻl _YT$5!M}6O ZƘ:z}nt0?Cz0wyx&#۲d) =d1߿e{Lw{"MkHv >ZW$"6za4?ELH>J.nHRu3i:e*47|b|XƗmmlun!DbGӱha;FhWw%00$j|i̦.<4j;!{N#\ĘhCgD6?9K}j' !PCCFDR s%1>I;]%C;i}&6̃_suiA[nxƏw0Yn;xG^u4NJ UFdH7~l=I~YفovI$vS7KSM@v9$Ƥ?*7[%>Ѣ>08ԷŠ$ξ馺V.t87!3D88h'F3] %E+s,J 5H4ploՋ\q#4GR'P;h&b?h`:cO/ؚ8$IqPkHo"`SsM\DGǽխb&}aOe(;x<ѫd $klh[GQ;}kI8f?i) Jq:xx' n spxnp ߸ ޞ/DOOYH3'줕24~U wL|;n^\5"}~ޓX IktH w׬~{R:4ljN]re"tHJ}"ySY%qOcKO:F <ꤐJR)8kAS(X"=ڟ*7 0Oaj@3IKh)6 P\ѱ4{'O9{-!$7jP#BVu3u 3St13Kڊw7`h!=1qճ??5T @tq$L֘P6Ic@u;\@` 3lrv;h }Ie)*!]!Gm Ԏ= i>1Mcl s3}8վFx#"q R;H@Ԏ^w "429CkA@򑫱tehk'B>J ˙Yi"?uF(@.iyrZTVZ ;wR~SkW;>B]C 25prMCM\G45t]Nhi2 J-fH" '_ϠC2ɓg~/hNѠowtӮj5iTAӿhU涸Ϋ.mN>G"Ni\$4;gYPAh.Բ=ݍVF0{0'Y_:d4ZѫgP?kaZ-״~t(ؓߖ:BYʬ ZKhB6>̀dKÉFQ @sZٍߝޮU-b8Ը{80$Q)Gg۝M5zeU6s mHE.ȭ =]s}޵[~Egߥs@KбH* `,+idS>^ s5zkK^ 5zh>OџԋRm$>˱]0?I$-Ɩ̩25c]MY0'i.yL pwU<ͻ1sk}6at5}<81ftl]EGOŬ ]) aC_YWHs`f>,.~\U94hڦCд:Mnl;vo¼gVPC_qִk$'%C嵍6+&޴G[:!ӟ[Ey9 vO9V=kn#lF%6LolQ}X"{4c`?yma@S:X`X!MICQ,O$U<[sknwoc=k;i#@㽤(yE@w,ې֜wHl-v~1N˪2N+Go3ju뢜;pZh7 }zCk& t 錡Gu,.5 O}Z!> ^;T[ cd֍LA: )t].;\뢜?]C깶VF6?s D~ mdAOwkUE$Z3Es.IѰ5o武KSAe<`7H>k[cYLzЍ}o40]N&eۿyp)hmy-/=D"M c/[邧O^L3=wr`pݟܶC&e#T|v÷5p}W})-7pwO6*mnG7wzۋ^-.O{EGMnvDz`@w5,|f8Ӓ}ٯ*˽AH (%-$}#VUTdbl? N_:>|B\=Wb%w/4K)ma[tAγ$ ?8jrP&+b繬vN˛ZmMOr_ӀȠj]KuN>V,h̷1#7PV7s@ka}N@V4փ L-kNScC}ǘr~S<Bv=/^?<8sR8ڈcݯ$48}'69tV@5ϋg< I#r)u]K{:0~k$ŭqݦY=\=YgG?h`<?b\wV[nCH/&\-|~ `y#vc6KǭQHk$N֒㒲M 34NޒE? VWiA O;JTwRCjߘ_T5V`:@S40'ϞΪXx{|Qi'?wN9 -.ieph{L ݷŧL-cH.G7c~V! s4XޫA-oVOUkj}媧+>yÇuu48l9HPݴnk[2l"D6?կQ~˳kxc[ͮkc/)6Ln$HwWW4nsFR),msXډjG4ưƴ:LWL{Gt̺_W6+:0m3:2FߥRn[505ɻ5շtf :{/%E8hk^LI>c_[8cky*g'MqG?[-.`iԨW^XI?Yq{r EěԸG] S6XVv#0 ӮkV}- pߢ<|gYkt,ɩ֦7N9%?Naq᣸еmahn'ϪuPF>OQqmwAsG&$q?y.~r_e,sh C#ZE,sfGҏ-|C695=W;8:Ė[Ug&K?7B`Kwzf;w3c;Wva}`n%k'io∈'G6PwچN[/Ƽ:DnY&K[ HLq YP.$Q]}/æ?J_cZhufYo'w =kO%W:cfb>ⳬc eA C:_Y'S~cs"gmԩK\ ӹc<[汾Cwx%ݹPsZk-k4ٴk9;ƾ͎kLfю=*Fn}/olg3"x0jP ?&$YVai qKV}N}/ $N4<MeՋ-kΎsZ/s/-^ƺ-k`(8h:vjFgu%~L=GPQoB6=G5w: mʬsN.7fNDqv`mBL@.@1'Hܙsv5S1x.;'Y lV2 en H?ou,p.`:KfߧjLevư!ۚ'w !ꩼ"3 4!'wդ!՚˘!sGm3"1wo{ߠh/8:nK,Jkk= s@p10xs}|u';lh$iPkC7LkU[ǪtsA w6cUa fv={s4{^Zѵ{nӗpypvqLրq%R*hu,/sM~w}&7}-b)k횜ז/{gc\)2;H և@c?EAnNHg<H1VmplG[WTmo~z=5lfc=;s{viGOoޤa$\$v'~jG$=S (.cֹ.Gz#Xյ5=zC\A @:{\אK{`ءY$y5?i@A1v3W;h6w{=EVˁZ:kKĐC p7}?Wc9 l|';?A=o|bOdFG9ڸ8uBB<$xFQHgk~zuaeu+k`~{v+xpZ~IBƆV@ pb~r]KmIJװIiO3$.51?7kM,: #Z/1t5x 1Ks[~茵i[:=ҡ]P Y:UhnJc2״Gd{sn8;_c\KKFݠFC[{I*@Z7miڥlmچ- HAw?i5n >bnhBJEifO󚃻{+&F2NߧZF,` Nm}Z%?~u"DIN.kH?3C@qi#LIsCO=8VK H@hCQiLKAjW\`ӯ?G4okߵJ \~#I>7I}{[jsv9ډ<v6=𾒈 ǡK,;\Ce~GަKIO3htğ39l$<~{#鸖 DޫlΠ9%S +m̴=cޛ8n>m qi5_u!CN?7܈&ǃykL6CcA 9Rpis:;($`w?K~q}oRZ]/ 'Pki%jaοZ4Dn ߓ8{IcHslE)KenM?;=Q g1p>M! \=ZvCC=pI$I$$I$I)I$I$JRI$I$I$I$$I#aUΗj.y".JI$C!;T}1SOmA_059='݉\#6=Os|Lh&M`h9L"uإ) mh$HПݭ8R@HuY`60J2%ō0" TfA}݇1:<‹' a;tmSߤ@ Qc߹gHtΟ5EnsODI }(4μJrF_aq!?w>]c=QYv_Q$e~xC[wN֐ "AA t  DŽF]J&=P@?3btƼPHpY\cԭۻ$4` ϱ/%1u'k ΄0kI#=ΟP1&K;IO椥jS94>)㿚xaMԽI*bk}6K_G)Xiyw)e{ftj b41HL$CNhT0A2CxhTsZ65kN?cvH-wރmf/%`%8Hrf$ h'H^ I'kcA̟{~7xG?-.cZJD "|[C[X8ý܅sv ?"}Nocudys}N5?9@?RRkxhI_ ɀ[X.q1&uV(>{+ ;+h'k ߺUa4OD#5LJrSBZ fv[S@hlq~AXֈhq:mC\8V=?;}p@vST3&eLrSwSGɁ" Z\i3ʛ*eč+|},[ׄȔLwvQ󧻰$qɞ^hݸǷwR|z[ēRR䄦-wspN<Ƈ?Q$kK@} n'~ k>9IJ3#OqyKT|66 2OLm #9k4otlBL? > :DGqRI׾d֘w޳ xN8ܢډ9$k:%p>i)SV9²"uˀ b0sA&#nG'sls T&f;-4| y4H*V:\w=AZVAv)^2c I##hU hO΢C67cth"#{D9$/ Amֺ %Lv) - y|K\~J$O{ZA-:aq~+GI2t$kI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$YK[ }?{+l_7{ MIU3)s]x6Ӹ53[u`_u `v75<3?Iƿ"$;{;Ͻ;I//gKmU?)ʮkI>_sP0-tDwTϠ?Cq%FK=*6Y{E[@s'V+~>~fpnA~6Uokt7!c+ֈh+,ynF?Gmj nNs[_? Ӳh͜g~ 4lewq?%ͮhFpR4`Vs#~qh\9?+G?ޭ; ]q$?)S.a!Mz?9Xnykb4i?F{R{vx=4Ll5?\fP+[pGb<{I#];0^,ё̟:c1^mX˵?BݍY&#y ߔ]M #3OJ5m]⹹|?n֤-9>+`>$HY}Dd[rؒgf2^?͈}1nqҝ_vԼwbCөE[4U"0P8V⵹crgĿ}gh۹La@uDud[,j9<ĶEwǢp /Ddi 2w{{ՐN=b<<jg(&9Onep_DЈ?"?/nOC}㱹:ws{4RjzW\iv: &a=i{?6HՒPƑVzEVYɏ9'u@M?f=XHG%]YK]%^ЃWu@cE&bc`?#EUl{q~]Ed1=mz[魶4Ԅ3k!|zߒ^UG3nPtuv[|MWX\Y` #DV52K[6Ru cƓ5l]-F?;_0Z$P{鱠Xk:{qjvK78kMӆ&Cj:iXE JcV-FKmץ*ю&&#O~z2wcсcҿXzԉk(zl`w qX1~T__{aQ՟ei?F_DnqݾMLՀ)[ vKC%&'2^KZY[ZƏE쁱?~UlG=_> (Սk" Ff31\n{}%CMs12{_6R@kZ=OfK63O#5 q dR[cF?;6.<~}mPF y "oAޭi#= RA׶ŭarZG pJop6m2eB܏]XZ#vR?5%-71sPǸ,0O?_Tqrv19NwTwdgMcT%׎+#nXumnXGr{ e}6A#.5cE]9Cu utxT1y}g~XϭH5?u*sj{G" ۓV6gR{pmf\]2uO!I3~׿%Ak;vt ;F?jUcXp5գ|G]f]?Rpsk=G4aYs LqWs%2^Qkp9}oOJ5g |ǹ.u5g#S 5·?&<9InP"L҉ߊivk2*h-ƒmԝE?udY$mqّ_Ra g_MN=!ƿI\6˳ZƉtOS5Dՙw7'>7-=Af3iG6?Lp}׶AeN̺zuD>6c]sY+~yk$@tqw'kutuz+@G57d[M}DseՒR]Pmk[cؤ"PYs)ZjqO hǂjE&~n(nCFNMAʏ_>1qf4vm}a}&iԾFUw@Gu\6+<Fļԅߕ5SȦ+O7(Kqܖ!8EuX!Mn>]ndgjm4dZq_p'X¼503ѵCmԉ/n9MtHב46wtm٣1_R&  {;k; 7W|tv m8  $EI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JFgwBX.vyLi&?Wk-7SC;? ">+ cQ@i -nƆޡv9T0Ii-XQ8uۍOYiq!@䄐 "n浖0=Խ`9Fրqi 2vKwUIkt6bk!ʃ_h,0}o;Cv"h ~1ؐݪE4Cq3?\mnKa/t%E&^8lڪRM7X:OݧBJUVC\`Fy!{AKC# яIufRM @N䯰8yT6cQ;O迒l-4: 9w5~k&uK 8ߓ\CZb`G}Tp!4IKOinF=G`-{oh=QX K7f[Aմs[ \\>cY Ri1I*L{An1Zp4J] c$ғXސos}QE1c{\=Rysj$ƆmI-uڗM;a?O'59^;ILq{Zזx6o&!Ƿc\G'  6KXbv7ߝr̮SwI'C[?Qqhi<HvԤV c'ww8FcMLù}ڏ7; ZH'H^ AnA3?Aq/ #;)*վ5';u/ =7ͬpptub{/xt}o\AsT\cGqbƹ-FMop ɤUk[0c}߼ZƖpλO5 [_Cnw?"5ݮs;ß5ξIAQc"]ȖG"^k*tw>Rͻi 0b6WD|??MaY&*$cnzv۸8'Ƿb&#Mp]EiQ 4K:}/چ ӵ%nkF$3FבBն^?$XAp&[&#?KZ @y-N$fdt ) T$1mt [~=ǫ{K ;N8?2Aa j69%ۉ2GV{f̌,u?[1 KGC{I8EC,g$Klc/thU*z~^^*CI$R$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I+&Ӑ;M;#p%%a1!%ItZ oqfuhJq2> yk`AB8ky穁e>4x)mlmtQl6ջx"K@ 3?Z;]Ui{$@OSIH>I:ȄoVu%|ZkW8ZmuD4ye>I#uJ=v3Y1stMdqs᠟!HU@.@ru:yuhHuI..t{r qZ%۸@.$J -pq;{R#HA)!3@0?T:{};M{@zɣԮt49F=$.4i'bt!?RLis$CV 2ݵDΟAnvuՀWJItkÄ{&hu!JCj4̈-Wx;$u.q'P;7\斺?E:{>i%)d7N@'Q?HfUV9ίkFsik 8˴>*Y mm`xGH),{Fh%ʋw0IvQ{}kw7ݐ ;^8AGY)vo050`&8˜'4XCŧp:,!ǹ~jDm75߼ujmq;O>w|>hm7no)8;v{wR x 8HV 5#oҖ$o?j˜ "5wZs\a2t- )=)c4$r`$ܩx;xwOC4'`߾iیw&DF#HR?^Bf7q۲p %u78dZ{+maQ2v' f<{}/OQemlh'RL#S9]r581u'ޣnXwn;u$7q1;Yc%sN67zw9*<4w*Ʈ|Jg?wwR dF%q|m sYeKПvI,!!>J%d>q6EiCG.hs[;v44hhEVZK[?$VA%#LyQs3V e`;Og~oNS;!81 ]Tk?.uHLl0;'5 $ScCGHn@KA-T,h{$tG&S4'_NT7sb@j/5R (] ko^Xǀؒqvπv*PBf5(hI(:wKgZ 6SOskG=IAK;{ k&i8J`Ky0Iݩ! FŤn~K\8gu07L"M>raEbfR|[Q5}C:r:K)ZI&e<]i8_cQB;b w)ĤA?F$)1 I= k 㺍v5t #O$읳1Ȃ;$ KN@߿m@۴:ѩ=s@Ƈ1AKOyH'!Qqa:|~?47}{Jz'n[ILg?9?Nx1;D*Dșt[Q`iRNRtlq({95_뢥w$!9=ΝOd6K{;6?Iy;53 L]-]k %CC NRH6@ӷ1@}Ө> s%qk ';Ͱd TuLG~ PI $nO63΂UY,Ё+nv-iht:d:YWɹK*gM_Yƈ5UPp0srZywerv }/LuA8?ȼC5Q,}'XG})6ڟIeSӁ O֏cY0qg)e1\7Cu0?66{ɬIh&c~5zTVIVn{@΂=)fNE ,wc!q[|cqwh9s.&CXdKl~kƤYcѐÏ\6T^fHkuseoW & 09-IMG:S]c[$8ǻJ㓑Yd4v\CEa_X tFQ9[~smQ_Gh \qS9p?H~juS9Jn;cc8N6[KS۲4WW869|5 'bEb.NKN4@ʥxyY3w-pű~ >Y3;%[)دp&ZLgߕ@6{~Ϧ`.sAvݟSh`8;=¼R :G zvUO#_ T^\80bO!*C'nYpBHrnv=@H>_X4^,D0pC;ܨ! KD'9gdR̶c F?9Sf&VSY&*gqVqb<n105$Bz.8nSuOZvN>()qt+%ѿp.qĖ;2O>En} ͊@!oZ$$)֥x=ߟ*ٳ_G|?\ : s}ۏ,̚jˬ-쨵=@X}3:okA$Ɂ48Ax4!ӯ+%գ 8=&u(RnE[)n-S(sK,<[lkA$4Cq$%Ju18d>wnEc`s+!]&}O%viڳ2-dDivXwR"48c?2[˛[C(:HNqҝ*2_SMn꛹2l' -f:eblqkOOg ݚf oYT@8k,a@Wַ@a`?չ],]b](db.7}w9AՍKce󶑰:nBHdtvn#Uv}m4 hжƧs.RQᵙ-G%:E{ Ϛ8Ư],L,{/)cF*찂9o`wJTT5կʧ/ki6 k\ւ ?*~sCu'U;.K](ՍX'Մl5 m_PN]a:5K{:U" Z$8hʫh[c[N^w+Ͱ۽dI9%DX˚61؇8% @63YePi|1ToPs?N;EXAB_U:˸Y8dȝ?2qȖ~p}/}OӰ>oM k!lA~)cVhXlcZF[7̴Xmx%AVtppGksk {["Q q.`$5)3BʗYsƏ~Y1{ es&X!Ok}?[2w$\ D!&'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$}UN%C%Cd;k&l$(,2ШzwU_M _ܖ5p??}Cx f. @r߭@6 к:BQ>ylݣYT@ 9j.: ~u &ȐDϭKH36mz\>%6٧WDR^-hiմ:Ѣ_dqtjWWxm$n3Qɯ.{ŮΨpc3)76];p T}Vnxz*WӎNahXa @U\`#;cJ]6oqsY܏n5nj S5j'J3<|1T_.OS b'/-=Kړe^ h@iw[k&ط˪p>I^\l9TC=ty`X+s̴kK(؇l[/IX0̙>_TmՍN8xϵn-oO\) X,"?D~_MY6?w}ƹhG $Cacˎ>alkN~Wn1JStܧ:+7Y ӼxNDՄz.'֊0u?MnͦU~c>EpRoK-PzWƵ 9gM8 u!%co{KK Ok{=E\I?I\,(QAb+ۀ23L^AcDhF8_Y\֗mhhآx -a$O JPbZ \Dgܜ`?[$op+FZq-ݩ'h&7\pq FMϥ)KيIJѾe5Ãc],vLx{֬% _d0oS)/McYW#2,c[I |n0;KC G'czƶ@gH-tzQbo']XΖ>%-ynE'_c9ĵNu/`wP9M9?CMtomƽ׏b<#vk[G>+GWÏI 梻PK4gB)#omup#T+s˷HT%/P=R;?{\!hzDn1oQxK?Gtn7p. 9_XqH#k~n?骏ي )J#X1٭˚Z` Н$$Nk$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I#l $#%NZ_줒Iu1A:V}R\װ Ɠ[Z1o"@#,&t%}=D6YDB LTo}ug{G'ȸ=8m: dGr~d/b-iqII< )`sݰ 0q%30 h)綰IXH4#D{&|PI= V[AH613pP[kx"I "%DDϊk=w {>I=qX $$$Ce@u_Knÿ)Z:B{`p~;K%5)1ĸ vLIXv5>cI ";D<8IN .0DLh>K gQ ,kٿ1hs@!ĞR7;ʅ aqAnG?pG)$'dp kNN+E#Mc@~۞k}DQQE'M>*D *Ԑ#Rȕ^`ٸ:~jx#b?7;۽p )G`:FD({ ο#akCˉ&HIW?>q.pOc.H8!Eh.h\י$CF1DGOR{.G%*p.I#D4ΧE3xs IэHָ0LorN7 AqwU.so$?bJP #] ۨIԎ1@ G=0A &E{`hlWI24I iyQoxA=DZ^7|v$ɧok]N  hi&c✂uII60 =O4'MAJ^Ah (5dbyw_M%*S; t=T#U#t4;_Ān3M;@?y 9G 3HHvS'ogYL}'P>5]k^ðRht'HHܥ鹌 . #I+S& ܂"Dsz pq]MH3OJO K-TS"S$IMZk;awZ:5U~#Tו%S>QWXѯy;i ~;rq[@;A?HۀIJ&5Jdi0 r%LZK}~gO,wљw'oBۅ9đ?kH{k )b4I |kCxLx;th˦?(Z<O( s|7.1"~([$ ( #b_?FT鹅 bIڷ$&?6 綩&1xDwX$:cZH-"tg6Ɔgo$u2yCFRF!uggZV7ӝ\'S>ֹ{>? FKѤQ8ItIAgX@#Ih;4yH= Dn'T j^߼U3rhHUL0N~ x GEI$$H9JI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Iu?UqqmA'P',TlO?ˣ?[Ⱥ L>ί`Aot T3G)[: `Q29f\`5Ͱo~若7JVdx=:솎Ҙ>1Пx36ֈAlѪJZts=49hipfDlxp#icM5\J9JMP 5Ln{\6mlc{wYUAA.k;M+P pp5{=Ob=J~Ekxl{]=pͮDm?JMMRhcSxdp}JGޞI|wgR{w@:7p;'RJV;2A C='Dk5^| H'WGS4KB?HA\4"~i41>i# ķA -pkjnXS#iRik<|;iQkC=B | mCLvI*I5ks֛N!zmYO\=~5$>I- # @k~ilu9ϊ,Ѯvǚ D+5=a xml6{mN2j {Iq G}Ne[ZXlqqp6Z}e͂Hi߱Ik1oX*!l rZCƗ:ݳ[Z0>9 _ovV٤m%^Rs,6'?h0hlK$c{kħ-k=nF~~Qs\~7h~*M t Ipy%3c OA۞+I?7{ nֲ"pOؚcKes~=7_{C- {4_ô5k$m̹ ̓kCnDDzZ<ϻk~˿N;G 7/lQ>:@Qm߫I;'GM?!~!28>Kk-q:6 =ڛ Obk3ow6ae,8zf2^N >~p}vL]AL#A}7ɏM#T2Zv3m1I-w WncK>iзIPsC $)8$x;T sl!Ѩak#w1AmcI"t ~vOgmi;AC릂; ƹ$n|9)%ǙS$κखAp'a?bmm k;1.b}[*$ϴnGg?!5}igCM?Pediu D&Rg>Ii$gRRK/ }w'}C[m-_KPqA0 D%@Z۩mI$I$$I$I)I$I$JRI$I$I$I$$I'laFI$TWX'X+,py5K\7HNOb8#Sꘈ|ӗRRZ#kmkw%?樇1C@.I>L&I )Dpv5}$̴Z}f|yĢ{ջ hjN:-C`CWc1ED?cZ $NLǵɡŭh"D?_FRm?$ ~qNMh:xVZ}~W;()<ƩӒ\cE,bLֱZ&INr1mvZ^ 2DyW۪<8QIRQiv?Jktsu"-f D[{ݠ?(TdpGēaF&p$jT'%'f'0sHs@jC1Pcd;os?CCtXYo=bЈ3ڤ jR  # 9I Dα@Ƕ 61  UJ[hCqƊplCD"#cchhncM6XHfx B:$͝g9hxIž(0n!6Oc"~D?IJ2ۼ@1D.8)X6F?;5x/{=þ HGxH6>I֟thHHSîϡ]b{A!8 &{KqLQ S]ۼJt4Lk5t֨@Ϗ&.qx%Ios)!N $Sxl{=!7ai;I&% &wڠ$?n^ǔ'f4RAKF頔)HI'SUțIZqh|Cu;DRcFhh3 |bJRbcDgxk*UVH'nϦV6s\81vͮlDut:5x X \] o(>L8Orkch;O@>$];<[TwpPua8f:?5Ot6Zv9A$Αsct:m̭-Q8j`4Љw<6I$yIKj|!4 ƚ&q%'ǟ)ѣhǽE2<=c}IKGڜlBll"Dyw$\a mskv4ÌRTCxh T`n$#5'd8rDw~b`yH8n -Lk$%T@ @m! ѲK?iD{k汰" {77ljƃE*BcEaѧ[F%z]&e_gsZ>Mis$noN^855&@uZ"?GC>Np^HXF^DGsq'vZ9 fz<2`}Ɂh>'!֞dx}%-΁<:H$s,x"#%})ꃬAӬ?o+`sf]1cj&_~S aИ]sZ#Gh6 Ƽ`I&xwlUXǴ=D~Vk3܍ co{};t82- 秳bɬca46 kL;'"ثF<~}R/v|?,;y\H;IO$laԻ s#VN]vIh?Ww}6XXi{I}) DM ~]en-|#[j{!{Q u4'Xu51l%5_뤦_,sn5[Cl5nCk0RhI5Ŗ3qm'VDGRk kd28PLTř,pi?B{.wf-忙sC vE%릟ob@m>i؆}R$JcyJdzAdrjf ?ڕl,kQiDCvc]E2;"$ Nf-IIKSkC@\s˃K{}zc|mMs:Gԫ\Nhh'Q$~Z{@H_(i0x|ʃY|9R H09'Nkv}LQ[Uûyk{Sfddj@12#]>JmsF'%#q-]"'FwǩNև{ߦ\i?h6UsGjfb ꋵq.CƑ(Whx_{B8tA1^4l0?@?MS-&KIIl= e"NY EkE"O W;i%7 :~tR3cC|l }ZZѧYI$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I"QQAHu)$.ߧC[cv|GX gHa'tO*X-/M`s#w&u?Ee`ƼL[`7, kXhQF+|(Xo'Fx)$$IC%;^*vǸx<d8Rp|c5%Q{- Btl|CA'訖z:]-1_H5? 73>?.$I{w T="񸸇vh`|<I$#0TI$ۄ`t[㷹NZ[=i+F2QI?BCKySsCkH2~cʋ*I ( ~- Bt p'cy0FM':OI[H ccrE)-Mf;}{>]?]O=JƶCJס%q Z"T=.I TvC2 wPcYPI$y:$ܺ?B?XN78CLx?nh'!n2]v$H$RݿL*n:A\rWB/ڤ@<F;{$%a%ցjsOù aƥz@1+2}#Xx'ִ0$:'y|ytqʪMKg@>v5v4iHdM!uL%I%f9$'(0^YUtp_o8Jor"RswhxRIXnm &`?1902cl5ٷAɈr{\|3Fr8lN&Lh<̝O#H*LleqٿLjvyBK"G`Ll?JW mZ;yHN .1>M :):pYW#8qaN I+O 4LU[6V9u^{R=-1$4#SX d̞'&Rv6r9:>ĶRRI[6iUQi,;cT3%JH~G|逍 ӫ ;N4˃w?֪_gkާm}R施Ga*H"h/d9N[k-sFiVk/ I?2ֺLԥJ&$R%ay;@FhKܪLt$(7#!yeCCu&$$ЯI." p il1'@#HQ7$ iYA2L\uR'8+[iȍ7~{Ўۦ~?b6CLp?lNIl0vaI4%YN,Οi\@- xy4C`A-k˝I$ +܍]訄(h*Ζp{˛%tw3ѬG w('rG$:dI%I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I= !Tl hkfN^~֗%wWzLb g_l+jdzI=j zE5a? P1RSECHƇC wSXsIstlgRzgMy&?uk;tH^ZS (# )).e-N&/2og;(α>[?Q=4 `wv2Kܣ.jR 3\CXFdt}=,Vw ֽHgɃX^ Cpݣjvc';vt_HZAܞ@td i'L*i ۿ 籭x{K81gԶ5s Siˋ;Ѽ&fOTCF67@$vIH[q"4.1ېkZƸ^ {Ow! vZ;;YϳI{1k'Op8ɔqlQsB[ΡǼ )@kHg͟I Ss{lD!ć9ߵ&P9H=LvJ~$Os ),~LzLj`cED~M[F0;ǁlky)Z}Ѭ.: $$QLGWd b`;{Cē~wFXa8U&֑'u'v$?ZHlZdi#7Qup`?I붿mm"mVC[xps>3.ƷTv%˭Oxٺ825w75- f`8{$+EgLɈ5;E FHS՜J` {D7 ̀YSCtNgЋk t6񤟠?9k5ym0<}ADTaX I>oBI`Qr-1运mm 0#ݷnkswF?ͨ_!ƸMĸhvׅ&jevPx%6}%$Q`]F-PHh85/t@jthnFQ$L~KS3ߔ-tqvPA]'a4@Z j"HI̵Y)y`򜱀Ȥu:j\01XC͘?nzrݤO&op:aumMMyiI\$F$$Hh@頦[_%HQԝ=G  [Q!Đaf~龃c[  ?qz-ttS@!{HʁyH $s] %7/e(YĐFg;s6}{XdsKuUDuӅe-'d8h> HpD6i} 9{wk=6 y:ōunژ#gb_ƚLO\_FSxWjZr -wx;lYpwz*55 ­>{JI$H]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$&NvW*mn cemc UGQ[gp!/D/<_ci`jme!l4-O}d%5)WXIs'&/$I&N~F4n?D! L<-#B+S~?󋤒JAc%YH4Ej4ߑ$H7X̤I\v 0hѸ'qU{v?ʁ*"݀4.<_թ$S0˻KHw*,f}gEGsZK;4jH<@Y8$:#+|a)# xhDE`x'*OJ$H<K'Ik=dVZ9䴈?'DζL $?Y*R):I)ɂZ|t7l {(6YJFDP" _䤒Itt;xJ-2NҍY Nc$F^I$\w 7OLGo5ۘx2ˆA?dI~u $RcMm~M霁-馿Rj|F$ l+#KԒd3̧L= L vg}Fl$ uӜ~H.d6C#pu&x0沰l @{\05IB\.?$I%ĝ禟OTd{P/HBbY쨴xjHFG8ȤL1ܟ-I i:@|G!46dU'I\e]$^!o=jg6Y1cSI<^MGOJ)$ҝ=/%784; -'aKox #:$$GʤI; cI| 6X-``'OxI{HlVhter桛2I1!Cn.IXHt9JAiXH O¦C'铤mnzW$tMJ kEˤv+Goed$@!n5dj?{k$?I+3=Q8I$f1=ǂNqd0u,e#yvcI$5ņ;v=LVY/#T~=#jf\ۜ[3Pc/RI$s&S_t):dO?OI% d2սkq׿M\#ƐwZH礪ׇI(3i<8@L;SQq,f#]"[vuTLye8@pxsSj:@RkH &p $A6H#B,.d]|ĸjb9 xu}M=G4-x?Kn@N>x{ipv7%9h0G))|{wat?L52?¦{k5w[#h\t45euJS %\^݇hihql~+]Dō )j#I9 NdHRgU,..l~O?y߬ -NII u[t 1 {Yglt۴ AZZ'p kO-\xo;??9Zੰ5a"< $ϗ) ǿRulk,p&'L@ϸqG%Hˮpk:7~wF릹:~$|fnnbO t<7r=-ӺJc^EfI}&S>C o{w^unqhw.o1L]v`}9a5ݬjrق$H@ `Bp=C/ JNhځi=3,׆;B w7-A Kg3p~gXl*Os8Q 7~ʀ q..3Ss?ێ%>i27cy ."S?Nw:WP?H}V6'@As#U8~`3ΜI% c~v'O}mf[]{!o{6ա86lȏ1ͽA]%պ~c>z\ P-F2mT+a1FFG=<+~gU)vcy;tvwDAݔ\I>;u"O ;I`=O$'D΍pkgk#op>a#?5\l7li,~{L_Smhö]] ;$):Hv",50N˯zk'bms_s}PXs+kZH=Ai%ÓYZ@S SALkp{` 78>sZ\6uk{۶D7:pkgqϥOԀdܥN@Ni 4Z?;jv :LIK Z=Ӵ&qAZ;ԫXswck=SV@w ZHԝ`#l?Tt 4-4Hw:)%j, s?kKC3#=V[]oy! `dk"bNH=Q[Hp.l&#sNf&'O%!#iDƣ[ؙT]ۀ#x<@\Ɔm6 sϻ^w9CA):;Zi:L@Lu 䒔ks`[\ \H hy.vmMs @.nָBL!m=%"ucT/74{Pk)pɰ5}muVņ~G6[ 'O?i= F:~7|aH:i r|YqԈӄM{e=87X>U4O!TCna]-j %OqY䍮6iu:~t8b;GOZ@f쎒I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I)W}J*uF"u$pIt`u'L㍡|<hN=hNz ,RLBsd{Y5ՏLĎH*ϧ>K^?EզX,y#_ %(:I~uPׄ<n??j& tQ$pU_m{ODL pVˠpe@@@93Ahc eHiՆ!i*>6'].dj5O2!vN"GM@<7o&48k+hGt#INv=B{e+ULiAHXdy{(zM5iԻVϺw0bI\}4{ ~j}Dȃ߸ԭ+ɝxO*.|I5p. !_fegsLhenqk6 ~C K];gwh6e)v/M| K~kj'᧏c"CC'j%1ະCv 3lH—P/D}#q&?*mfcH$$ӱljFkmw@J C_ڪݘts IR'sAe27i"G{`qG){H6w4: QM d R ^ZuO-CwhYAdO.rg[,!$ƚieZ]$6[2DJA̤f=$sA  ?Qew?: oyq6Ϊ^51*Xoe3{I:vWh#̴`GIZDb4/d Ήߤg] &'E}wsY ^Hf!K |J!vtL{'ΞSl q3)V$<աUo3cq:mCILVݤ󪃜cNM;#u ^w<EMvKF~r1cZs[Z8dzJJ/qh'8Ϊf擯oAv4i&#_"YV"8>lCuIBHFF_4ID.v-8dJpq1 q.&#TϭkdIC#[q.)UGt1%"E}*n#A v<8IoO$$Urȕ7\։I;c#F>%}4]%;veoD2)twYr?XmߙHL uq\apBHuN&c0Ĥ@#F};Z!4Q} poisf=h44994ֻLM -" xP;j $\XFcY:sNCdi?u 'ݟ#a$k["vQsK#Av8&f'6* D4IIXk0DkGoMZA@闝\N7dqiR2f!@icß sZc@8ꠦ>aHNYc'YpZS:{h [um{Zșq{i秽7&))jwhZL{PѾ ?z\Ƃ.YVL>^}6&鵦 =ڑI@'vI39$2>k[As5~oeAS4Tv#ڥuws`J'BQ5;D 3~ ,i#MQk][| t{-@Ѿ}!|n_z=A. 8}yqI}΁#^L3uQ%#㝵 V3o% q.}dD{W?*c  w+긍h_ 91mf9Do"J [3 )sS\c ӡѱ* u}=Eplo;oc?k@vRIBtLCg◪I#̤m䐏ѢKvCF}es l?qscм}7jTP` nXbl"vOVH 6jvA(-A%pKC-I;}߽F{?FLe3[p8/N/}=NAZhco u{ p5 ;ooj>lRSYxi N1sK!sw/b x=k;#E?EOkO1.>);I$uv9"KGs=KZ2v[Rڃk<mdl6Jo\Ywq@5HR5Si`q`H/WE -{7:?\F' xs>=w7d8vJ`l HP}"H=K3VsweoE40wIsOѩ[CmҴ9_)`k9wG? |cqD48cP'Q"Kr!MG?ܒ sƖn=~ +{[vܧi \A6)8ϴ'6"6c 񣀅7=D8QN"4 \@wvxym 1!s,2yE}vUd8I\jDSmGs<μ/JO#p4A5)zhZ'S ;6st2~EI}M@-t b>C{4%|eA<ĩ>5)P͗\4'ZY; I Խk..cOi TcnЗ]%{>ihϊEkc@T$OLͯlv)/zFV ԰ۊ-*-.ԃ=Ckis@vӫknzc[h$ Di=KD"+9:!Ø ƟIIFU:kG`AUk$[~o/M s>fY۩0[--nS;V.P ?vA%H)e- zL{?~UqCkk? C^#k<ߴ5ۆZYh5f8Gu gwŐTU[?} &gYI$I I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$K/~G ;zvAn seYC^Iܘ2;|Dr? cZݳSXk{!jL ·ȳr'_B(, a.:v*Af&Nݵ3S?G;H<S2HI3ARWX\j6ٴ'TapmdhOUw cNAIJk<Šqܩ8 o`1ԏ\_(m0[J) )F9HMÀ>}Q=9Ăxjjkp7yw}t$N j 3ϊU2 #?~\4r""8P.iO#7))[G0{Bx3EQ{D󽿸wC}rny"a :7O21> bIBA)tK^;o$@څmv0.>'qJ[T8-=:Qh9?ŠvkpOn)$;'ۀ PhH$}FǼ8uT`hgCZ?@O'Q末-I`?I {̻W̏&4 sHTHk ;H)i&4*M p̃#6"> u\t:_gx/#l|G󉟱p."OIK .Ge I-)-y&NHml: s͇;4jR#LN .0'H8j|/kEml8 ǟm']-jD$8LLcIHJw۲_$GSXG5 K t8ɍ4 )m$6 O'nNdll^N-w!$9dfdv6'A)'ANZqMseI,t /k6 sA$~j(Ƹ~P\Topibg_`\çlBMuu9ZG$%\z0?jA}"F~$\'q)[+n5nR[<, GE n‹!.񯒔Ccs™]%* itc0bzoWA5,LOe-<-f?_-U3kӡ & )K!6GoRO4N jR>Z(vArbUn5'^L5?t%c獭F;)@IR&>i`G%;f=);Ӳd35J%r]61Z-܇s,'#R.tOrON =M['Vk[{Gˊw[e;J^dh 2<9NֽuC`7vu'_Jg@k'$7S"@L tLCH->:tn&#qcY/E}g@Sg'7p#:v9R-;C^wEK-D8~ۏZAKv6TiC};(2s1w- 4}ONLmpH2OJL-q^%qΚIt:aq$6vZZ$HW8C{tswJL)8P:{|?q 1 r 8EI$RI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'cw4ϫMm8d  EX tX\_m{mrWPW#6d9gxt_EwiAnf!Gt  <3?FaX漗vm#t/oLUγlu*L$A]k$x{4J l` ~MxhW1{Ht֐ čXCHH8F'WL$mxv$| DsBFYQ}&5:Ӑ v:6QuM xw.by,fң: |xR1O ;L>S8  ?*HI[txCv>CVvItnh.ih }~9۝ޜ8FK(mim3'yso-khgBu#?!RfI͖ߩb-6 x{H1Ο}5 .cvݻb#; e!v=`抖[v5oon~@VL}c=}s\58Dq&-vsM8k١oS$LJ;CAa@nO' S-..&fv6_N[˶N;cmAok "5@)H $6m|hˏiIL7[Ku'mk1:l=}.9 >CםYX]; ZD3M5'{8L7zgXFO)y.-q#mJ\;o4ͧ|6ƿ#OS"zi;D/9.u" yP5o : R/{+m~gPYh{]ӍY k>l7ގmCS xHWj/!Ja'D1fA R)s7{nB͛ pq=ٹY1}MAh-:I58>ZHOt:$pNih_IK [Yb}og+ o6A'A_I B Ͽlk% \P<"4?"&k3SJMYayO ~{f1qۻoR\&Xꍮ;?=t?k%8RiPF_R&`,X$9A "f>?os-#d;{?ޅ;K ioӭ߹[`GdݲO}]hau))gW.aXcKMc`qDUedsk!ܟֆrPI5VoB{^tKmti?l6, gkw?j~6~mL2tH׼)d?TɧDk$MmO;6A1߷l~z--'͟mLie": ΍fbe5:L'C"HTDiI ݄s9[w3hn=ے$ fZDkˁi'Q#ZACN `8DmIH"ySu7k꒘۫f&8s,L״zmk]?^3I[RFH;oV t"A4cI?_Q$D8eJ`j4-NAJce6d#6D<2Hwk Zc>4-{]}oR}XրNMxO }%v4sBz渂9DU0dĸx̓s$x'iR;꒘乗R%4?7w\G3o/6XֵŤ0I$_Oc\: 5Dg@p:Gn?O,.uS:?;>?$\\?%3]k\={wZZcI]g)ӸX7x7aj$`Z}Rvu .  dohh[SƮ^w$t?q*~i{qX}q:. 2dۤH}^rvR>',0وklVI$B$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$HIJL%r̬`W9:qMOm-h`ېK !TGQv?>(h 4ߎdIs#I$,`ۢzAOўK0/_TĻXЩ BUunWsVgi ̃K!ZڤOi R#FgQHqARI]= ۺ{,f-jLQ%56MN%A48j CHy)&V~Zt$ij5Wn߼zcT_IAF tvk|9Ha:ujS]43 v^7=֑wB 0hPTB."?,P$8vTgOEE AkJD5KIS<)$v]-sF8*TeQd [9<C:-r2~_݋)=T(W/ ys))x'Z-fA [6I:Odqc0 d,'Jf^T&7 R5?3eHJmB9'ò68{ㄩR#1rb ԒW\4\h_inGhU±čs#B 圉1IYU]&Ŏ媫KQr$hAʺ72\#Sіnh`!*+Pg_Ht,s]iڥ;?B쩰[P^v9羟E2!W[Jrd0=3ē!<3_8S~X$J/lk0?9-Q<ЁntR -{XA~DJ2` 5O}/W,z~I2W*=N [ݸv(֏ޢVڝO·Oh.2tJR *sZ[B6WƶZ8~sk)h\q+TIײ_Jd+"?F=pI4'7n1j .qkj6Ww $-A"q9LJ)$|SO/$sE` Os6ql֟~#iq`ڑ{SYY#F;oH&Հ$$geDwN]swhZlvJX,$4A> %%MkYƒe 77M%>8w צ~><1"?:k} "h;'8omPK\ᩃ+w9k@ఊ`]$I$ARI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K[j"Įi]\[[3] ۽&^WX^KE r5DJOD~_zoHX5I'Sܕ=QϿhZ|\xx̤Xӆ'];䡼=;||?*rLDZMw -k@#lqR"xοOGI&xQ0~9|v:5;)n1{Jo/ӟʚ74pD!T\/Q:)( %0-qW)vb{T:9OR9%sm/ʔ% ǀ?IDj+ {D&/oTQ=Ck=)Q'_%5YjcXT6GƇGJmZ9R zyTIMvD'q H!9pԟTQ}o&gϚ"Ji(^~nRv#mR[ϷXHdb.*j;.G#m1Zy3z"AC})N0o54.^=8[j kEZw>) MN@w>)>"?f~OvSמIMiDmOt>I >$|*E|SQM ΀d Jlcd,F/='h)#kyLFO_gܤٍ[B9;?j|)_!k~)t?r[ ``.%"86<#McQt~N,#R/w=寂mwr{610 Y=x^t=OI$I$$I$I)I$I$JRI$I$I$I$$I$H$$K52}\auaIV:,4܄U:(rASBVkK$(X[xV}f?4K*8:H&B) 8R+\>-2I$@{`k:* #r+^тI欄tL}ƶL.%Kuh9॓t{@% Ni|&N[_Rt†OE`x$e?F_jI2txwAv(Z$[O}VD smKDFQ_ފI$¦RwOhNozԣ?褺gegHKk\A8k[d 5RWoC)$ =tEh'st8zטpHSI$(pl % OeݼPqj.&|T|RI&DSuycKZxT/=AmkwO8I2kU3ݨI&QǠO`/l s}I>5Eqj9IoJ FGo/P%<[aYɁdV8Zs܎lo2MZ3N#(2RhNUr-Ųt ml2H7;ղ4.cfɿm I#Żt W_-.d74PhvJLKczg:b)-.t7-9!r4s$*q]%I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$+K2g4EZ*ͩlj$Գ"`|o]n g'?PY#)onDovJ9EyKs{}nB`̩#`)I{ >Z$nhX|JpI$w 4ɀV{GrwQ')j>?Ls#z}=II@IUq1*łKl/ۦ5]&$}R@D-N; 4/,{~6D/I2)|h8㥓;R1OPh;$qI*%L8\_\I;Alj$IBs$;c-7naM< XSчxp?GLA7iz_;M%$8F:>%<~Uc et+S r y\?^p5`#OVjق16Dw?`ܨ[O揄wItK5  p" 0t1 |xfʃmo,>I*]'Hsul[53P|50<%1tu<~>?mΧ$l1-3׹K$D{Gܧ"O')4yOR1$`5OSI~9HIܩAԄ{vR=>)x$XDiE@8NYh<6O crO':$q(t/|Nӯx%R9'u9~{A&9&Ivjw))l+vD㖝y)*u%HNvNܚN?@&>|x'!L1'M w(R('>O}<y]I #`8{ =4PrLVR&GP}NakArr4qɩ}G+Xx6ik⎩$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$KZFbd yw`Hn@aǃ-tLkkGtU2@7Ul4H:$7O8o bzSUY|֊T:W48> dǼ|Ksx*kFW c-N&/" 'Lm2ZBWOſhtC0}tkʄ铤_Y? ?#KF} YG|jLtZxA!#4Yjw*ӃI'4k͏T:Hx-ݩqAsѣT_'ml5HI\Gێ8~JI$qmmh9kݵO[}zdiIIGĩ$Kͧp;,8E>{pY{gPOEy8?=XtAfn+?4胠J=Y|$HZ7٫r%ĆtY_%~ע)$)Z=GemnW$6n ޛhQ4uo$)u->ž=.oS?Ps8vBɸ}n8-)$F;g7m`G*4T* fYk{O뗫6MLJh^w]TGk*ߥ:(X=z$X#ܿ:`35'5(s=C)뭴$I蕣ۑ<1?I$+d4F{VXh:ݖ1G  vR]b~I$6? ?u?Ilvr+ x褃1,0N6wpUn?J8)]`-w A!'c6roݚLU ϫg3_n+`!."(\4I\9/f@8y?i;0T{Skp601p$u/nCD;x5 \DvcٱZJ.E!퓣xIer:eyI$C##lg(RF\FSj;v(\MGP$~z_c]$Ӑnvу)UYl)D@ȮA)/rY NIkxwk:䨩]eӼ:?FҬz n;[,hq>pt װŤv$C}˟υKdhg:DpU̓f>1'qN:Ƕ?FGcW*%(Kit<5B ve`; m*p.G.~}'- dY#$ݬ õWպw`خ;hucZ9בܔoY8N(8sZNu1ʺHA~0f}4R~G]IHd\0n]P-''0i'Dx |l%܏+ ߦZ]@hk\C&/K;[-kc{ k#WDxe]iJMɵd<7,c"?(0[WC@',iL]Pn(?mvIƟa\`}Y'h'gbeXN#۴+GeZÇ]<5l$ILѷ>(9Y1(=FDxAslp&t5U.v`࿰z~aNgHʧ=qˋ}75q#^GilMA&UV{aF4Ѥ﫿FcW땮0\IPWpz;tF 3Z+yN}WH&`jI"8XEI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$N @I%ZY &8A@1ۚuYs:'~1L tK IkIb`.\aGVcZiѼD)f g:"g7:jIqπ"hq.O'SSil8O.!:Gd{͇im( A`kV/IH;&ȷsA!aWމd?ꓤ`.pDysth8Hʬh?I'|yeTI)P=ޭCާfMuN)̩Ӵ'] )#ՌpC\גKI"SdHkmocJIj8sJ}`09.s<ޕQ쬻H 'fz+J/{jf4Bla>^樋QTm$(t﬒I):19~eC!rP[]_'w0c>)(NY}<^J铧exB><7#DŇi]C^H.JY?RI&C.mG 0qn81$ƿS e/VY$"UXw'U[_ ZF$dwky_{%qYd!9 #?RkD jeקÝ9EeUp>r]2I _덐8h֚ IWY%xB6eR#@29/D  'MS}[}O[~|`C%`u*fHLr#d6,tE`D ?TY>YgӰ82 yYI'Źi:SY0ܥf5v:t< D:v*u0aޣBEKts)&2,,G$)^,H(`l>vhq߼}xLqG0cٮdwÞ!4X`AG,eiOߐk~xȹ%1">YI$Vgݓ Sɿi~$W)1|I#C`s M?zr{0 'MSeS Ni <RI$ֶA@u6kDi>z-dyi`A%xLcW$G䍖sy}Aq4{Ox5\x&)<$ LWI$-lIT6L&enc6qJEDF9~pL$NC˙Sx[mǺ}8lKbD\ ?kp 'iJ_[Cnocds'Bk/~ ުKq|;,"ZtqI$I$zI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$RI%)$HRI$I$I%)$H5ʺ(I$(>?{jVGR4Z{$JBqj$t'I>$RI$BdRI$Zos~;v#PRI6kpa[AR3'U6dXǸ`I $xSI]6ꔫ빬 :IOy[g48A`jի.ufw!Zo VIPOic8l >M%;C@cCC1_Vm ח X%A\EoZ ?EbtnA%Aw<Z5}s-5I .mW;%U՚_a<4DbIoe}p˴\1VpYGdH}_Ū n]%:ADd2IQ32\CgI*z:vR,k4۝{k>(N{KI'TRIAw)tI$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$Kv}wQ:s.&9BΊY;\57suތxF ?GwJ I陨DNSYh?%;n~lZTh}R/5͗NJtc^#)$>2qc*t;@|xI^1h|%& nDk6A;̓W$p@q{" |Tc-b}X'Au#`J;@dOrjL.`"{{ϪS43*XY~LaI&N woYt%Opm,HyjU'\lk\u}i?TԒI{R%7o`'{MXpB k餻00I&I۱,ةYASXyi .Oa]$CȴyFeKAɝq-#l^}&49ޒ:4y5$J -kʯCNC;߹S? I$4T o~ڕxhʛ"v'H ?NJAcDzkKFD؂lvty^#!-9pcRIƍ%9`vGT_gpk~ .dpz$H4y:yL= N 42<; 0TI)SQcw;dSW'yK#,6$ b!Sxu&N>=" +q߸ dMO4m924% ؾ_):I(d^ַd;A=6=zTOmPm@]IuܻओJu?hZK}2$DxSX $0m:O%F(a\Nè$FwRCLJ%,CrqxZh3eԝ$x qq̽v L6AGԠ?|$:gX*f5BlpJߴxh_VlotT㗧/I$2\Zl|QFۛ {.l4hy0 k6s~ܒtzfI$T.0G;鴝cIռF!dhIFsx'I$x>6G#[f֗xpq?μO ( Pr~RI$zwCO͂eÑZN1 Dc&O#H0\=Q2NV|À$nsu(,[0tUfqI$[5$%HNyEe?in^쒸GPRI$u젓OďNw= 4g {].4?թ$Q! k?P8Uf4 DHI'Wwv)V9+\+ W{lxԸ@F0QY)10%:۹x`D4j+k:I,R\߈WhI&NI$EI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$KdLY$pYMoӨ!iNt{""Yq@'&.$;'V c`|IJw^<U[.4)e x:#%07r8IR%a<m-k kɆfI06'rzicI۹+DyxpIl0(L*-j%$:ZqeVnCg@O!IՌn yd$"c^ShUk2Dz na>3cS;yɫ5aVN2Ir1؎J{!ts[ÈӃgWP&0ci**}2IHc uPiwFz 8׏˔͐uL2{jUze< ?Ұ+X6׭~18Ë`ww"chd')IQ–R`NX91'O :9_}1"tl۹+HOb Qq1)kdDrV5t6wA J֎[&YwM)8H 67k5zn> ܧ\;GVxl8 ɥhba-6I&Qkv#^m sVqENáP,y>];&^@1rLLvWKa%VcN]oVrk`a D;.<DC IJb9+=-\GxVnliΔs!M/Hȭ#q|WNRPĿ8(Nw?%XKN t3hǎ 9CIB!VjF+۱w`X}#U^O,k)&=;p45*,ۮjY!T-8;dc8sԝ2tnL.tCU F:j6P-oƱz㗪I$%<8ǭacUNS{p\i,e&rg:d<4Q)Z hmc?}RY?H%%Gf \t$TiHȩRlkF kI o'WLtā窝{[B5s[#luX:BKelp_L/꬝$"#+gvtX4{ORI$I$EI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$K{鲸:mPΆZVC=> z .ç<1T,hcTv)0++mu9POQ{4{}vK;i7Y=&k˜ZAwRJNv1ո: S=Gi}p:0  )v8S> i^AO1l0AvYR]꣆2Z"Hi?cTg_HHt8!Ki$8y }bh@pATqc Rvˁ\z^IQt!><'P./ [YVi.~r[;xKS0И;Jf3$ꝁ7r'QƅH=XG*,B#vt{j>Z^j\@%3jn.o~SZ o=Dƴ >nZ[Kc{T&`$5ܷRCq$I8h~)8Iӈ{0i?Tn2b ؠ]9i$Z?9!/ v`t\PB (v\Fu "?zr&Ȗ,ۉvD dw"67^NNzDbJPqsdD%E`@2V~WO_AIִXt6H.>  KK1Ѿ} qvȘ}0G# acjtL}/4 ,klkAA55lqg~o%#~Kwi?Ɂ1?.&t =ZM?C^\$}wZ?yLӍ$[2 ;^JX3s6v;9-G @ G >%EI`kka~@70 I$w!lnOq*U0g.'Ȁ9Est44$O!8 8#W걎Km{omW<47i3$r+v c:t}9>BG mH.>f`@uLb7}3ÞVn7꒣.em2Ɔ8WMNpFt.sO:KkݳS?k; G)ZX}A@&N<i= LA_mmkMww} 6zon  ^Z IR,V@_^`}-v?4]dG*m5}7e!ǐ5Rj;H`&~-6?楍ygm{hԍT}aVfHoP5,31HMs!ѓI\Nvn؝z֘24ԙoILI<Ԥ}À@2Hw# JbZgj4Gz+v: v;RPmn󴾪b1L JMm? /mtrvUq)a? 7X:6Lyirȴ[)4DU$OT,ljdD)KT%jS~MuNkVZYG)G7I$I$*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I%)$[} Z=țk^?a]T-SKi>,tRq;}W uogst"dڈ!a ?|o]|]R`hw(hӍxOu^vꉲH7—]??9k\w{6Ƨ褫 53O0>Z '6>& JZ-ɤ͍n?wN4ThN亪,nh ail6?D⭎kAhw<{7$ Ckdn hC& : 8*Y@yKlʐw H}!Inq-` GgDL{ߚ:֗8;Gd'䁩= dNdwN;vW6I:{Y㰝FhnBe>ϴO .\[{|䒳mݹ~_H{˼4" $'Eւ%GTdQ#gZ>^,w$$GiS[$P<\ ,cPr.kI32T@k Hh)m2?@Tޘ7RLB3s^k۩z9Wp06I=PD'eh)_kxS-H׎!IN`ˠD SD)KXsw]25S3>Ҡ]`RN~+Iϵf`ړ7C'l}eTgD4#@N9$A2ĉ=3ZcGzY'I5r\HD g2[~2.wS\" A:5HyȡH,$ӱ)nK0H=-wq0X|lit7~;wpwJL5:tn`?yKsFDŽj1n>i<9hБ(Fq;C3qaZxu Ot?N \ B|@ۧÕ!+sGi+ wy<|$I$H4I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$~}2i:ƫyMGH]mKɓ͟b4 !UuyM "ttv8byԄZ?N3 I3֝Tqk7o>ɜ= =/M12Ғn?I${^W[(elxsIԁ›]-=!kv) 6OB?I-RH1#;! XvƿJvTA{:d$8ָ}bւǔh7;WQI$E yeCZ'A&~렟!)Nv&(q<8BI! Pkq;%!uCW#58S-ΚI( E'I$Pnǀjp쳃ÉR_&tt]M"A{4IV'IBEG.'1 2a `#;^cBCrV:󟣎K% (Km!`s`%7f?*@=Ga$U0ߵ<DO<\G1|#y@D(S̨I$C983SiE7mQk+H%%zCE)IDTۋ@ DkINnϺ$}c0v<;J(H2~$$,'#U&8 oF;>>7j˛@>:q&r?4e[% $:EL-[;pi+CfO˴>3uxgPI):]?da0%yIBǭ;tq$OoH6o?k@X(οCp,өoA\r!b =rF}ԱG$ikTϮ;yԴ <{ȶ3jT97Sփ>J%4Y'l~v(}[t'^JݣZ[Ξ=dmA>ޠng_bY>\~ 5'iJckkw4+ɪbstr1 h;5Tvr02͑HRLKZ2;Zh;{qڨi?<gN/86|oRFj7\L@3>%;O3)$=X o{PKKyH*qp[=X{x5TBCeqHpahIOڢ\CZ{H"PˬCy!gݮÖU*Pf5rЙNR k{Lwn?@7@Gj]HvUmpcMO*O.1xh.:_hvݼs?}\jaUc 3,v4"?z- `\&OoܚIvQ yXal);ٵjOpB9$I$I$$I$I)I$I$JRI$I$I$I$$I$H$$KGVC7c. iA+Dɫc#4][L"D"hv4~QMtR~@*em>ݠm }?t6]dwN2W<I%ĺӏP;pc]I%n8N旴8H#Umuho$U _pN5enOPH/I<$IH Xb4O ?oq!$D~INE-u>i @?yq mtLvuY%YX"a$ݾ#Po&eaǏ {l' x5%z(~$ 78{_{Z:Ci{_fio}5I 6o)$ -'[*2oo\ST4e6j}x\*I$ 95ﰀ{G{_Ԭ'rpsm|#ܒu?[bJa.T)S#Q%0wt~%8> :@t"$ dRRBIm<qݛ]&'JTKv< j ŷN %)s܃;-m 5{B{ݎh>Jփ_RTIl/@ۼOG{Ҷ8G.)i"_9I2Im-Oydy_{$*{!%Rt)9 G&0AT ns'۵3m,v')(n?IrS"#^2M̳B(^/e$BJ[AQe!Ér}M؍O%|$Ivp=|9o( 1&f̭²D@#?6O"%$Ԓ˿ݾGi  .KCZxJJ}gAzVI$sC൛}߽ՙqJ{;6RW >JRDYh'| "eqBØC ^x-#?I$d̓"= =V6@4HҢI% ù;OA?VP?k–Ǒ95n|?>n5%RbVA&-#e\8jxAMu%W:'$h%u#pQ1T 5Ƿkx08O5'I$ͥ?vAoZ憙C{6uH *ɟO)2I&4;\ʃ u0L p8A[;ĵA-%ppOT$bE t6 x%Y{"HG!GEiC'Lem#ViW:so,'8ESL.75.,ӇiI$I$Mu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$A%)$ZKr PKkIkKytcيݩ%Hcl.(h3*^o [l@#o&; d 'kkn.?ulegx;UoAXcYXi vO`elc@q24ܑh]cXɏȂ9*tOĘ8hIQ#gQAZS_&5a^-uI-$ <:`U{n='T6{1i OiKxE׈O@c\jf&6e_UP '+p-p ;gX.c:Ts}>ӨHVtt]}'Mcih7ҵP߻c %;I4pǶu;4)}ʾCdrq =8ZjVi {O''߷x(k>&t GqK`ddV}J:0~M{%%&SgX֐)\ 5 _$II0jpmg32+i&lg>\FAH9KpE`F6;L(W YԫkM`uE{כH?$j^w$J"mHxd=O@4Xcd8W<!J%U-Q>@$tn6ٺC?*vyWHh w?#9@qF2 HZloj$3:)Z"SH&6uSq !ˎӸ$[[kv do;f+uwhtĻ9ڗ%6QǗttw&cĆ$Ct9CFzM #06gRۈ%.ZR.!EF;6g;a4GNuM W+3\线j At#FzJZ:!H90  iRŅ)uVh v(ӴpmOc  hw9[NZm@4mq\ | JHqc|ل򟠝4;C~p7|N9[|>ҴiTrD󸓤 Ӑ{m7G#qO{FEt": ;sw%TA&R܇t Z^xFnʖIi 7]57 ĉoZ#"ݨNL( Lẁ?9T4ܖۜ[` a|Ƴ^;jcnp2R RP<xKv?/*pG(FYӏnZ^-kkLDA3C45 ~\H8}٤ꆻi3B}Q6Gߔlݺp2#OoVR@di3Ish>lz6$ iLHJv| ōv q5J>pO [˝Gcs&8Vԭxxf;4uRkþ}Es+ ٴ 4$kdIvcY#Bl'tBHG~dRioW#vVAi4kKĖ.s@?`HB;GtHʱ" ~IVH ;KQoNk``icG&Etw:Ĥ$Um^"`.;(A=@~-{{ ic(BLM:pM{֖kW)lq"\ 9@鱄X{cob9Grr_?w$l{)l \T7Y5u<Q=ڇ"ףokI$n|U5);Yc_RI$I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$.Nau/64OstHWLX@Iw_UGsS*.=LR뇤Z}9WR^]4=̲H!Q-_Fѧ*5`%Ե\$/{[CdFjH/.bCn ov=$Yr'23$F j'Pn$hH(F.x?Q::GMYmb9@a~LCd2 piܤk~BcӗK5uWg>J/L 5 7"R=9_h?5Bc;Ҵڛ[X:s>L)5퓬mf<蚗=fo~5h3F$"i1ۏ'>{ZDϽ n;S7nCEQ<& l [q\wƇcYc\$?5 c-.sa?ma% wةSkt_Hql:>DT#wdnv֟hoszd4h7Ԁ0'?ww+y.X$YR!]wi%Lx蕷·D{H1M6- =q"uN3$1{RFAꕆt1s O%'$N-ԗ8C?iZl8Dq}f.{Y9dSSK:1F+OΞ?g&? CGnyh-)]dI0n 1H?SoaԹinunԸR {SxQHw w=AzC$01j 9$%IoLǺ= j)d]`s=i'qEA<.S=[@ @)l;P8i y}KA1Q ;tnݢ'AAM2 NG~O*0c1H1F؆F?=} =73Qmck)1;ILB Y'O'V׼9Vdu(Lͻc_KW$F@v.49_>n=<PaddikI v{2XDs#I74mrIk~-Oc]u@>ҮYs>yqфAJ)d B־=>liv#M@Y:A$?j+vMmih'҉8a ;[)jhnĔMwA Oq Q 3 qRm.mpM \?4MtB*It &Ahi)CĤ:y'$L 9vGpy'ۿraa2Ht gZƁχҳ N龌S׷1p`.'&\TY?y&moKO&1ڗk\xTd"uR3`83=TGaN|gVnt)3HL[v䑤0A%T]bOiR)lO>)D4>j_htF2;f@Jc<~(R q Ʉ-Nw?!Icq%.ywEefAIRZ/u΀e$L1lGNC 7mb$nF/!JB6|N]2Z9HOALu|@LAD iwݶy_߱EP#SΒi$H~ꢥHN BGIDvRebׇX~:k/i#?_{IݚE4V6cC:L^&)3oo rfFPc\oժV8,s< 9_no4>[)>pk!&{ALQ`"{{k @ϱdvBv \lpVHx> .1Vŀl{k"CAq̧;DwPnp~ n@c]SSY&B-_*c[I$I$$I$I)I$I$JRI$I$I$I$$I$I%)$Z} 0WSYպgBȮGW[G?5'>sDKMNNgۺ5 m{E[{_&SYIȷw`6#󒴮,10H<kH[;$U`pxi[X8?(4tRhxRj\ "pRc.%X&]e\xh*aoIWC8 c@-p#ƻnhs;ΐG,!͂`w*7wH0$K\Lslef5ǟSݔJ9I?Lt;37[MvL;Hf֐$:F =-:)f״zz4+$rA N'XTcw$qnf!@{G܆^~Lj=kO2tM)Gwi@gNUk!9׍?qV׀Hi v"S@5mhyR"uq|h_PXK<m5.=AUX#Y5%A4`-{7OB{-Ioi"}&_K&tʙtШ"IL|J pke&Ď-14t-;TѰm)3rNL`gO\Ip2<Xiv{a.o'w!;)ĸD wRX6bI?JlU(d{}RA_=%2۳u)9ű04|gTX}@Q f\Ht 'ڥhutxm i}5.A$xNI'@hI)n'O~降a'd@{vLR8hU : 1Rv5%)"pp>;|KA;h>im c~w @._='X7nVnh"tJ\5ɀ|R۠$6'_R> HD#(apc?C"a2  vRjN}`s3i^O"#S4TKwOi~O?I!. kBRll`4<=J:KK4m$NveAJ?GC-gMI11&{%1{fd|l5??;Nvߛ37e۬@^JK8E2d>_I-$h`ΟPsEɘGoR-`p4=5 VBGpc1Ξ*,$b8M}NkIi 1 Oo[):A9L -%ĂNi1DeLI=yӟ䩰:,^\jh=![=hd(?ϟ 'I$I$*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$蔵6 unG:\Dm$ӟֱ![pPXqa̐UwZ*.s;dcgqp_e}dvF(Dnmi`p&3M`ZAggAFdSk qгQ>?=;%xŭx:;(y 㑶Ii1lmxG5o3ܑ5OgZֶ-gL:t=g~o3X<^?5udC9 9n{&gks'0;ؑ K;{]";G9<{^ygK-|Zt[[X0?OCt{gw#ՋuPC[N}l7FH]>'?G"_A`Ӭ]JϠ$vniU3x":BWI 'Vg3\yp'_$X-hvjK(a-s@lhZ--iF)Z_NQhuV"g)&trm$6: 78@Ub $~kTj%i0xjJb,NВIQ 8*NL!5ˌ?^C\Nxp?ڝ`ޫǴV8kJҢ" K@%&"=0#YRf3C̆sKţWGuUW 5?yKGh%ߺi Ou?J?}辨ݴLfk{v[`pҢ+\\^O!>\;[.W xCU^톟 5 M;IhDw ⦁g|H|u72"~qA't,-c9ă' r)\ g N8^y}Ĵ}6-=rq8aG&Sc1+RM<'DxQ7oh _"idI xamU~#Xk|I"9`k$Tw~U;@x~ G1ʃLƒTv漶l5nV* e-A;iդ{RL/'4 FC`vԨѵr2=1@cK1+I.c7l}6`\!@K8Xd8& mb| 68%E̲4.>׹2&$pPŅkC`pgmxmAyw"?7bsO]*IcC\ZuS-ɟP|;A$'nSak>X.;E ?G| k-}W/Li?8>?QK3r DsbֲAs#%͇n&ߘeD ?7_5Մ=7))DypIÆp{h%b#El\\9HW·t!`kK=ѯ䧱$A,IR $B[7p|;-%ۧkA@q:ߔuݣ҉MݜOo)KIEĹT IKĿB}9htyMep]$F.!i-^x\H79J:?Ry}~Ǔ1R:5y>ISak|5P9ۍpƶ@$)ɚGwyJ A ޓC}6n􋿑J K-SVw F\\`?ʈ5mC:*Al{gs@/ R|Lbg=/;L|6[ȝxGIrwRN~?aN?bfN.htH2lκzE:5I=f:ۻ9!F^7%HozwU`OmmMBumJa&e]&4m"g3\@|'DP3˷{Oo tOC鏢)eI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$X,.xt=ѻGծc6$ %,q4#OIB@(np`"AkF4=vCyD0lpOOƢ_yvG5KA1=s$iom`߲v89䦮RZ֒LA-k:7Nsc %,X #e25AKp%up {CejEMsUm"`kuˀANnhskZ GqPƼ:HJGZDPn{kpiVlq:?4.{iWs  đsln$,棘 ĜT4Ұs,.-%48c%?T:4sA4i58:A062.TmvmH0!ZZСMa\7rI6E'öC:]?? RmmnѴ4Fc ;1v?IKRNdκ)8AAƷӐ\LdIvG?HyvT7۬ 5EK m{u|rALʍi }#2@;kw3ӬQ9X݄Vi5V{vPm4;{08Nr;p ,Ku;8Ct %3788hOD7V gQu-遴DG |T 6.֝u$$L!$ZLlqhl5$m*4ˣJ^1 nqS.xb<unIx:D2p;&1i#i#q&uO]~<>th]em<Mhs^ֹſmsc u@{͎5lj 77j-湤O aC v8tD,oq}O's$+_L!G䢔{@`k#4isn??=!dA $:x ac n@o.ah'`ԃho}6nvHhq0tJ6]9q*AB^GvuLvdrBacq%5fCHBkcwKp;@\ؑzwĀ')&XhZe@o2p)J>E\ .w4LT]&l43'9I9ή?t=niNrCyݩI?1t%?'<OLxxMeWKH%ӱmtan׼{ZLK Od%+Ry6Z#O.51R$\,o^3HOb.n ,ԗ<jV6Q^ր{rm!4m=u>{@ I;Ҋ-}nvIL?9[>_MG7855ǃw~J7w tƦk-tԙ?5(]OR/ asgA!4%A{{$j{}. &_,iH'be@6ZF3v 80h-Iѣ[E,I:hdPHSm3cdz cIC=VN0=^l {&!'Kp;Oax7Xln̆փ<<ӂC;A^ c?o0 ;Z?GMiO#Oh=#^o$+ycXD( w{ˉ='Z#)fh|Jtm\̀ NC8If?5* c=vǿ ~N[Zw:Ny%/%/HvLlxH \GI-ᡎi#`?RݽޭO@Ы&Q퍢t;$}78m6I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$xs1.m;| __Y:9]eM;wr$vw>C i?)Au;kqӹa<t "l$y}$% AځF<kx'ь"9Mku6i w-?C{nH:AEknqt qqh4sR}v-?*tA'H>ݢư6Α<I2mo+n~ԇN-H }9D_XvuW7a3#%K4 5 aAԒHj\l{iB)p\[XwK?8㙷Y>!6 @&ծtpuJD9k\$s<'u`OQ떁KH", 青)"8@Wت(ZN={`GtpLvZ?賶IҰ~h`'SošBk-ez0'Yh 1 FIԝ|H8zqPA(T^vN\s h.7vcc]^j`XN>%fsR!""4:gAm{<ZH U{ 6v8) vDj1$hd^:bSp$5*R`%J K<{JoLl8R-:h3K6\z>& WL4tm'}Ўt .7V'%y$kctE'w̲[:G^& &´)t5!:ΦTXǶI- PcYcsf B~h RmNj wmARd=ݧ~wc:jM؁L8't5kkRbZtN_cv>A})_C{w40 6.ح-RX`Fmy.v ? {x_婰<{?Hjձ;_-~DxmjZ րLjDm@ HoԯRktcF$[A{(k\Cx_QOdra 4>X4#@4Hch^%8pH?a2vǞ^4uv@'3Yj{sq>SC̰8|-ߜo  '2#N\{ J6V43.:Rq xw*-6&<zzAtfJD ~C7ݦmoKh$4{/LF|#jf'IMbu)$!-n }E3 '؝Ζa3_ i<~k$p?9%vD @QiLG? InH~?\7lH?IAkduKZ5H_7v\֙=46Vdo-ÿ1Fbg ۶=likw1Iheog,[|y@k$HHPpg(n꡸lvVKdthh hΨĵаj$gSBNId%}]S ܣ ؞L!s }4#Oii}]1[$w$&hScaG*,Oegaǀ=?3 HS&`s^qebN@<%QDZmhC2bj"j#ݱ!8<|5 *mpծգH?me5Oq9fuWD.$uό&=I)6y3I{)sI3FHE 6dέ\IS\d"渒 ?Kn-t#R'wxh#6<OYqt0O?%VUXJ(%eӤI$ %$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$6%]9i!7I?r`mrKFԝoLD8noJa67s]B1n3w[}䇻hxwk⚷;3:=B<yHUg&$'Ni͞x?Hڻc6{ IE0'D$kp5.p rg>5Ʀ w0HkZ`NKb%إl؛AK<Ü"D_"`* .NX'(䆀̀Γ:uVzpoiGq;isYs#R$*PJO# 9$px!'1 58p.T 5ݠ8 A #Sn $o]H0xHL|Oi$"?[\GCOa‹cJ A.iވ舘{='Pu&a5&u76@'h[Y @CK=Pn{ GE,.`}5Rf1 ս)I)nIxsHuz$ ҐXXt?a`.3}H_CZ .?h)mZx`p;#g>IXR٥ς ?w09-6$0==߼|o868YH~؞]'pqdNߔgTF j`vtP>Fu)=A0IZHG:Fܩd8Әٝe$A$9?QͳHg ` U9d)8HR)Nh G"Bg@?,@:{> GQlxhg I-2 ,L 8@HZ#>%Dni.$m_Sh>~`sIHojN=<~s;4LNHO}|ӱ:dp~ְ٘%ۣI'$'GG7ih"%ӦGu$ i˚co^^LѪ^ǓƻInG'] iAx;pd><ɴ)k[7iYs m!X]?b ɀ ?4iT 2 N,qO(۔Dƪ5;Y~voctDxORmw.ߺRILoh=ڈ@qLYO?V>3\ ė OX~jeY[@>zX0Hp@h%Zq%H%6dDsA rⱡ3=ΔcX|x+ؕvN3! 4F Kt>i9!-#}Ĺ͎=X Ǹy 44 9>܎HQ~m6L?1#s[.ɫ;LD/%<9_4UK h1ksFO~)#'2s68FKh?֤K ;oѮ'e^+A -Jv=A((isA沵wq'!ŖwheyKFzo 8<ptՒ\h Dѹ>3e $>yhc\$X`iS#r'` eMiqh.`GٵۃG>Wbok 3; I eD0{O)L$p`L*N M'ysL@ [aqqAEK7]qਸ;"< vڂ"h ~ 5җiO_$8([4WvJ'ΒpH Hsē 7F$kienYE5dj% cϔڑMBzoYiuVv2JE94I$II$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K葸Qj o[ˈhBMJRPFߤ$[sa5@}ic- 6' =+p `G B#c;MIN8'PcM߃S L?QFK=>ph&68EkV5#Xw: bu JoQӯ=TU 4!(E=gXokKA yܡȉ<jIB4o;6ʘ8>*~'"<QF Z`)`Ds?6Q!* ;dd&ƀDL Go)/-:I:ʘ"D b[5)8kٲ2H:D=ɟ>Six)PU!1d#1 81~_t'#Ğߺu:R+FG:=$ېt&8NrPΧ˰Rh?~Dh)hKhNsu : c% ?449RZ)h mN#2${)yn χP;I=x3vPVKuB(iѤNXlGdy|r|R,ALb dR}hj}diwJDD% *{ܐy&ycO nZHϊX**ՁsHN?堈 B}[ i$u9S /8xY'\6O%Z1ʔ% @${*LfFƚ8zbUc^KORUāJt>_)5@?jLl.yVRi$L+NL:S55~;c^ȁ4l-\AM1 ~In3cS kX8Hw.ҴH0$wQf '1'\ZbԓkOMNȞ%-Ʌ~4 r v12vO??)s AXΤ5q{yve ٮu-\8ۿ-~r#es&}[tU¶e=BQ>j 8O{Ic{S5I:1Rcz{w?{S"D#LcJղ0u&򿖠~4>>Ӱ8K'ov]F-n&LGGt$B]x,;[$LL?JcpcItgAa4 ;#k\ ; B`,.v6*Vܨ9{%.EI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$An_Ȗk+  hx0'_L_k 咓.OD4p>;\װ}L:9? z8 (wRBN :}>\|(]$" }.!Iv = "ԝ2I3n>f|xJJ$SoLA~dXp<{>e U$'Cfe):7NDFEVM*O7)q?ӹD I6I:R<44Wԧ_Q۹䔤I(wx#݇'1R?=u$$JTKD#ǹRG܍O$):dFQ-ܢ}̨i]$(iȞ.H3Ǐ$ᜀtRMI~L`.Ko9;II$2 }3Mϊl>ӰI6IP1y_)9x& < ))t'KRtHGG0]BI2}:7'˿ 9RRI$gx XOrDp$@IViI%ƑAcH;=?8O|: U$Jfu?|]u hEI$u<6٘=ϊ,Fw)u> Zt$:7);_Q6]_x%i'M)!Ά])I(IV]^> [G K7%ZҝCsRmg$2LHT$@)JRK?%sƓ>^ {4ۦhI(!MN~);dZ)[BPI; |sk\}̀TK5w2 I)H۩LH[cr#Ԕ)I%'mSX=n = }+h|ȝMH<+'I%M$ARI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$Q:vP=sDteUy{|q$Dxx!%$VEz'z($IƜfRIGY+$%FL@y:]$>#V:K=[o:2&\I'%V:Knm'Ac|*C&c p%q$wc )$FY2,n _#7q2)?#n<"K i^&}d8=ÂR9""ϊqt%qC"iާ"O%Q#6@ clT]pԸnG:\z[g_#zXpx?")Ӥ@F8 $˷&H4Do֋h>HQsO ]D~i} UG.`r:{NѠ\ps*cCx,pМ0> '1԰V6du:sI'ħ9AvjV ~iSZ*÷J.5k$QsɀωL}56#4 }@q?!j! T8~?kXg8밆-%;}|V*#tʟ5qE9O@]xJtf˰Ar_k ΊϦ8엦}*?ApSx>B4Ի2i^S l2{#w><P}OY8?Lω!PT]2 x2@w܍;x$jRjGLp,-ݣT cxj{lKԑ'2#k5OfO9h8V_hh#E% usܔ=@TI#Y5`ΉzݸB_g!#@>];ѮGa64j#; Nz {gt jpw!cxyjpgCq;n=4gĔkcS(/ȃaOAʎw ǰL~nȩy,G$owv _%ITÌ1I)7)v vC/l_hx+O$'|;5?} ш=C1vBH#ݒo?4DN T kIVI4$Dhx&#XH>yNII%<=~{j;~hDƼIV)#I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRd$I$$I$I)I$I$JRI$I$I$I$$I$I)II$I$I$$I$I)I$I$JY:I$I$:I$I$$I%)$I%%-$RI$qcsl$EnU2~*m UIp12I%h<#ygn3UI>CRI$гc {RI%dI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$"4)$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IwIJI$$?))I$J:}y/I4Tm(:7ZCkD[ö~IBTZ. IA=.~i*4ꥸ*#YmziI NIAJRI$I$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Q*:rJ.xo*A1 wV4-u2I;7ZJkp­Ь"^ t:Vlʁ5^I7fU*nWK4 r>H-) &T!(B7)zEt:D!~)BoTHJsCHGTCO#X:Ψw Ap4Rhh[ym:~ƨa;Ȣ.ɝ??U`nBe@^|!Jd[k~#2+2#SWntI{iY cv(>>*[Xt""m&a1%voܠ<|9@}$4Q'AA*nN)Z |i*{C@QZW;Z hFh0O+E#V⍦6O40TЬzoAUA`E] JA89r6t3V{{ya]YPGf? Z(7=V*[4~$[\L%<0߱'M"QPn]niAgё+OgN!G=ua\-ԕqkG +Il gDG_(Hb8IL(% !I$I)t'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$iq׎ԥIԒI*nWC@$T}7x%;^ڤ)RTI*#OW4`Fd^7++)$TF)pS\tTIsl!DJΜ'R+tM+$9Ik>wx&HpdzHb=ji{y E.I($BI!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I+}Z ovI $X 0|?CCGuU )k&\ yw%GUP4h'īaPNmDzm!2u)ƒ9?r)5%Jϝ`|m!]*~W?TQw ݺ9TCCi;!ho͸<ʨ ̰H6ʻjh<'sc"|Q\Ƃ쇷Jl<`C s vw3eޤ qx5 $8&$Bq@IRk4`d&um&\¯qۘT@2Gˆ'h.U17SneLܒ04&JgKF x!;SsfTي-4(ukY)j?8;%#=Ë0G-si?+pBn[7lh->jkCs$NAAs JHLJ0:or+_˘}YE'O4(ǀӫ|Rȉڒօ6HrZkqyn*iv%KaGI(:!8V ^]x W]cO{g5ÔT}CXcv浍$Bn4v5mN[xsc#KF:[e$rALAv[ݶ= H6pICx\UlZxugݒYXWKZ%]%XU7kX@qxYuvWNa n E$JHDT HB'LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$+8>X4<-.]Z44\U{2cb۲8GLR46_ALM$u]ڎ5WCyV%ޚ\A %-fO GRL1䧑{-Ѝ=T)40ꕔA&'Rǜ,mZYAKQUh x1P:)[YLˏRٻ9 Lgw)!cA,`=έFp x"zÎ#DsHvie]*^#3m|RST^[POWx6xp|R`i8Kс$ϐPޤDԽw8=+`>*e~xHDb17I'C{A&Şc'B xILX\GԜ C_a>$qr%41<m"]iORG1f5K~)n1pMv#CD_-=dDF+iX jTWP`3> Ko S9tW1kh=l;2"; _Rv+ti!]X񀈍9udO,l&j8{C8tv1բkIԹ $#"be[p9+X@ L%|M%uxUz-MՒw0#V)$ĝ)6Zxv'0.Gj:'Ο;{V~j h㳾2.H6VetOS&-p}l>ߎT0q‹wV74XK%4L&9?փNǎG=qe#] $l~8LX%ăScÛ>*M]LoPRzI4GE! iV0=)z-hMtvhw,<sPw8HUx \|P\Ϻ~CCYCFߒf}ԘH AVA3WC,VR6DnXL >h،ǰ3jl5SKnEQէD>jly7K۴yOc1us!Q<Î* ~)Vc$WHKBUeY1fGP&&8"${^Ihh)R< Z>(L{̓cB(]M‘^1碿Amho,"]awQvcIK(oDWt[0pwa! S rЬc:Zw'ôד;'YCyn3m$EMH >\r*94 9Z 4` 4t$)f3x*^#S&d*6q鱻3_S7Tj졝p .h?ʛdq; DY9Mv6EYw 5brOkyHY;{SϏ uV$QU՚]`;ոPBV[kvUY7%Sk&u@b!t\GPv[:tF"5H2vO ôp- 1Vi$.6NS3݂?+l<ө3N)KnˀJUf3cTrP/EcVf0ۻ'`lnET ə) >Wqz{qp:~(BT䪷侒H<W#0 #X/-r.xiih=ggGmM$ZMUE5.qԫx.lƵ$lsyV^#>X wؐ=]!^{:úWU^RYc-g⪳0}yU&̑ȼo1߂f;6I!gCd~+s[ӏq%[w `e:s^:11;WCC삲@4PW)w8Vʥm CuDV'N$DŽ,sӲl;IlVPeܐO%e~a:HW1Eu |XT`ڛ&aiot7\8Trnp`hocIs7GGye g,% hZ?؅6f;;|kCU+sȰ'Ct+ƒIXY6]i BlG;*"Z'$Pt12 ;8Hc`>{,n4Є˯^TVh.=2͞]꼷pr䖕& $p-0y *b`dI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$.Xi ZI$s tqϊ H)I$I'I$@)jX E5$4J`e 䗨faggV [%.be#/Q#vZt"U6DJIs$'Dflh#J%t@wP ,0a9.cvS$L5g]RS)MMDpI<NNݒS {AMkQ>$r{(x%. RlTC6QC  ~ӯ%/!)L)jƷuRAοF8vФIS!4̞Q=QsF%. DG*L`q=Jhh&थDiO)ŲxL3=|Hk ;!=4:A Lۮ$Dt2!cױ1ex-ȯ c\Z%j?ݶ[1US4Y|RvC 7+'c{v;k*;u,\^,pO"{Z`+ȯV=+1Çk U89 "ƏH-;c[m%қE.JwMDQXbCe$:%I5Q%gvA:I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$p $$d- NvFmbzqğI 5h7K" @=uX044D8h&`*L"G(M4 pNHײn BfOd :G%<{@:R {❵1ڗ|{PRSnα?rF c{*M4F08S$$TU'jW\ȈIԫ'U5Ǔ!ŎhI3P`y:)an؏PSXc\hY|hzIM K[7aXE;Uzg̣0{J~0{P[AX7:cDRő5Uźh~8(-0qha"R[,ݸsYqd4_B\֝&WnS+fK_݇Pej׻ c8A1myII^45sh)WExx^trJ% n>I<(۫$cǔRN؁SV &8CZ .Jt ʃHu7);@ /}>otv?E#Vvd3YDR;`y:"|uApcfd @ $("I{ ~? c ʛX"vcLT}Ԙf4wxvZ)} &0{!ipv(u<0Cg[AdsI II2k6?U'k3@7YkvGC}oh,C&XBf~EtǪvx JXlqƏ#EVSd,+4.GsELiR %U41vX"X 8D kpEx6VGpՁ]GtIUSb]Ux8w>D<{\MiuDC]T=S *ugkZy%^uN.j8"!lՔl4OiY}XCÃUk72l!Nk JeB{]EiC(,~ߊkks"-w}{ !4DLmg"~ LL9'nCޅC$5|35a9Mn>E!EIJ%N⤏%HA}ZBMeQ S8ΉkQz,i:Nǹ |EϐAk*F|!;l[l@9 BBfYY˝kMnil'Tv(%yX9&ۼF|ǂOE @kDj#%R cX*m8ֲ?*_RvqR[ >*GLs=TB4IN;D0*Nmcmjz{N+f{LQJ"kP|Cg:b&clZ7?#^*^UKWxFGk@,58>J=|ZB5=/t9K* +%̻Aۦ"cb@!YΚ'hni#[Y\84)c}7IkL ýd u'M=54IyRXi*ޥHJ/$ \SZX-$<&F\} IsVkh;Xe4뵛